Journal of Medicinal Plants for Economic Development
ISSN: (Online) 2616-4809, (Print) 2519-559X
Page 1 of 7
Original Research
Morphological, anatomical and molecular
characterisation of the leaves of Isoberlinia
doka Craib and Stapf and Isoberlinia
tomentosa (Harms) Craib and Stapf
Authors:
Hadiza Bello1,2
Umar A. Katsayal2
Aminu A. Ambi2
Yusuf B. Abubakar1
Affiliations:
1
Department of Botany,
Faculty of Life Sciences,
Ahmadu Bello University,
Zaria, Nigeria
Department of
Pharmacognosy, Faculty of
Pharmaceutical, Ahmadu
Bello University, Zaria,
Nigeria
2
Corresponding author:
Hadiza Bello,
hbello855@gmail.com
Dates:
Received: 18 Nov. 2021
Accepted: 17 Feb. 2022
Published: 14 Mar. 2023
How to cite this article:
Bello, H., Katsayal, U.A.,
Ambi, A.A. & Abubakar, Y.B.,
2023, ‘Morphological,
anatomical and molecular
characterisation of the leaves
of Isoberlinia doka Craib and
Stapf and Isoberlinia
tomentosa (Harms) Craib and
Stapf’, Journal of Medicinal
Plants for Economic
Development 7(1), a150.
https://doi.org/10.4102/
jomped.v7i1.150
Copyright:
© 2023. The Authors.
Licensee: AOSIS. This work
is licensed under the
Creative Commons
Attribution License.
Background: Isoberlinia (Craib and Stapf) is a genus with high economic and pharmacological
values.
Aim: This study aimed at establishing the morphological, anatomical and molecular
characterisation of the leaves of I. doka and I. tomentosa, which were conducted for
proper authentication.
Setting: The leaves of I. doka and I. tomentosa were obtained from Shika, kaduna State, Nigeria.
Method: Morphological and anatomical characters were determined according to
standard procedures, while molecular identifications were performed using ribulose-1,5bisphosphate carboxylase (rbcl) gene and internal transcribed spacer (ITS) DNA
barcode’s region.
Result: Morphological studies revealed similar features for both species except for the
shiny leaves of I. doka and rough abaxial surfaces of I. tomentosa because of the presence of
trichomes. Variations were observed in their epidermal features, stomatal index, stomata
frequency, presence or absence of trichomes, trichomes frequency and their quantitative
anatomical features. The quantity and quality of DNA measured at A260/280 ratio using
nanodrop spectrophotometer were 29.1 ng/µL and 1.74 ng/µL for I. doka, respectively, while
the I. tomentosa concentration and purity were 71.1 ng/µL and 1.85 ng/µL, respectively.
Agarose gel electrophoresis revealed two DNA bands with 700 bp (rbcl) and 600 bp
(ITS). The sequence analysis revealed maximum identity with National Centre for
Biotechnology Information (NCBI) GeneBank Isoberlinia species. Evolutionary analysis
supported the monophyletic origin of the genus Isoberlinia. The morphological and anatomical
characters of I. doka and I. tomentosa leaves have provided a significant taxonomy tool for
proper authentication of this plant.
Conclusion: The findings ascertained that ITS and rbcl served as an improved and efficient
tool for species identification of these studied species and could serve as potential DNA
barcodes for these taxa.
Contribution: This article suggests that further studies the on screening of these plants, for
various pharmacological potentials, might be useful for new drug development.
Keywords DNA barcoding; morphological; GeneBank; polymerase chain reaction; Isoberlinia;
anatomical.
Introduction
Isoberlinia Craib and Stapf ex Holland genus in the family Fabaceae (legume family) is a tree
native to the hotter parts of tropical Africa (Burkill 1995). The species are significant components
of Miombo woodlands and Northern Nigeria guinea Savanah woodlands (Bello & Musa 2016).
Isoberlinia is a vigorously colonising African tree that often dominates the woodland belt that
stretches from Guinea in the west to Uganda in the east.
Read
Read online:
online:
Scan
Scan this
this QR
QR
code
code with
with your
your
smart
smart phone
phone or
or
mobile
mobile device
device
to
to read
read online.
online.
There are five accepted species of Isoberlinia, namely I. angolensis, I. doka, I. paradoxa, I. scheffleri
and I. tomentosa (Burkill 1995). However, the northern Nigeria guinea savanna are
dominated with an open woodland of two species, the I. doka and I. tomentosa (Bello & Musa
2016; Jackson 1970).
http://www.jomped.org
Open Access
Page 2 of 7
Isoberlinia doka is locally called ‘doka’, while I. tomentosa is
called ‘faradoka’ in Hausa. Naturally, these two plants exist
as trees or shrubs measuring between 10 m and 20 m tall,
with a trunk of about 40 cm – 50 cm diameter, branching
from about 5 m upwards. The leaflets are arranged in three or
four pairs. The flowers are small and white, forming large
open inflorescences that are held conspicuously above the
leafy crown (Burkill 1995). The pods are oblong, flat and
quite large, about 30 cm long and 10 cm wide. According to
Singab and Mostafa (2016), the molecular study of medicinal
plants is a promising and prospective scope in the field of
pharmacognosy. Deoxyribonucleic acid (DNA) barcoding
using ribulose-1,5-bisphosphate carboxylase (rbcl) and ITS
genes are an important tool for species identification
and standardisation of specific region of the plant genome
(Singab & Mostafa 2016; Zabta, Shinwari & Nadia 2014). The
molecular approach for the identification of plant species
seems to be very effective than morphological markers as it
allows direct access to the genome and makes it possible to
understand the relationship between individuals (Tripathi
et al. 2013). However, DNA markers are based on unique
nucleotide sequences and are not affected by environmental
factors or physiological conditions (Kim et al. 2016). The leaf
epidermal is the most varied organ in providing anatomical
features that can be employed as useful taxonomic characters
for proper classification, delineation and identification of
plant (Aworinde et al. 2009). Leaves can have a wide range of
morphological and anatomical studies such as the leaf
epidermal studies, stomatal and trichome are considered
important in phylogeny and taxonomy (Hameed 2012).
Isoberlinia doka and I. tomentosa are widely overexploited for
fuel wood in northern Nigeria, and this makes the plant to
exist in their shruby state (Bello & Musa 2016). They are
widely used in traditional medicine for the treatment of
various kinds of diseases, such as ulcer, stomach pain and
arrow poison (Abdulkadir et al. 2011) without much scientific
validation in accordance with World Health Organisation
standard. Pharmacological activities, such as antioxidant,
antibacterial, antifertility, and brine shrimp lethality test
have been reported for I. doka (Abdu et al. 2016; Abdulkadir
et al. 2011; Salka, Abubakar & Hassan 2011).
A systematic standardisation, including morphological,
anatomical and molecular studies, that could help in proper
identification, prevention of adulteration and quality control
of drugs are lacking for I. doka and I. tomentosa species.
Materials and methods
Plant collection and authentication
The fresh plants of I. doka and I. tomentosa were collected from
the man-made forest at Shika Isoberlinia woodland, Giwa local
government area, Kaduna State. The plants were authenticated
by a taxonomist with Voucher specimen numbers ABU 022478
and ABU 016280 deposited as for I. doka and I. tomentosa,
respectively, at the Herbarium, Department of Botany,
Ahmadu Bello University, Zaria, Nigeria.
http://www.jomped.org
Original Research
The morphological and anatomical features of
Isoberlinia doka and Isoberlinia tomentosa
Morphological and anatomical examinations on the fresh
I. doka and I. tomentosa were conducted to assess their
anatomical features (Evans 2009; WHO 2011). Macroscopic
identity of medicinal plant materials was based on shape,
size, colour, surface characteristics, texture, fracture
characteristics, odour, and taste of fresh and powdered
stem bark. The macroscopic characters of the samples
were carried out based on the method described by
WHO (2011).
Stomatal number and stomatal index
The Adaxial and abaxial epidermal peels of I. doka and I.
tomentosa leaves were rinsed in distilled water severally,
cleared with sodium hypochlorite and mounted on a glass
slide with few drops of glycerol covered with cover slip and
examined under a light microscope (Hund Wetzlar H600/12,
Germany). The number of epidermal cells and stomata was
counted. Stomatal index (SI) was calculated using the formula:
SI = [S \ (S+E)] × 100, where S = No. of stomata in an area of
625 µm2 & E = No. of epidermal cells. The experiment
was repeated 10 times. Average values were determined, and
the results were expressed per square millimeter. (Evans 2009)
Vein-islet and vein termination numbers
Small pieces from the leaves were taken midway from
margin to midrib and cleared by boiling in a super saturated
choral hydrate solution in a test tube placed in a boiling
water bath. Vein islet and vein termination were counted
using 10 × 10 magnification. Ten readings from continuous
squares were taken for counting the vein islets and vein
termination (Evans 2009).
Palisade ratio
The average number of palisade cells present beneath
each upper epidermal cell is called palisade cell ratio. Leaf
pieces of the two plants were cleared on boiling with chloral
hydrate solution. These were viewed under a microscope
with 10 × 10 magnifications. Palisade layers were determine
under four epidermal cells and the focus were changed until
the palisade cells were seen within the epidermal cells.
Palisade cells including those, which are more than half
covered by the epidermal cells, were counted. Palisade ratio
of a group was obtained by dividing the resulted value by 4
(Evans 2009).
Transverse section of the fresh parts Isoberlinia
doka and Isoberlinia tomentosa
Transverse section of the fresh parts of I. doka and I. tomentosa
were cut using surgical blades. The sections were cleared in
10% sodium hypochlorite solution, washed in distilled water,
and then stained in safranin and fast green. Sections were
then mounted between the slide and coverslip using dilute
glycerol, and photomicrographs of the slides were obtained.
Open Access
Page 3 of 7
Isolation of DNA regions of Isoberlinia doka and
Isoberlinia tomentosa
Genomic DNA were extracted from fresh young leaves of
I. doka and I. tomentosa using a protocol of Zymo quick DNA
universal kit.
Determination of the quantity and quality of
genomic DNA extracted from Isoberlinia doka
and Isoberlinia tomentosa
The quality and quantity of the genomic DNA extracted
from the two plants were determine using Thermo scientific
NanoDrop 2000 spectrophotometer, measured at the
absorbance ratio of 260 by 280 nm.
Polymerase chain reaction of the DNA extracted
from Isoberlinia doka and Isoberlinia tomentosa
Polymerase chain reactions were performed on the DNA isolated
from the two plants according to Prasath, Mohan and Divya
(2017). The primers ITS1 (5'CCGTAGGTGAACCTTGCGG 3')
and ITS4 (5'TCCTCCGCTTATTGATATGC 3') and rbcl gene
with forwarding sequence rbcLaF 5'-ATG TCA CCA CAA ACA
GAG ACT AAA GC-3' and reverse sequence is rbcLaR 5'-GTA
AAA TCA AGT CCA CCR CG-3' were used in Eppendorf
Personnel Master Cycler (Germany). The polymerase chain
reaction (PCR) total volume of the reaction was 20 µL, which
include H2O (16.0 µL), DNA (2.0 µL) and ITS primers 2.0 µmol/L,
and the same reaction was carried out using rbcl primers. The
conditions for both ITS and rbcl gene are indicated in Table 1.
Gel electrophoresis of polymerase chain
reaction products obtained from Isoberlinia
doka and Isoberlinia tomentosa
The PCR products obtained from the two plants were
assessed on a 0.8% agarose gel (in Tris-acetate EDTA buffer)
electrophoresis at 100 volts with a 100-bp DNA ladder. The
DNA was stained with ethidium bromide visualised on a
UV transilluminator. The PCR products were subjected to
sequencing by Sanger method in an AB Sequencer.
Nucleotide alignment and phylogenetic analysis
The ITS-rDNA and rbcl region nucleotide sequences of the
two plants were performed at the NCBI gene blast. Searches
were performed using the BLAST megablast parameter search
function, to compare the study sequences with the data from
the
Genebank
(http://blast.ncbi.nlm.nih.gov/Blast.cgi).
TABLE 1: Polymerase chain reaction conditions for internal transcribed spacer
and ribulose-1,5-bisphosphate carboxylase gene Isoberlinia doka and Isoberlinia
tomentosa.
Original Research
Sequences were submitted to the GeneBank by Banklt direct
submission, and their accession numbers were generated.
The sequences obtained from the two study plants, and some
selected GeneBank sequences were aligned using the multiple
alignment Clustal W algorithm (Thompson et al. 1997). The
phylogenetic analysis based on the rDNA-ITS and rbcl
sequences were constructed by the maximum likelihood
bootstrap analysis. A total of 1000 bootstrap replicates
were performed using MEGA version 6.06 (Kim et al. 2016;
Tamura et al. 2013) software.
Results and discussions
Macroscopicals studies of Isoberlinia doka and
Isoberlinia tomentosa leaves
The macroscopic studies of I. doka and I. tomentosa leaves
exhibited similar features in their dried state as indicated in
Table 2, including rough powdered leaves, the organoleptic
characters were also similar for I. doka and I. tomentosa,
which are tasteless with characteristic odour and light
green. This study further showed that the plant samples
change colour after drying, which is similiar to the findings
of Ahmed et al. (2014) that moisture loss could affect
organoleptic characters. The only notable macroscopical
differences between the two plants samples were seen
in their fresh conditions as I. doka had smooth shiny
leaves at adaxial surface as a result of thick cuticular
layer and I. tomentosa abaxial leaves surface was rough
because of non-glandural trichomes as showed in Table 3.
TABLE 2: Macroscopical studies of fresh and powdered leaves of I. doka and
I. tomentosa.
Features
I. doka
Fresh leaves
Powdered
Leaves
I. tomentosa
Fresh leaves
Powdered
leaves
Size
-
Texture/surface Smooth at
Characteristics both surfaces
Rough
Smooth adaxial; Rough
rough abaxial
Fracture
Smooth
-
Smooth
Colour
Shiny green
Light green
Green
Light green
Odour
characteristics Characteristics
Characteristics
Characteristics
Taste
Tasteless
Tasteless
Tasteless
Tasteless
-
TABLE 3: Qualitative, morphological and anatomical features of I. doka and I.
tomentosa leaves.
Characters
I. doka
I. tomentosa
Lamina
Shape
Ovate
Ovate
Venation
Pinnately veined
Pinnately veined
Apices
Acuminate
Acuminate
Margin
Entire
Entire
Base
Acute
Acute
Step ITS
Rbcl
Phyllotaxis
Opposite
Opposite
1
Initial denaturation -94 °C for 3 min
Initial denaturation -94 °C for 5 min
Petiole
Petiolate
Petiolate
2
Denaturation -94 °C for 40 s
Denaturation -94 °C for 30 s
Epidermal
3
Primer annealing -54 °C for 40 s
Primer annealing -54 °C for 30 s
Stomata
Paracytic
Paracytic
4
Extension -72 °C for 40 s
Extension -72 °C for 1 min
Trichomes
Absent
Non-gladular unicellular
5
Go to step 2 repeat 35 times
Go to step 2 repeat 35 times
Mesophyll cell types
Circular
Circular
6
final extensions -72 °C 10 min
final extensions -72 °C 5 min
Palisade cell types
Rod shape
Rod shape
7
Hold – 4 °C
Hold – 4 °C
Epidermal cell types
Irregular, triangular,
quadrilateral
Irregular, triangular,
quadrilateral, polygonal
Rbcl, ribulose-1,5-bisphosphate carboxylase; ITS, internal transcribed spacer.
http://www.jomped.org
Open Access
Page 4 of 7
This supports the earlier report of Neinhuis and Barthlott
(1997) that trichomes is one of the features that caused
roughness in epidermal surfaces of water-repellent plants.
Qualitative morphological and anatomical
characters of Isoberlinia doka and Isoberlinia
tomentosa leaves
The qualitative, morphological and anatomical characters of
I. doka and I. tomentosa, as shown in Table 3, exhibited similar
lamina and epidermal features. The lamina features included
ovate shaped, pinnately veined, acuminate apex, entire
margin and acute base. Paracytic types of stomata were
observed on both epidermal surfaces of the two plants. The
main diagnostic taxonomical features to differentiate the two
plants were revealed in the presence of trichomes in the
abaxial surfaces and additional polygonal types of epidermal
cells of I. tomentosa, whereas trichomes and polygonal
epidermal cells were absent in I. doka as shown in Table 3.
Quantitative morphological and anatomical
characters of Isoberlinia doka and Isoberlinia
tomentosa leaves
The quantitative, morphological and anatomical characters, as
listed in Table 4, showed more variable features amongst I. doka
and I. tomentosa. The petiole length ranges from 0.9 cm to 0.96 cm
for the two study species. The lamina length of I. tomentosa
(16.5 ± 0.12 cm) was larger than I. doka. High epidermal cell
numbers were observed at the adaxial surfaces of both studied
species but their stomata number were found to be higher at the
lower epidermis than the upper surfaces. Amphistomata nature
exhibited by these plants serve as an adaptative features to help
withstand harsh environmental conditions. This finding was
different from the report of Abubakar et al. (2018), which
revealed a higher stomata number at upper epidermal surfaces
a
Original Research
of Cassia and Senna studied species. The study had shown that
the types, abundance and nature of stomata distributions in
plants are essential for unique physiological responds to
changes in the environment (Aguoru, Ahemen & Olasan 2015).
The leaf surface constants varied between the two species.
However, stomatal index (0.23), vein islets (40.6 ± 0.87 mm2) and
vein termination number (35.6 ± 3.36 mm2) of I. tomentosa
were higher than the values obtained for I. doka, as shown in
Table 4 and Figure 1. Quantitative measurement of transverse
TABLE 4: Quantitative studies of I. doka and I. tomentosa leaves and stembark.
Features
I. doka
I. tomentosa
Petiole length
Width
0.96 ± 0.02 cm
0.24 ± 0.02 cm
0.9 ± 0.02 cm
0.25 ± 0.02 cm
Lamina length
Width
11.8 ± 0.75 cm
6.0 ± 0.28 cm
16.5 ± 0.12 cm
8.21 ± 0.24 cm
546 ± 11.15 mm2
378 ± 13.77 mm2
627 ± 8.6 mm2
282 ± 16.5 mm2
20 µm – 60 µm
15 µm – 30 µm
30 µm – 50 µm
20 µm – 30 µm
Guard cell length Ad
Width
12.5 µm
5 µm
15 µm
7.5 µm
Stomata number (Ad
Ab)
14.8 ± 1.34 mm2
76 ± .6.36 mm2
13.8.5 ± 0.56 mm2
60.2 ± 4.0 mm2
Stomata index Ad
Ab
21.7 ± 2.2 mm2
9.70 ± 0.54 mm2
17.2 ± 1.45 mm2
8.3 ± 1.32 mm2
Leaf
Epidermal cell numbers (Ad,
Ab)
Epidermal cell length (Ad)
Width
Stomata ratio
Vein islet number
Vein termination number
0.19
0.23
20.6 ± 1.08 mm2
40.6 ± 0.87 mm2
35.2 ± 1.02 mm2
35.6 ± 3.36 mm2
5.25 mm2 – 6.25 mm2
4 mm2 – 5.25 mm2
Nill
23 mm2 – 38 mm2
Palisade mesophyll layer
150 µm
160 µm
Spongy mesophyll layers
300 µm
440 µm
Vascular bundles region
300 µm diameter
400 µm
Palisade ratio
Trichome numbers
Midrib (T.S.)
Xylem vessels
40 µm
40 µm
Phloem
10 µm
10 µm
Ad, adaxial epidermal surface; Ab, abaxial epidermal surfaces.
Results are expressed as mean ± standard error of mean.
b
c
d
g
h
vi
vt
e
f
FIGURE 1: Epidermal leaf microscopy of Isoberlinia doka and Isoberlinia tomentosa. (a). Calcium oxalates crystals of I. tomentosa, mag ×400. (b) Vein islets (vi), vt: vein
termination of I. tomentosa mag x100. (c). Vein islets (vi), vt: vein termination I. doka mag x100. (d). Trichomes of I. tomentosa mag x100. (e). Adaxial epidermis I. tomentosa
of mag x400. (f). Abaxial epidermis I. tomentosa mag x400. (g). Stomata of I. doka at adaxial epidermis mag x400. (h). Stomata of I. doka at abaxial epidermis mag x400.
http://www.jomped.org
Open Access
Page 5 of 7
section (TS) across the midrib of leave (Table 4) revealed more
variable taxonomical features of I. doka and I. tomentosa, in
contrast with Hohn (1999) that Isoberlinia types are weakly
delimited, even though they possessed similiar qualitative
features.
The transverse section of the leaves of
Isoberlinia doka and Isoberlinia tomentosa
The TS of the leaves of I. doka and I. tomentosa is dorsoventral
in nature. The palisade parenchyma cells of both species
appeared in double layers, while the spongy mesophyll cells
varied between the two plants. The spongy mesophyll cells
of I. doka were between 4 and 6 layered, while that of I.
tomentosa ranged between 6 and 10 layered. The vascular
tissue system of both species were well defined with
prominent bundle sheath. There were double vascular
bundle distributions in both plants, one of the vascular
bundle was concentric, amphivasal (phloem towards the
inner and xylem at the pheriphery) and the other appeared
concave with similar tissue distributions. Trichomes were
absent in I. doka, while non-glandular trichomes were present
at the lower epidermal region of I. tomentosa as shown in
Figure 2 and Figure 3.
Original Research
Amplicons obtained after PCR were of 700 bp and 600 bp for
rbcl and ITS, respectively, and visualised on a 0.8% agarose
gel as shown in Figure 4 and Figure 5).
Phylogenetic analysis of Isoberlinia doka and
Isoberlinia
The phylogenetic tree consisted of two main groups ITS and
rbcl. The first ITS group consist of two clusters, the first
cluster had four series of two cluster with 91%, 98%, 71%
and 69% DNA of a genetic similiarities with the following
species and their accession numbers : MG949328.1 I. schefferi,
AF513691.1 I. doka, KX057884.1. I. doka, KX057885.1
I. tomentosa, in NCBI Blast.
Adaxial epidermis
Palisade mesophyll
Spongy mesophyll
Phloem
Xylem
Parenchyma cell
Molecular characterisation of Isoberlinia doka
and Isoberlinia tomentosa
Total genomic DNA were isolated from the collected
I. doka and I. tomentosa fresh leaves and there concentration
and purity using nanodrop spectrophotometer were
29.1 ng/uL and 1.74 ng/uL for I. doka, respectively,
while I. tomentosa concentration and purity were
71.1 ng/uL and 1.85 ng/uL, respectively, as shown in
Table 5.
Abaxial epidermis
FIGURE 2: Transverse section of Isoberlinia doka with magnification × 40.
TABLE 5: Quality and quantity of DNA sample from Isoberlinia doka and
Isoberlinia tomentosa.
Species
Concentration/quantity
Purity (quality)
I. doka
29.1 ng/µL
1.74 ng/µL
I. tomentosa
71.1 ng/µL
1.85 ng/µL
Ad
pm
sm
ph
xy
b
p
tr
Ab
Ad, adaxial epidermis; pm, palisade mesophyll; sm, spongyll mesophyll; ph, phloem; xy, xylem; b, bundle sheath; p, parenchyma cell; tr, trichomes; Ab, abaxial epidermis.
FIGURE 3: Transverse section of Isoberlinia tomentosa with enlarge palisade parenchyma cells and a whole section. Magnification × 10.
http://www.jomped.org
Open Access
Page 6 of 7
The second cluster had two series with 99% and 100% genetic
similiarities with HM041839 Berlinia orientalis, KY306506
Berlinia confusa and AF513669 Berlinia confuse with GeneBank
NCBI Blast.
The second group rbcl consists of two cluster, the first cluster
shared 67% similiarities between KX119305 I. doka, KX119306
I. tomentosa and ID rbcl, IT rbcl (study species), respectively.
The second cluster shared 88% DNA similiarities with three
Tamarindus indica AB378732, AB378731, AB378730, as showed
in (Figure 6) and sequences were submitted to NCBI
GeneBank using Banklt direct submission. The accession
number generated for rbcl gene for I. tomentosa was MN
M
1
Original Research
879280 and I. doka (MN885536). The accession number for ITS
rDNA generated for I. tomentosa and I. doka were MN857896
and MN857895, respectively.
The ITS and rbcl DNA barcoding marker revealed
considerable genetic similarities and identification among
the two studied species, which strongly agrees with the
morphological similarities observed in this study. A similar
report was revealed by Zabta et al. (2014 that the rbcl region
was more effective to identify and discriminate the species of
Acacia and Abizia. DNA barcoding could be considered as a
good approach for distinguishing and identifying the mint
plants (Hameed 2018).
The subfamily detarioideae are depicted by clustering of
distinct species within its clade similar to the findings
of Oshingboye (2017) that the relationship among the
cesalpinoideae also depicted distinct clusters in their tribes.
Phylogenetic analysis of this study presents a monophyletic
origin of the genus Isoberlinia.
2
700 bp
The percentage BLAST identity of the sequences obtained
for rbcl and ITS gene from the two studied plants when
compared with the Isoberlinia species at NCBI GeneBank was
above 99% to I. doka and I. tomentosa (Table 6).
ID ITS
69
IT ITS
71
M, molecular weight; 1, I. doka; 2, I. tomentosa; bp, base pair.
KX057884 Isoberlinia doka ITS
98
FIGURE 4: Agarose gel electrophoresis of ribulose-1,5-bisphosphate carboxylase
gene of I. doka and I. tomentosa.
KX057885 Isoberlinia tomentosa ITS
KY306599 Isoberlinia tomentosa ITS
91
ITS
AF513691 Isoberlinia doka ITS
MG949328 Isoberlinia scheffleri ITS
HM041839 Berlinia orientalis ITS
M
1
2
KY306506 Berlinia confusa ITS
99
99
AF513669 Berlinia confuse ITS
AB378732 Tamarindus indica rbcl
88
AB378731 Tamarindus indica rbcl
AB378730 Tamarindus indica rbcl
100
67
IT rbcl
ID rbcl
KX119305 Isoberlinia doka rbcl
rbcl
KX119305 Isoberlinia tomentosa rbcl
600 bp
ITS, internal transcribed spacer; ID, I. doka; IT, I. tomentosa.
FIGURE 6: Phylogenetic tree of Isoberlinia tomentosa and Isoberlinia doka.
TABLE 6: Percentage BLAST identity of Isoberlinia doka and Isoberlinia tomentosa
with the GeneBank sequence data.
M, molecular weight; 1, I. doka; 2, I. tomentosa; bp, base pair.
FIGURE 5: Agarose gel electrophoresis of internal transcribed spacer gene of
Isoberlinia doka and Isoberlinia tomentosa.
http://www.jomped.org
Species
Gene region % Identity in GeneBank
I. tomentosa
rbcl
99.6% to I. tomentosa, 99% to multiple species and
other genera of Fabaceae
I. doka
rbcl
100% to an I. doka voucher and 99% to I. tomentosa,
I. scheferi and other genera of Fabaceae
I. tomentosa
ITS
99.5% to I. tomentosa, 99% to I. doka and other
genera of Fabaceae
I. doka
ITS
99.2% to an I. doka voucher and 99% to I. tomentosa,
I. scheferi and other genera of Fabaceae
BLAST, Basic local alignment search tool; rbcl, ribulose-1,5-bisphosphate carboxylase; ITS,
internal transcribed spacer.
Open Access
Page 7 of 7
Conclusion
Original Research
official policy or position of any affiliated agency of
the authors.
The macroscopic studies of I. doka and I. tomentosa showed
similar features in their fresh leaves with smooth surface
characteristics, hard and fibrous fracture, grey in colour,
tasteless and characteristics odour. The qualitative,
morphological and anatomical characters of I. doka and
I. tomentosa leaves revealed similar lamina features, such as
ovate shaped, pinnately veined, acuminate apex, entired
margin and acute base. The presence of trichomes in the
abaxial surfaces and additional polygonal types of
epidermal cells of I. tomentosa can serve as a diagnostic tool
for proper authentication of this plant. The blast percentage
identity of the sequences obtained for the two plants
revealed above 99% similarities with the same species in
the GeneBank. This finding also ascertained that ITS
and rbcl are an efficient tool for species identification of
these medicinal plants. Further studies on screening, these
plants for various pharmacological potentials might be
useful for new drug development.
References
Abdu, Z., Dimas, K., Sunday, A.O., Isyaka, M.S. & Sa’id, J., 2016, ‘Qualitative
investigation of phytochemicals and brine shrimp lethality test of the root, stem
bark and leaves extract of Isoberlinia doka (Fabaceae)’, International Journal of
Chemical Studies 4(1), 112–116.
Abdulkadir, I.E., Aliyu, A.B., Ibrahim, M.A., Audu, S.B.D. & Oyewale, A.O., 2011,
‘Antioxidant activity and mineral elements profiles of Isoberlinia doka leaves from
Nigeria’, Australian Journal of Basic and Applied Sciences 5(12), 2507–2512.
Abubakar, B.Y., Adamu, A.K., Ambi, A.A. & Nuru, F.G., 2018, ‘Taxonomic delimitation of
species of Senna and Cassia in Ahmadu Bello University, Zaria’, Fuw Trends in
Science & Technology Journal 3(2), 488–495.
Aguoru, C., Ahemen, A. & Olasan, J., 2015, ‘Comparative micromorphological studies
on two Landolphia species in North Central Nigeria’, Journal of Emerging Trends in
Engineering and Applied Sciences 6(3), 152.
Ahmed, M., Abas, F., Tan, C.P. & Khatib, A., 2014, ‘Effects of different drying methods
and storage time on free radical scavenging activity and total phenolic content of
Cosmos caudatus’, Antioxidants 3(2), 358–370. https://doi.org/10.3390/
antiox3020358
Aworinde, D.O., Nwoye, D.U., Jayeola, A.A., Olagoke, A.O. & Ogundele, A.A., 2009,
‘Taxonomic significance of foliar Epidermis in some members of Euphorbiaceae
family in Nigeria’, Research Journal of Botany 4(1), 17–28. https://doi.org/10.3923/
rjb.2009.17.28
Bello, H. & Musa, A.O., 2016, ‘Species composition and structure of Isoberlinia
woodland of Shika, Zaria Nigeria’, Journal of Agriculture and Ecology Research
International 5, 1–9. https://doi.org/10.9734/JAERI/2016/20494
Burkill, H.M., 1995, The useful plants of West Tropical Africa, Volume 3, Families J-L,
Royal Botanic Gardens, Kew.
Acknowledgements
The authors are thankful to Ramla at DNA lab kaduna state,
Nigeria for assisting in the molecular analysis.
Competing interests
The authors declare that they have no conflict of interests.
Authors’ contributions
H.B. wrote the first draft of the manuscript; carried out the
research, and A.U.K., A.A.A. and B.Y.A. supervised the work
and made all the necessary contribution towards the
success of the work. All authors read and approved the final
manuscript submission.
Ethical considerations
This study followed all ethical standards for research
without direct contact with human or animal subjects.
Evans, W.C., 2009, Trease and Evans’ pharmacognosy e-book, 16th edn., pp. 513–517,
Saunders WB, Elsevier Health Sciences, Edinburgh.
Hameed, I., 2012, ‘Pharmacognostic study of five medicinal plants of family
Solanaceae from District Peshawar’, Pakistan thesis submitted to Department of
Botany, University of Peshawar, pp. 2–3.
Hameed, S.M., 2018, ‘Molecular identification of Lavendula Dentata L.,
Menthalongifolia (L.) Huds. and Mentha × Piperita L. by Dna barcodes’, Bangladesh
Journal of Plant Taxonomy 25(2), 149–157. https://doi.org/10.3329/bjpt.
v25i2.39519
Hohn, A., 1999, ‘Wood anatomy of selected West African species of Caesalpinioideae
and Mimosoideae (Leguminosae): A comparative study’, Iawa Journal 20(2),
115–146. https://doi.org/10.1163/22941932-90000672
Jackson, G., 1970, ‘Vegetation around the city and nearby villages of Zaria’, in M.J.
Mortimore (ed.), Zaria and its region occasional paper no. 4, 14th Annual
conference of the Nigeria Geographical Association, Zaria, p. 171.
Kim, W.J., Ji, Y., Choi, G., Kang, Y.M., Yang, S. & Moon, B.C., 2016, ‘Molecular
identification and phylogenetic analysis of important medicinal plant species in
genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences’,
Genetics and Molecular Research 15(3), gmr.15038472. https://doi.org/10.4238/
gmr.15038472
Neinhuis, C. & Barthlott, W., 1997, ‘Characterization and distribution of waterrepellent, self-cleaning plant surfaces’, Annals of Botany 79(6), 667–677. https://
doi.org/10.1006/anbo.1997.0400
Oshingboye, A.D., 2017, ‘Molecular characterization and DNA barcoding of arid-land
species of family Fabaceae in Nigeria’, Submitted to the School of Postgraduate
Studies, University of Lagos, pp. 1–42.
Prasath, H., Mohan, C. & Divya, S., 2017, ‘Molecular characterization of medicinal
plant –Cassia Fistula L by Matk Gene’, International Journal for Research in Applied
Science and Technology 5(4), 126–132.
Salka, N.M., Abubakar, A.A. & Hassan, F.B., 2011, ‘Sociability and sexual motivation in
male wistar rats in response to different doses of extract of Isoberlinia doka using
“partition” test method’, Asian Journal of Plant Science and Research 1(1), 88–94.
Funding information
This research work received no specific grant from any
funding agency in the public, commercial or not-for-profit
sectors.
Data availability
The accession number generated were submitted at the
NCBI GeneBank.
Disclaimer
The views and opinions expressed in this article are
those of the authors and do not necessarily reflect the
http://www.jomped.org
Singab, A.N. & Mostafa, N.M., 2016, ‘Molecular pharmacognosy: A promising and
prospective scope in the field’, Medicinal and Aromatic Plants 5, e172. https://doi.
org/10.4172/2167-0412.1000e172
Tamura, K., Stecher, G., Peterson D., Filipski, A.D. & Kumar, S., 2013, ‘MEGA6:
Molecular evolutionary genetics analysis version 6.0’, Molecular Biology and
Evolution 30(12), 2725–2729. https://doi.org/10.1093/molbev/mst197
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G., 1997, ‘The
clustal X windows interface: Flexible strategies for multiple sequence alignment
aided by quality analysis tools’, Nucleic Acids Research 25(24), 4876–4882.
https://doi.org/10.1093/nar/25.24.4876
Tripathi, A.M., Tyagi, A., Kumar, A., Singh, A., Singh, S., Chaudhary, L.B. et al., 2013,
‘The internal transcribed spacer (ITS) region and trnH-psbA [corrected] are
suitable candidate loci for DNA barcoding of tropical tree species of India’, PLoS
One 9(8), e57934. https://doi.org/10.1371/journal.pone.0057934
WHO, 2011, Quality control methods for medicinal plant materials, World Health
Organization, Geneva.
Zabta, K., Shinwari K.J. & Nadia, B.Z., 2014, ‘Molecular systematics of selected genera
of subfamily Mimosoideae-Fabaceae’, Pakistan Journal of Botany 46(2), 591–598.
Open Access