Molecular Phylogenetics and Evolution 55 (2010) 580–598 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A classification of the Chloridoideae (Poaceae) based on multi-gene phylogenetic trees Paul M. Peterson a,*, Konstantin Romaschenko a,b, Gabriel Johnson c a Department of Botany, National Museum of Natural History, Smithsonian Institution, Washington, DC 20013, USA Botanic Institute of Barcelona (CSIC ICUB), Pg. del Migdia, s.n., 08038 Barcelona, Spain c Department of Botany and Laboratories of Analytical Biology, Smithsonian Institution, Suitland, MD 20746, USA b a r t i c l e i n f o Article history: Received 29 July 2009 Revised 31 December 2009 Accepted 19 January 2010 Available online 22 January 2010 Keywords: Biogeography Classification Chloridoideae Grasses Molecular systematics Phylogenetic trees Poaceae a b s t r a c t We conducted a molecular phylogenetic study of the subfamily Chloridoideae using six plastid DNA sequences (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) and a single nuclear ITS DNA sequence. Our large original data set includes 246 species (17.3%) representing 95 genera (66%) of the grasses currently placed in the Chloridoideae. The maximum likelihood and Bayesian analysis of DNA sequences provides strong support for the monophyly of the Chloridoideae; followed by, in order of divergence: a Triraphideae clade with Neyraudia sister to Triraphis; an Eragrostideae clade with the Cotteinae (includes Cottea and Enneapogon) sister to the Uniolinae (includes Entoplocamia, Tetrachne, and Uniola), and a terminal Eragrostidinae clade of Ectrosia, Harpachne, and Psammagrostis embedded in a polyphyletic Eragrostis; a Zoysieae clade with Urochondra sister to a Zoysiinae (Zoysia) clade, and a terminal Sporobolinae clade that includes Spartina, Calamovilfa, Pogoneura, and Crypsis embedded in a polyphyletic Sporobolus; and a very large terminal Cynodonteae clade that includes 13 monophyletic subtribes. The Cynodonteae includes, in alphabetical order: Aeluropodinae (Aeluropus); Boutelouinae (Bouteloua); Eleusininae (includes Apochiton, Astrebla with Schoenefeldia embedded, Austrochloris, Brachyachne, Chloris, Cynodon with Brachyachne embedded in part, Eleusine, Enteropogon with Eustachys embedded in part, Eustachys, Chrysochloa, Coelachyrum, Leptochloa with Dinebra embedded, Lepturus, Lintonia, Microchloa, Saugetia, Schoenefeldia, Sclerodactylon, Tetrapogon, and Trichloris); Hilariinae (Hilaria); Monanthochloinae (includes Distichlis, Monanthochloe, and Reederochloa); Muhlenbergiinae (Muhlenbergia with Aegopogon, Bealia, Blepharoneuron, Chaboissaea, Lycurus, Pereilema, Redfieldia, Schaffnerella, and Schedonnardus all embedded); Orcuttiinae (includes Orcuttia and Tuctoria); Pappophorinae (includes Neesiochloa and Pappophorum); Scleropogoninae (includes Blepharidachne, Dasyochloa, Erioneuron, Munroa, Scleropogon, and Swallenia); Traginae (Tragus with Monelytrum, Polevansia, and Willkommia all embedded); Tridentinae (includes Gouinia, Tridens, Triplasis, and Vaseyochloa); Triodiinae (Triodia); and the Tripogoninae (Melanocenchris and Tripogon with Eragrostiella embedded). In our study the Cynodonteae still include 19 genera and the Zoysieae include a single genus that are not yet placed in a subtribe. The tribe Triraphideae and the subtribe Aeluropodinae are newly treated at that rank. We propose a new tribal and subtribal classification for all known genera in the Chloridoideae. The subfamily might have originated in Africa and/or Asia since the basal lineage, the Triraphideae, includes species with African and Asian distribution. Published by Elsevier Inc. 1. Introduction The grass (Poaceae) subfamily Chloridoideae was first validly published by Beilschmied (1833), a German botanist and pharmacist, who used an earlier description of sect. Chlorideae by Kunth * Corresponding author. Address: Department of Botany, MRC-166, National Museum of Natural History, Smithsonian Institution, 10[th] and Constitution Avenue NW, Washington, DC 20013-7012, USA. Fax: +1 202 786 2563. E-mail address: peterson@si.edu (P.M. Peterson). 1055-7903/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.ympev.2010.01.018 (1815). That same year, Kunth (1833) published his Agrostographia Synoptica in which he recognized the following genera in the group (Chlorideae): Chloris, Ctenium, Cynodon, Dactyloctenium, Eleusine, Eustachys, Gymnopogon, Harpochloa Kunth, Leptochloa, Microchloa, Pleuraphis Torr., Schoenefeldia, Spartina, Triplasis, and 8 genera now treated as synonyms of Bouteloua. Clearly our modern understanding of Chloridoideae is much greater, and there now appear to be more than 1420 species in approximately 140 genera in the subfamily worldwide (Clayton et al., 2008; Watson and Dallwitz, 1992b). P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 The core species in the subfamily share two structural synapomorphies: all exhibit Kranz or C4 leaf anatomy (except Eragrostis walteri Pilg. from South Africa; Ellis, 1984) and most have chloridoid bicellular microhairs (broad, short terminal cell the same thickness as the basal cell) present on leaf surfaces. Two main subtypes of C4 photosynthesis, NAD-ME (nicotinamide adenine dinucleotide co-factor malic enzyme) and PCK (phosphoenolpyruvate carboxykinase), have been found and verified by biochemical assay to occur in Chloridoideae (Gutierrez et al., 1974; Brown, 1977; Hattersley and Watson, 1992). Ecologically, there appears to be some separation in habitat preference according to C4 subtype (Ellis et al., 1980; Hattersley, 1992). The PCK subtype is thought to represent an apomorphy in grasses because this C4 cycle appears to be a modification of the NAD-ME subtype (Hattersley and Watson, 1992). In addition, the PCK subtype is known only to occur in grasses, whereas the NAD-ME subtype is also found in other monocot and dicot families (Hattersley and Watson, 1992; Peterson and Herrera Arrieta, 2001). Other character trends in Chloridoideae include a base chromosome number of x = 10, fruits (caryopses) with nonlinear hila that are usually punctiform or small, embryos with elongated mesocotyl internodes, and two non-membranous (fleshy) lodicules (Soreng and Davis, 1998; GPWG, 2001). However, most of these character trends are seen in the closely related subfamilies Aristidoideae, Arundinoideae, Centothecoideae, Danthonioideae, and Panicoideae of the PACCAD clade. A recent morphological and ecological description of the subfamily is given in GPWG (2001). Some salient features include: plants herbaceous, rarely woody, occurring in dry climates, sheaths usually non-auriculate, inflorescence paniculate, racemose, or spicate, spikelets bisexual or unisexual (plants monoecious or dioecious) with one to many fertile florets, usually laterally compressed, usually disarticulating above the glumes, palea well developed, lodicules usually two, fleshy, ovary glabrous, styles and stigmas two, caryopsis with pericarp often free or loose, hilum short, endosperm hard without lipid, embryo with an epiblast (usually), scutellar cleft, and elongated mesocotyl internode. The Chloridoideae have appeared monophyletic in all previous molecular analyses, however the classification within the subfamily, until recently, has been controversial (Van den Borre and Watson, 1997; Soreng and Davis, 1998; Hilu et al., 1999; Hsiao et al., 1999; Hilu and Alice, 2001; Roodt-Wilding and Spies, 2006; Columbus et al., 2007; Peterson et al., 2007; Soreng et al., 2009). Earlier studies based entirely on morphological characters, while not entirely misleading in depicting closely related genera, were often erroneous in elucidating evolutionary alignment of the tribes (Hilu and Wright, 1982; Van den Borre and Watson, 1997). Clayton and Renvoize (1986) recognized a large Eragrostideae tribe that included 77 genera whereas Columbus et al. (2007) and Peterson et al. (2007), based on parsimony analyses of DNA sequences, have circumscribed a much smaller Eragrostideae (±8 genera) and a very large Cynodonteae (±60 genera) that included the following 10 subtribes: Boutelouinae, Chloridinae, Eleusininae, Gouiniinae, Hilariinae, Monanthochloinae, Munroinae, Muhlenbergiinae, Orcuttiinae, and Traginae. Roodt-Wilding and Spies (2006) investigated phylogenetic relationships among 38 southern African chloridoid species using trnL-F and ITS sequences. The largest molecular phylogenetic survey of chloridoid grasses included 80 species in 66 genera (Columbus et al., 2007). A recent plastid multi-gene (three) phylogeny of the grasses incorporating 78 chloridoids provides a good estimate of the tribal relationships among this subfamily (Bouchenak-Khelladi et al., 2008). A major problem with this work is that it contains a large amount of missing data, since 61 of the 78 chloridoid species are based on single gene sequence, 10 species are based on two genes, and only seven species are based on three genes. Consequently, misleading results are re- 581 ported such as Schedonorus, sister to Lolium in the Poeae, and Anisopogon in the Phaenospermateae are included in their Chloridoideae assemblage (Davis and Soreng, 2007). Placement of these two genera in the Chloridoideae was based on each containing a single rbcL sequence. Obviously, Schedonorus and Anisopogon should have been omitted from their study. In our study, we provide the latest estimates of the phylogeny within the Chloridoideae by analyzing six sequences from the plastid genome — rps3 (coding), rps16 intron, rps16-trnK (spacer), ndhF (coding), ndhA intron, and rpl32-trnL (spacer); and one from the nuclear genome — ITS. To do this we assembled a large data set including 254 species in 99 genera. We compare phylogenetic trees based on ITS and plastid datasets, combine the data set in a total evidence tree, discuss previous molecular and morphological studies where appropriate, interpret biogeographical relationships, and present a new classification for the subfamily. Based on our phylogenetic evidence we propose a change in rank for two taxa, the subtribe Triraphidinae and the tribe Aeluropodeae. 2. Materials and methods 2.1. Taxon sampling The following 8 taxa were chosen as outgroups from the PACCAD clade: one species of Danthonia (Danthonioideae), two species of Rytidosperma (Danthonioideae), two species of Aristida (Aristidoideae), and three species of Chasmanthium (Centothecoideae or Centotheceae) (GPWG, 2001; Davis and Soreng, 2007). The Chloridoideae subset of data is partitioned as following: six species of tribe Triraphideae, 34 species (two multiple accessions) of tribe Eragrostideae, 18 species of Zoysieae (one multiple accession) and 188 species (11 multiple accessions) of Cynodonteae. The dataset of Cynodonteae includes three species of subtribe Aeluropodinae, 10 species of Triodiinae, five species of Orcuttiinae, four species of Tridentinae, six species of Tripogoninae, 51 species of (five multiple accessions) of Eleusininae, 11 species of Traginae, one species (one multiple accession) of Hilariinae, three species (one multiple accession) of Monanthochloinae, 13 species of Boutelouinae, 10 species of Scleropogoninae, and 33 species (one multiple accession) of Muhlenbergiinae. In addition, the Cynodonteae includes 31 species (three multiple accessions) with uncertain taxonomic or phylogenetic position. Voucher information and GenBank numbers for 268 original accessions representing 254 species are given in Appendix A. All vouchers are deposited in the Smithsonian Institution, United States National Herbarium (US). The majority of samples used in this study were collected by PMP during the period from 1984 to 2008. In addition, we sampled older herbarium specimens to maximize the number of genera in the Chloridoideae. Collections from areas we have not visited, i.e., India and Africa, were included. 2.2. DNA extraction, primers design, amplification, and sequencing All procedures were performed in the Laboratory of Analytical Biology (LAB) at the Smithsonian Institution. DNA was isolated using the BioSprint 96 DNA Plant Kit (Qiagen, Valencia, California, USA) following the protocol of the manufacturer. PCR amplifications were performed in a MJ Research or PE 9700 thermal cycler. Genomic DNA was combined with 1 reaction buffer (200 mM Tris–HCl, 500 mM NH4) (Bioline Biolase Taunton, Madison, USA) without Mg++, 2 mM MgCl2, 200 mM dNTP’s, 1.5 ll of Taq polymerase (Bioline Biolase Taunton, Madison, USA), 40 pmol/ll each of forward and reverse primers. We targeted seven regions for sequencing: three from chloroplast genome large single-copy re- 582 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 gions (LSC) – rps3 (coding region), rps16 intron and 30 rps16–50 trnK (spacer); three from small single-copy regions (SSC) – ndhF (coding region), ndhA intron, and rpl32-trnL (spacer); and nrDNA ITS region. Intergenic spacers rpl32-trnL (SSC) and rps16-trnK (LSC) are two of the top ranked, most variable non-coding regions for phylogenetic studies in the Angiosperms (Shaw et al., 2007). To our knowledge, rpl32-trnL intergenic spacer and ndhA intron (SSC) have not been previously used for phylogenetic inference within the Poaceae. We have chosen the widely used ndhF gene (SSC) to recover phylogenetic relationships since it proved useful in other groups of grasses (Giussani et al., 2001; Soreng et al., 2007). Another commonly used gene in phylogenetic studies of Poaceae, matK (LSC) was initially considered as a comparative region to ndhF in our dataset (Hilu et al., 1999; Hilu and Alice, 1999;2001; Soreng et al., 2007; Schneider et al., 2009). However, difficulties with amplification of matK over the entire range of species and especially for old samples encouraged us to explore other coding regions of the chloroplast genome that could fit the conditions of easy amplification, of reasonable size with a sufficient amount of parsimony informative characters (PIC’s). The rps3 (LSC) gene was chosen as a substitute for matK in our analysis. To our knowledge, the rps3 region has not been used for phylogenetic inference before. The combined datasets include 1574 sequences of the nuclear and chloroplast genome regions of chloridoid grasses and 49 sequences of the species from the adjacent phylogenetic groups of the PACCAD clade. Based on sequences of the complete chloroplast genome of Oryza, Zea, Hordeum, Lolium, Triticum, and Agrostis available from GenBank we designed primers for rps3 and ndhA intron regions and modified or designed Poaceae specific primers for 30 rps16–50 trnK and rps16 intron regions. The programme FastPCR 4.0.27 was employed to adjust the temperature and the quality of the newly designed or modified primers in order to increase the PCR efficiency. The sequences, melting temperature, quality, and references for the primers used are given in Table 1. The rps3 is a ribosomal protein S3 coding gene anchored at the 79300 position, according to the Oryza complete genome sequence, and flanked by the rpl22 (L22 – core protein of the large ribosomal subunit encoding region) from 50 end and intergenic spacer with rpl16 (L16 essential protein of the large subunit encoding region) from the 30 end. Unlike its mitochondrial analogue that was previously used in phylogenetic studies (Jian et al., 2008), the plastid rps3 gene lacks an intron and has reasonable size (720 bp in Oryza and 678–684 bp in Chloridoideae) and is suitable for routine amplification and sequencing with one pair of primers. The fraction value of PIC’s to the total sequence length for this region is comparable to the value of such fast-evolving plastid protein-coding genes as ndhF (Table 2). Two newly designed primers, rps3C28F and rps3C697R are anchored in conservative zones close to the 50 and 30 ends of the gene. The labelling numbers indicate positions of the primers from the first nucleotide of the start codon according to the Oryza sequence. Using this set of primers the portion of the rps3 gene of approximately 580 bp (excluding primers area) was easily amplified and sequenced for the majority of the samples. Of roughly 2230 bp of entire ndhF gene, 740 bp fragment of the most variable 30 end of the region was amplified and sequenced using one set of forward and reverse primers, ndhF1311F and ndhF2091R (Romaschenko et al., in press). We redesigned primers for amplification and sequencing of the ndhA intron making them less degenerate and more suitable for Poaceae than those designed by Small et al. (1998) or Shaw et al. (2005). In addition, the amplification with newly designed primers, ndhA  4 and ndhA  3 was steadier when working with older herbarium material. Both primers are anchored in flanking exons of the ndhA gene. The amplification parameters for all plastid regions were: 95 °C for 3 min; followed by 35 cycles of 94 °C for 40 s, 51–56 °C for 40 s and 72 °C for 1 min 40 s; the temperature of the final extension was set for 72 °C for 10 min. Most of the plastid regions chosen for this study have a sequence length between 579 and 745 bp, which is suitable for routine amplification using standard PCR parameters and one set of primers for each region. The nuclear ribosomal ITS region was amplified using primers ITS4 and ITS5A using the following thermocycler settings: initial denaturation step of 4 min at 95 °C, followed 35 cycles at 94 °C for 30 s, 52 °C for 30 s, 72 °C for 1 min 30 s, and a final extension of 10 min at 72 °C (Table 1). All PCR products were cleaned with ExoSAP-IT (USB, Cleveland, Ohio, USA). DNA sequencing was performed with BigDye Terminator Cycle Sequencing v.3.1 (PE Applied Biosystems, Foster City, CA, USA) according to the following parameters: 80 °C, 5 min; 25 or 30 cycles of 95 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min. Sequenced products were analyzed on an ABI PRISM 3730 DNA Analyzer 7900HT (ABI). The regions rpl32-trnL, rps3, rps16 intron, 30 rps16– 50 trnK, ndhF (coding region) and ITS were sequenced in one direction. Relatively short regions (500–750 bp) covered by our primers were easily interpreted allowing us to accumulate sequences from different parts of the genome for phylogenetic inference (Shaw et al., 2005;2007). Only ndhA intron (933 bp) was sequenced in both directions and the program Sequencer 4.8 (Gene Code Corporation, 1991–2007) was employed to produce the contig sequence for the entire region. 2.3. Phylogenetic analyses Sequence alignment was done manually using BioEdit v.7.0.5.3 (Hall, 1999). The indels and ambiguously aligned regions were Table 1 Regions studied, sequences, melting temperature (°C), and quality of primers used for PCR and sequencing. Region Primers Sequence (50 –30 ) Tm Quality Reference ndhF ndhF2091R ndhF1311F trnL(UAG) rpL32-F GACCCACTCCATTGGTAATTC ACTGCAGGATTAACTGCGTT CTGCTTCCTAAGAGCAGCGT CAGTTCCAAAAAAACGTACTTC 57.8 56.8 60.0 53.7 70 113 120 103 Romaschenko et al. (in press) Romaschenko et al. (in press) As Shaw et al. (2007) As Shaw et al. (2007) rps16-trnK rpS16–900F 3914PR TATCGAATCGTTGCAATTGATG CATTGAGTTAGCAACCCAGATA 53.9 55.3 108 105 Modified rpS16R of Shaw et al. (2005) Modified trnK3914F of Johnson and Soltis (1995) rps3 rps3C697R rps3C29F TCTTCGTCTACGAATATCCA TCAGACTTGGTACAACCCAA 57.8 53.4 105 64 This study This study rps16 intron rpS16F rpS16R AAACGATGTGGTAGAAAGCAAC ACATCAATTGCAACGATTCGATA 56.3 55.0 80 100 Modified as Shaw et al. (2005) Modified as Shaw et al. (2005) ndhA ndhA  4 ndhA  3 ITS5a ITS4 CTAGCAATATCTCTACGTGYGATTCG GACTGTGCTTCAACTATATCAACTG CCTTATCATTTAGAGGAAGGAG TCCTCCGCTTATTGATATGC 53.9 53.7 53.7 55.0 55 69 82 38 rpl32-trnL ITS This study This study Stanford et al. (2000) White et al., 1990 583 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Table 2 Summary of six plastid regions and nrDNA ITS used in this study. Aligned sequence length (alSL) Average sequence length (SL) No. of taxa No. of excluded characters Proportion of excluded characters (%) No. of parsimony informative characters (PIC) PIC/SL PIC/TL Tree length (TL) Consistency index (CI) Homoplasy index (HI) Retention index (RI) Rescaled consistency index (RC) AIC ndhF rpl32trnL rps16trnK rps3 rps16 intron ndhA intron Plastid ITS Combined plastid + ITS 796 734 211 2 0.3 286 1389 695 246 364 26.2 385 1222 723 244 213 17.4 411 590 579 250 0 0.0 152 1368 745 225 0 0.0 283 1424 933 219 0 0.0 431 6789 4409 268 579 8.5 1948 814 669 234 89 10.9 428 7603 5078 268 668 8.8 2377 0.39 0.237 1205 0.3627 0.6373 0.7899 0.2865 GTR + G 0.554 0.259 1487 0.4385 0.5615 0.7997 0.3506 GTR + G 0.568 0.309 1328 0.4819 0.5181 0.8304 0.4002 HKY + G 0.263 0.263 577 0.3588 0.6412 0.7876 0.2826 TVM + G 0.380 0.319 886 0.5011 0.4989 0.8235 0.4127 TIM + G 0.462 0.293 1470 0.4687 0.5313 0.8243 0.3864 GTR + G 0.442 0.259 7534 0.4153 0.5847 0.7932 0.3294 GTR + G 0.640 0.093 4627 0.209 0.791 0.7346 0.1535 GTR + G 0.468 0.19.3 12332 0.3323 0.6677 0.7658 0.2545 GTR + G excluded from analyses. The length of sequences and amount of excluded data for each region is presented in Table 2. No data was excluded from rps3, rps16 intron, and ndhA intron. All gaps were treated as missing data. We used maximum likelihood and Bayesian analysis to infer phylogeny. The maximum likelihood analysis was conducted with the programme GARLI 0.951 (Zwickl, 2006). All separate and combined maximum likelihood analyses were run under single model GTR + I + G. The maximum likelihood bootstrap analyses were performed with the default parameters with ‘‘bootstrapreps” option set for 1000 replicates. The majorityrule consensus tree of resulting best trees found for each bootstrap reweighted dataset was constructed in PAUP* 4.0b10 (Swofford, 2000). The output file containing best trees found for each bootstrap reweighted dataset was then read into PAUP* 4.0b10 (Swofford, 2000) where the majority-rule consensus tree was constructed and bootstrap support values were calculated. Bootstrap (BS) values of 90–100 were interpreted as strong support; 70–89 as moderate, and 50–69 as weak. Bayesian posterior probabilities were estimated using MrBayes 3.01 (Huelsenbeck and Ronquist, 2001; Ronquist et al., 2005) and the appropriate evolutionary models were selected using MrModeltest 1.1b (Nylander, 2002). MrModeltest selected models with gamma-distributed rate variation across sites with number of substitution types Nst = 6 for almost all datasets with exception of the 30 rps16–50 trnK region where the HKY + G (Nst = 2) was selected as best-fitted model by Akaike information criterion (AIC) (Table 2). The plastid dataset and combined plastid + ITS dataset for Bayesian analysis were then partitioned into two subsets that were processed implementing different parameters suggested by MrModeltest concerning the model for among site rate variation, number of substitution types, substitution rates and gamma shape parameter. All other parameters were left at default settings. Each Bayesian analysis was initiated with random starting trees and was initially run for two million generations with sampling frequency of the chains set at the 100th iteration. The analysis was continued until the value of standard deviation of split sequences dropped below 0.01 as convergence diagnostic value (Huelsenbeck and Ronquist, 2001). The fraction of the sampled values discarded as burn in was set at 0.25. Posterior probabilities (PP) of 0.95–1.00 were considered statistically significant. 3. Results 3.1. Analysis of ITS sequences The number of taxa included in the ITS analysis was 234 (including five outgroup); average sequence length was 669; num- ber of PIC’s was 428; and the tree length was 4627 with a consistency index (CI) of 0.209, homoplasy index (HI) of 0.791, retention index (RI) of 0.7346, and a rescaled consistency index (RC) of 0.1535 (Table 2). The best maximum likelihood tree with bootstrap (BS) values shown above the branches and posterior probabilities (PP) shown below the branches is illustrated in Fig. 1. The major tribes within a monophyletic Chloridoideae (BS = 95, PP = 1.00) are well resolved. The tribes Cynodonteae (BS = 69, PP = 1.00) and Zoysieae (BS = 63, PP = 0.92) are sister, sister to this clade (BS = 96, PP = 1.00) is the Eragrostideae (BS = 74, PP = 0.98), and sister to this clade (BS = 100, PP = 1.00) is the Triraphideae (BS = 97, PP = 1.00). The Cynodonteae is composed of the following 13 well resolved subtribes: Aeluropodinae (BS = 100, PP = 1.00), Boutelouinae (BS = 94, PP = 1.00), Eleusininae (BS = 78, PP = 0.50), Tridentinae (BS = 88, PP = 0.99), Hilariinae (BS = 100, PP = 1.00), Monanthochloinae (BS = 81, PP = 1.00), Muhlenbergiinae (BS = 75, PP = 0.52), Scleropogoninae (BS = 53, PP = 0.87), Orcuttiinae (BS = 100. PP = 1.00), Pappophorinae (BS = 78, PP = 0.96), Traginae (BS = 100. PP = 1.00), Triodiinae (BS = 91, PP = 1.00), and the Tripogoninae (BS = 53). There is very little backbone support in the tree and relationships among subtribes are not well resolved. The Aeluropodinae, Boutelouinae, Orcuttiinae, Triodiinae, and Tripogoninae each contain multiple species in a single genus, Aeluropus (3 spp.), Bouteloua (12 spp.), Tuctoria (2 spp.), Triodia (10 spp.), and Tripogon (2 spp.), respectively. The Tridentinae includes four genera, Gouinia, Tridens, Triplasis, and Vaseyochloa, each represented by a single species. The Hilariinae includes two accessions of Hilaria cenchroides. The Traginae includes four genera: a polyphyletic Tragus that includes Monelytrum luederitzianum-Willkommia sarmentosa-Willkommia texana (BS = 69, PP = 1.00) that are sister to four species of Tragus (BS = 100, PP = 1.00), sister to all these species is Polevansia rigida (BS = 100, PP = 1.00). The Tripogoninae includes Eragrostiella leioptera, Tripogon yunnanensis, and Tripogon spicatus as a clade (BS = 100, PP = 1.00) and sister to this is Melanocenchris royleana (BS = 53). The Monanthochloinae includes three genera: a polyphyletic Distichlis, imbedded is a clade with Monanthochloe littoralis and Reederochloa eludens (BS = 66, PP = 1.00). The Scleropogoninae includes six genera: two species of Munroa are sister (BS = 100, PP = 1.00), sister to this is Dasyochloa pulchella (BS = 100, PP = 1.00), sister to this clade (BS = 100, PP = 1.00) are two species of Erioneuron (BS = 100, PP = 1.00); two species of Blepharidachne are sister (BS = 77, PP = 0.99), sister to this is an unsupported clade of Scleropogon brevifolius. Blepharidachne, Dasyochloa, Erioneuron, Munroa, and Scleropogon form a clade (BS = 78, PP = 1.00) and sister to this is Swallenia alexandrae (BS = 53, PP = 0.87). The Muhlenbergiinae includes nine genera (10 genera included in the plastid and combined tree): a poly- 584 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Fig. 1. Phylogram of best maximum likelihood tree from analysis of nuclear ITS data. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values; taxon colour indicates native distribution as follows: green = African, blue = Asian, purple = Australian, red = American (includes North and South America). (For interpretation of color mentioned in this figure the reader is referred to the web version of the article.) phyletic Muhlenbergia, embedded are clades of Bealia mexicana, Blepharoneuron shepherdii, and B. tricholepis (BS = 86, PP = 0.99); three species of Pereilema (BS = 54, PP = 0.63); two species of Aegopogon (BS = 100, PP = 1.00); Redfieldia flexuosa, Schedonnardus paniculatus; two accessions of Lycurus setosus (BS = 100, PP = 1.00); and three species of Chaboissaea (BS = 99, PP = 1.00). The Eleusininae includes 20 genera: a polyphyletic Cynodon clade (BS = 100, PP = 1.00) that includes Brachyachne convergens and B. tenella, sister to this is Chrysochloa hindsii (BS = 52, PP = 0.65), sister to these is a clade (BS = 84, PP = 0.97) of three species of Brachyachne (BS = 100, P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 585 Fig. 1 (continued) PP = 1.00); a polyphyletic Chloris clade (BS = 96, PP = 1.00) that includes a clade of Tetrapogon mossambicensis and Lintonia nutans (BS = 60, PP = 0.98); two species of Lepturus (BS = 100, PP = 1.00); two species of Microchloa (BS = 100, PP = 1.00); Tetrapogon spathaceus and T. villosus are sister (BS = 100, PP = 1.00), sister to this is Saugetia fasciculata (BS = 90, PP = 1.00); two species of Eustachys 586 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 (BS = 100, PP = 1.00); two species of Enteropogon (BS = 91, PP = 1.00); three species of Astrebla (BS = 100, PP = 1.00) that is sister to Austrochloris dichanthioides (BS = 96, PP = 1.00); two species of Trichloris that includes two accessions of T. pluriflora (BS = 100, PP = 1.00); Ceolachyrum poiflorum and Eleusine indica are sister (BS = 78, PP = 0.92), sister to this is Apochiton burtii (BS = 80, PP = 0.79); and unsupported clades of Leptochloa dubia, L. uninervia, and Schoenefeldia transiens. The following genera do not align within these 13 subtribes: two species of Cleistogenes (BS = 100, PP = 1.00) form a clade (PP = 0.99) with three species of Orinus (BS = 100, PP = 1.00); Leptochloa filiformis and Dinebra retroflexa (BS = 99, PP = 1.00) are sister, sister to this is Leptochloa viscida (BS = 90, PP = 1.00); four species of Dactyloctenium form a clade (BS = 100, PP = 1.00), sister to this is Brachychloa schiemanniana (BS = 57, PP = 0.71), and sister to these is Neobouteloua lophostachya (BS = 71, PP = 1.00); Bewsia biflora is an unsupported sister to the Pappophorinae; Dignathia hirtella and Gymnopogon grandiflorus are sister (PP = 0.55); three species of Perotis form a clade (BS = 98, PP = 1.00), sister to this is Mosdenia phleoides (BS = 100. PP = 1.00); two species of Ctenium (BS = 100, PP = 1.00) form a clade, sister to this is a clade (BS = 69, PP = 0.97) with two species of Trichoneura (BS = 99, PP = 1.00); male and female accessions of Allolepis texana form a clade (BS = 100, PP = 1.00) that is sister (PP = 0.71) with the Hilariinae; Jouvea pilosa is an unsupported sister to the Boutelouinae; and two accessions of Sohnsia filifolia (BS = 100, PP = 1.00) are sister to an unsupported clade containing the Muhlenbergiinae and the Scleropogoninae. Sister to the Cynodonteae is the Zoysieae that consists of two well resolved subtribes, the Sporobolinae (BS = 100, PP = 1.00) and the Zoysiinae (BS = 100, PP = 1.00). The Sporobolinae includes a polyphyletic Sporobolus with Calamovilfa longifolia, Spartina densiflora, and a clade of two species of Crypsis (BS = 100, PP = 1.00) embedded within. The Zoysiinae is represented by a single genus, Zoysia with three taxa in two species. Sister to the Cynodonteae and Zoysieae clade (BS = 96, PP = 1.00) is the Eragrostideae. The Eragrostideae is composed of three subtribes, the Eragrostidinae (PP = 0.90) is sister to the Uniolinae (BS = 53, PP = 0.94), this clade is sister to Cottea pappophoroides (PP = 0.90), and sister to all is Enneapogon desvauxii (BS = 51, PP = 0.92) (Cottea and Enneapogon form a well resolved Cotteinae in the plastid and combined tree, see Figs. 2 and 3). The Uniolinae contains a clade of two species of Uniola (BS = 93, PP = 1.00) that is sister to a clade with Entoplocamia aristulata and Tetrachne dregei (BS = 54, PP = 0.92). Within the Eragrostidinae, Eragrostis is polyphyletic and embedded within is a clade of three species of Ectrosia (BS = 99, PP = 1.00) that is sister to Harpachne harpachnoides (BS = 92, PP = 1.00); Psammagrostis wiseana is an unsupported member of an Australian clade (BS = 73, PP = 1.00) of Eragrostis that includes E. desertorum, E. dielsii, E. eriopoda, E. kennedyae, E. lanicaulis, and E. pergracilis. The Triraphideae is sister to the all remaining members of the Chloridoideae and this tribe consists of two genera: two species of Triraphis (BS = 82, PP = 0.92) form a clade that is sister to Neyraudia reynaudiana (BS = 97, PP = 1.00). 3.2. Analysis of plastid sequences The number of species included in the plastid analysis was 254 (268 total taxa, 14 species with two samples; 8 outgroup); average sequence length was 4409; number of PIC’s was 1948; and the tree length was 7534 with a consistency index (CI) of 0.4153, homoplasy index (HI) of 0.5847, retention index (RI) of 0.7932, and a rescaled consistency index (RC) of 0.3294 (Table 2). The overall topology of the plastid-derived phylogram is very similar to the ITS tree, although BS and PP values are usually higher for most clades (Fig. 2). The Eragrostideae (BS = 96, PP = 1.00) and Zoysieae (BS = 97, PP = 1.00) are now strongly supported and the Cynodonteae (BS = 85, PP = 1.00) is moderately supported. The Triraphideae (BS = 91, PP = 1.00) includes a monophyletic Triraphis clade (BS = 52, PP = 0.80) of five species that is sister to Neyraudia reynaudiana. Within the Eragrostideae, Cottea pappophoroides and Enneapogon desvauxii form a strongly supported Cotteinae clade (BS = 100, PP = 1.00) that is sister to remaining members (BS = 91, PP = 1.00). The Uniolinae (BS = 80, PP = 1.00) consists of Entoplocamia aristulata and Tetrachne dregei clade (BS = 74, PP = 1.00) sister to a monophyletic Uniola with U. condensata and U. paniculata (BS = 96, PP = 1.00). The Eragrostidinae still contains a polyphyletic Eragrostis (BS = 91, PP = 1.00) with most nodes supported by high BS and PP values. A major clade of Eragrostis species primarily from the Americas and Africa (BS = 65, PP = 0.84) is sister to a strongly supported clade of Harpachne harpachnoides plus three species of Ectrosia (BS = 100, PP = 1.00), together these are sister to a strongly supported Australian clade (BS = 100, PP = 1.00) of Psammagrostis wiseana plus five species of Eragrostis. In the Zoysieae, Pogoneura biflora is embedded within a polyphyletic Sporobolus and is aligned in a clade with two species of Crypsis (BS = 100, PP = 1.00). The bootstrap and posterior probability values (BS = 64, PP = 1.00) for the Sporobolinae are lower than in the ITS tree. Urochondra setulosa is sister to all remaining members of the Zoysieae (BS = 81, PP = 1.00). In the Cynodonteae, the 13 subtribes are well resolved although the Eleusininae has no bootstrap value (PP = 1.00), Tridentinae (BS = 61, PP = 1.00), Hilariinae (BS = 95, PP = 1.00), Orcuttiinae (BS = 91, PP = 1.00), and Traginae (BS = 92, PP = 1.00) have somewhat lower support values and the Boutelouinae (BS = 100, PP = 1.00), Monanthochloinae (BS = 97, PP = 1.00), Muhlenbergiinae (BS = 95, PP = 1.00), Scleropogoninae (BS = 99, PP = 1.00), and Pappophorinae (BS = 89, PP = 1.00) have higher support values. Lepturidium insulare, not in the ITS data set, is the closest sister to the Muhlenbergiinae, followed by Sohnsia with weak support (BS = 53, PP = 0.81). Alignment of the taxa within the Muhlenbergiinae is very similar to the ITS tree, although some support values are higher in the plastid phylogeny. Schaffnerella gracilis (not in ITS data) is sister (BS = 88, PP = 0.99) to Lycurus and together these are sister (BS = 78, PP = 0.99) to the Chaboissaea clade (BS = 100, PP = 1.00). The Scleropogoninae is not the immediate sister to the Muhlenbergiinae as in the ITS tree but is sister to the Sohnsia–Lepturidium–Muhlenbergiinae clade. Within the Scleropogoninae, Scleropogon is the basal member and Swallenia is sister to Blepharidachne. Monanthochloinae is sister to the Boutelouinae (BS = 77, PP = 1.00). In between the Pappophorinae and the Eleusininae is the Tripogoninae (PP = 1.00) that includes Melanocenchris sister to Tripogon plus Eragrostiella embedded within. This same relationship was recovered in the ITS phylogeny but the Tripogoninae was placed as sister to the Orcuttiinae. The Pappophorinae falls between the Tripogoninae and the Traginae. Within the Eleusininae, Leptochloa uninervia is basal followed by Austrochloris dichanthioides as sister to four species of Astrebla (BS = 63, PP = 0.91) with Schoenefeldia gracilis embedded within. Lintonia nutans is embedded in a clade with four other species of Chloris (BS = 90, PP = 1.00). Five species of Lepturus form a monophyletic lineage (BS = 70, PP = 1.00) as does Microchloa (BS = 100, PP = 1.00). Brachyachne chrysolepis, B. fibrosa, and B. pateniflora again form a strongly supported clade (BS = 100, PP = 1.00), and nine species of Cynodon form a strongly supported clade (BS = 90, PP = 1.00) with Brachyachne convergens and B. tenella embedded within (also found in the ITS tree). Saugetia forms a strongly supported clade (BS = 99, PP = 1.00) with two species of Tetrapogon. In the incertae sedis genera, the Orinus clade (BS = 100, PP = 1.00) forms a clade (BS = 70, PP = 1.00) with the Triodiinae (BS = 90, PP = 1.00) and this clade is sister to the Aeluropodinae. Bewsia biflora and Gymnopogon grandiflorus are sister (BS = 78, PP = 1.00) and they form a clade (BS = 61, PP = 1.00) with two species of Dignathia (BS = 98, PP = 1.00). P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 587 Fig. 2. Phylogram of best maximum likelihood tree from analysis of plastid data. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values; taxon colour indicates native distribution as follows: green = African, blue = Asian, purple = Australian, red = American (includes North and South America). (For interpretation of color mentioned in this figure the reader is referred to the web version of the article.) 588 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Fig. 2 (continued) P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 589 Fig. 3. Phylogram of best maximum likelihood tree from analysis of combined plastid and nuclear ITS data. Numbers above branches represent bootstrap values; numbers below branches are posterior probability values; taxon colour indicates native distribution as follows: green = African, blue = Asian, purple = Australian, red = American (includes North and South America). (For interpretation of color mentioned in this figure the reader is referred to the web version of the article.) 3.3. Combined plastid and ITS sequences The number of taxa included in the combined plastid and ITS analysis was 268 (8 outgroup); average sequence length was 5078; number of PIC’s was 2377; and the tree length was 12332 with a consistency index (CI) of 0.3323, homoplasy index (HI) of 0.6677, retention index (RI) of 0.7658, and a rescaled consistency index (RC) of 0.2545 (Table 2). The overall topology of the com- 590 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Fig. 3 (continued) P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 bined plastid and ITS-derived phylogram is similar to the plastid tree. The major tribes within a monophyletic Chloridoideae (BS = 100, PP = 1.00) are well resolved. The Cynodonteae (BS = 83, PP = 1.00) and Zoysieae (BS = 88, PP = 1.00) form a clade (BS = 100, PP = 1.00) and they are sister to the Eragrostideae (BS = 98, PP = 1.00), and sister to all of these tribes is the Triraphideae (BS = 83, PP = 1.00). Within the Cynodonteae, the Aeluropodinae, Boutelouinae, Hilariinae, Monanthochloinae, Muhlenbergiinae, Scleropogoninae, Orcuttiinae, Pappophorinae, Traginae, and the Triodiinae are strongly supported clades (BS = 93–100, PP = 1.00). The Eleusininae has only posterior probability support (PP = 1.00) and the Tridentinae (BS = 87, PP = 1.00) and Tripogoninae (BS = 83, PP = 1.00) are moderately supported. There is support for relationships among these subtribes since there is some structure within the deep nodes of this phylogram. The Muhlenbergiinae is the most derived subtribe, there is weak support for the Sohnsia–Lepturidium–Muhlenbergiinae clade (BS = 66, P = 0.93), and the Scleropogoninae is moderately supported as the sister to Sohnsia–Lepturidium–Muhlenbergiinae clade (BS = 83, PP = 0.99). The Boutelouinae and the Monanthochloinae are weakly supported (BS = 67, PP = 1.00) as sister and the Hilariinae–Boutelouinae–Monanathochloinae–Scleropogoninae–Sohnsia–Lepturidium–Muhlenbergiinae is weakly supported (BS = 67, PP = 1.00). The Traginae has posterior probability support (PP = 1.00) as sister to the Hilariinae–Boutelouinae– Monanathochloinae–Scleropogoninae–Sohnsia–Lepturidium–Muhlenbergiinae clade. Alignment within the Eleusininae is very similar to that found in the plastid tree, again with strong support (BS = 99–100, PP = 1.00) for the following: three species of Brachyachne, three species of Trichloris, a polyphyletic Astrebla with Schoenefeldia gracilis embedded, four species of Chloris, and two species of Microchloa. A polyphyletic Cynodon that includes Brachyachne convergens and B. tenella and five species of Lepturus are moderately supported (BS = 89, PP = 1.00). 3.4. Nomenclature novelties Based on our results we propose a new classification for the Chloridoideae (Table 3) and the following names are necessary to realign the genera now recognized in the subfamily. Merxmuellera papposa (Nees) Conert, M. rangei (Pilg.) Conert, and the four species now currently placed in Centropodia Rchb. are not included in the proposed new classification since their placement as sister to the Chloridoideae is equivocal in all molecular trees to date (Barker et al., 1999, 2000; GPWG, 2001; Roodt-Wilding and Spies, 2006; Bouchenak-Khelladi et al., 2008). One or both genera may possibly align within the Chloridoideae but this has not been thoroughly investigated. Tribe Cynodonteae, subtribe Aeluropodinae P. M. Peterson, stat. nov. — TYPE: Aeluropus Trin., Fund. Agrost. 143, pl. 12. 1820. Basionym: Aeluropodeae trib. Nevski ex Bor, Oesterr. Bot. Z. 112: 184. 1965. Included genera: Aeluropus. Tribe Triraphideae P. M. Peterson, stat. nov. — TYPE: Triraphis R. Br., Prodr. 185. 1810. Basionym: Triraphidinae subtrib. Stapf, Fl. Trop. Afr. 9: 22. 1917. Included genera: Neyraudia, Triraphis. 4. Discussion 4.1. Phylogenetic relationships 4.1.1. Tribes and subtribes In our overall tribal relationships, Cynodonteae and Zoysieae are sisters, and sister to this are Eragrostideae, and sister to all are Triraphideae. This corroborates results by Hilu et al. (1999) using only a few taxa, by Columbus et al. (2007) in their ITS and 591 trnL-F study, and by Bouchenak-Khelladi et al. (2008) in their three plastid gene (rbcL, matK, and trnL-F) survey of the grasses. Only the latter study included members of the Triraphideae, and they found it to be sister to the Eragrostideae, and these in turn sister to a clade containing the Zoysieae and the Cynodonteae. Bell and Columbus (2008a) reported in an oral paper and abstract that their combined data set of ITS, trnL-F, and ndhF sequences yielded a tree with the following order of divergence: ‘‘Triraphis, an Eragrostis clade, and a Sporobolus clade that is sister to a large clade with two sub lineages, one comprised of primarily Old World and cosmopolitan taxa and the other primarily New World.” Based on matK sequences and a full sampling of genera and species, Hilu and Alice (2001) found support for the recognition of the Zoysieae, Eragrostideae, Cynodonteae, and Triraphis but their order of derivation was equivocal. Our hypothesized phylogeny is the first to verify with medium to strong support values the stepwise derivation of the Triraphideae, Eragrostideae, Zoysieae, to the Cynodonteae. In the Triraphideae, Bouchenak-Khelladi et al. (2008) were first to show strong support for Neyraudia and Triraphis as being sister. We offer moderate support for the monophyly of Triraphis having sampled five of the seven known species. Clayton and Renvoize (1986) pointed out that Triraphis was perhaps an ally of Neyraudia since both genera possess slender panicoid-like microhairs and the two have keeled lemmas that are villous on the lateral nerves (Watson and Dallwitz, 1992a). Hilu and Alice (2001) and Bouchenak-Khelladi et al. (2008) who both used the same matK sequence place this taxon in the Uniolinae. We have ITS and rps16-spacer sequences support (although only weakly) for Tetrachne as sister to Uniola. We have moderate to strong support (BS = 85, PP = 1.00) for order of divergence of the Cotteinae, Uniolinae, and the Eragrostidinae. Within the Eragrostidinae, our data indicate that Eragrostis is polyphyletic since three genera (Ectrosia, Harpachne harpachnoides, and Psammagrostis wiseana) are embedded within. We advocate subsuming the previous three genera within Eragrostis since it would be much easier to expand the circumscription than to begin splitting out small clades within this large genus (400 + spp., Simon et al., 2009). Ectrosia along with Pogonarthria squarrosa (Roem. & Schult.) Pilg. were found embedded within a polyphyletic Eragrostis (Columbus et al., 2007). Based on a survey of rps16 and nuclear waxy gene sequences from a broad range of Eragrostis species, Ingram and Doyle (2003, 2004, 2007) have advocated that other small segregate genera such as Acamptoclados Nash, Diandrochloa De Winter, and Neeragrostis Bush be included with Eragrostis. Roodt-Wilding and Spies (2006) in their ITS and trnL-F strict consensus tree found Catalepis, Cladoraphis, and Pogonarthria all embedded in a polyphyletic Eragrostis clade. There is a geographic signal within our expanded Eragrostis since the clade containing Psammagrostis wiseana, E. desertorum, E. dielsii, E. eriopoda, E. lanicaulis, and E. pergracilis, all endemic to Australia, are sister to the remaining species in the genus. The thickened to coriaceous spikelets of Psammagrostis are very similar to those found in E. dielsii and E. lanicaulis (Clayton and Renvoize, 1986; Lazarides, 1997). Harpachne has a raceme inflorescence with reflexed spikelets that are very similar to other species of Eragrostis whereas species of Ectrosia have 1-nerved glumes and awned lemmas that are 1–3-nerved (Watson and Dallwitz, 1992a; Nightingale and Weiller, 2005a). Mucronate lemmas have been reported for a few species of Eragrostis but by addition of the 12 Australian–Malaysian species of Ectrosia the circumscription will need emendation. Sister to the Eragrostidinae is the Uniolinae where we provide the first molecular evidence for Entoplocamia and Tetrachne (BS = 75, PP = 1.00 in Fig. 3) each monotypic genera from Africa, as being sister to two species of Uniola. Clayton (1982) included Fingerhuthia Staph and Tetrachne in this subtribe, and this has been corroborated with molecular studies (Hilu and Alice, 2001; Colum- 592 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Table 3 A proposed tribal and subtribal classification of genera in subfamily Chloridoideae (Poaceae). The proposed assignments are based on plastid and nuclear DNA analyses (*= not examined in this study) and/or morphology. See footnotes legend below for placement of taxon by Clayton and Renvoize (1986). Subfamily Chloridoideae Incertae sedis: *Afrotrichloris Chiov., *Daknopholis Clayton, *Decaryella A. Camus, *Desmostachya (Hook.f) Stapf, *Drake-Brockmania Stapf, *Farrago Clayton, *Habrochloa C.E. Hubb., *Halopyrum Stapf, *Hubbardochloa Auquier, *Indopoa Bor, *Kampochloa Clayton, *Kaokochloa De Winter, *Leptocarydion Stapf, *Leptothrium Kunth, *Lepturopetium Morat, *Lophachme Stapf, *Myriostachya (Benth.) Hook.f., *Neostapfiella A. Camus, *Ochthochloa Edgew., *Odyssea Stapf, *Oropetium Trin.,*Pogonochloa C.E. Hubb., *Pommereulla L.f., *Pseudozoysia Chiov., *Psilolemma S.M. Phillips, *Silentvalleya V.J. Nair, *Tetrachaete Chiov., *Viguierella A. Camus Tribe Triraphideae P.M. Peterson: Neyraudia Hook. f.a, Triraphis R. Br.a Tribe Eragrostideae Stapf Incertae sedis: *Cladoraphis Franch. Subtribe Cotteinae Reederb: Cottea Kunthb, Enneapogon P. Beauv.b, *Schmidtia Steud. ex J.A. Schmidt Subtribe Eragrostidinae J. Presla: *Catalepis Stapf, Ectrosia R. Br.a [includes *Ectrosiopsis (Ohwi) Ohwi ex Jansen, see Nightingale and Weiller, 2005], Eragrostis Wolfa(includes *Acamptoclados Nash, *Diandrochloa De Winter, and Neeragrostis Bush), Harpachne A. Rich.a, *Heterachne Benth., *Pogonarthria Stapf, Psammagrostis C.A. Gardner & C.E. Hubb.a, *Richardsiella Elffers & Kenn.-O’Byrne, *Steirachne Ekman Subtribe Uniolinae Clayton: Entoplocamia Stapf, *Fingerhuthia Nees ex Lehm., *Stiburus Stapf, Tetrachne Nees, Uniola L. Tribe Zoysieae Benth.c Incertae sedis: Urochondra C.E. Hubb.d Subtribe Zoysiinae Benth.c: Zoysia Willd. Subtribe Sporobolinae Benthe: Calamovilfa (A. Gray) Scribn.d, Crypsis Aitond, Pogoneura Nappera, Spartina Schreb.f, Sporobolus R. Br.d, *Thellungia Stapf Tribe Cynodonteae Dumort. Incertae sedis: Acrachne Wight & Arn. ex Chiov.a, Allolepis Soderstr. & H.F. Deckerg, Bewsia Goossensa, Brachychloa S.M. Phillipsa, Cleistogenes Kenga, Craspedorhachis Benth.f, Ctenium Panz.f, Dactyloctenium Willd.a, Dignathia Stapfm, Gymnopogon P. Beauv.f, Jouvea E. Fourn.g, Lepturidium Hitchc. & Ekmanf, Lopholepis Decne.m, Mosdenia Stentl, Neobouteloua Gouldl, Orinus Hitchc.a, Perotis Aitonl, Sohnsia Airy Shawa, Trichoneura Anderssona Subtribe Aeluropodinae P.M. Peterson: Aeluropus Trin.e Subtribe Triodiinae Benth.g: *Monodia S.W.L. Jacobs, *Symplectrodia Lazarides, Triodia R. Br. (includes *Plectrachne Henrard see Lazarides et al., 2005) Subtribe Orcuttiinae P.M. Peterson & Columbush: *Neostapfia Burtt Davy, Orcuttia Vasey, Tuctoria Reeder Subtribe Tridentinae Keng & Keng f.a: Gouinia E. Fourn. ex Benth. & Hooka (includes Schenckochloa J.J. Ortiz), Tridens Roem. & Schult.a, Triplasis P. Beauv.a, Vaseyochloa Hitchc.a Subtribe Eleusininae Dumort.e: Apochiton C.E. Hubb.a, Astrebla F. Muell.i, Austrochloris Lazaridesf, Brachyachne (Benth.) Stapff, Chloris Sw.f, Chrysochloa Swallenf, Coelachyrum Hochst. & Neesa(includes Coelachyropsis Bor, Cypholepis Chiov.), Cynodon Rich.f, Dinebra Jacq.a, Eleusine Gaertn.a, Enteropogon Neesf, Eustachys Desv.f, *Harpochloa Kunth, Leptochloa P. Beauv.a, Lepturus R. Br.j, Lintonia Stapfi, Microchloa R. Br.f, *Oxychloris Lazarides, *Rendlia Chiov., *Rheochloa Filg., P.M. Peterson & Y. Herrera, Tetrapogon Desf.f, Trichloris Benth.f, Saugetia Hitchc. & Chasek, Schoenefeldia Kunthf, Sclerodactylon Stapfa Subtribe Tripogoninae Stapfa: Eragrostiella Bora, Melanocenchris Neesl, Tripogon Roem. & Schult.a Subtribe Pappophorinae Dumort.b: Neesiochloa Pilg.a, Pappophorum Schreb.b Subtribe Traginae P.M. Peterson & Columbus: Monelytrum Hack.m, Polevansia De Winterf, Tragus Hallerm, Willkommia Hack.f Subtribe Hilariinae P.M. Peterson & Columbus: Hilaria Kunthl, *Pleuraphis Torr.n Subtribe Monanthochloinae Pilg. ex Potztale: Distichlis Raf. (includes Monanthochloe Engelm., Reederochloa Soderst. & H.F. Decker) Subtribe Boutelouinae Stapf: Bouteloua Lag. (includes Buchloe Engelm., *Buchlomimus Reeder, C. Reeder & Rzed., Cathesticum J. Presl, Chondrosum Desv., Cyclostachya Reeder & C. Reeder, *Griffithsochloa G.J. Pierce, Opizia J. Presl, *Pentarraphis Kunth, *Pringleochloa Scribn., and *Soderstromia C.V. Morton, see Columbus, 1999) Subtribe Scleropogoninae Pilg.a: Blepharidachne Hack.a, Dasyochloa Rydb.o, Erioneuron Nasha, Munroa Torr.a, Scleropogon Phil.a, Swallenia Soderstr. & H.F. Deckerg Subtribe Muhlenbergiinae Pilg.d: Aegopogon Humb. & Bonpl. ex Willd.l, Bealia Scribn.p, Blepharoneuron Nasha, Chaboissaea E. Fournp, Lycurus Kunthd, Muhlenbergia Schreb.d, Pereilema J. Presld, Redfieldia Vaseya, Schaffnerella Nashl, Schedonnardus Steud.f a b c d e f g h i j k l m n o p Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed Placed in in in in in in in in in in in in in in in in tribe Eragrostideae, subtribe Eleusininae. tribe Pappophoreae Kunth. tribe Cynodonteae. tribe Eragrostideae, subtribe Sporobolinae. tribe Eragrostideae. tribe Cynodonteae, subtribe Chloridinae J. Presl. tribe Eragrostideae, subtribe Monanthochloinae. tribe Orcuttieae Reeder. tribe Cynodonteae, subtribe Pommereullinae Pilg. ex Potztal. tribe Leptureae Holmberg. Enteropogon. subtribe Boutelouinae. subtribe Zoysiinae. Hilaria. Erioneuron. Muhlenbergia. bus et al., 2007; Bouchenak-Khelladi et al.,2008). Roodt-Wilding and Spies (2006) in their strict consensus tree of ITS sequence data found strong support for a clade containing Entoplocamia and Fingerhuthia. All three genera have a raceme inflorescence, a line of hairs for the ligule, and 5–11-nerved lemmas (Watson and Dall- witz, 1992a). The basal member of the Eragrostideae is the Cotteinae and this has been recovered along with the inclusion of Schmidtia Steud. ex J.A. Schmidt in other molecular studies (Hilu and Alice, 2001; Columbus et al., 2007; Bouchenak-Khelladi et al., 2008). P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 The Sporobolinae in our study includes a polyphyletic Sporobolus with Calamovilfa, Crypsis, Pogoneura, and Spartina embedded within. These genera have been verified as being embedded with Sporobolus in other molecular studies with the exception of Pogoneura (reported here) (Ortiz-Diaz and Culham, 2000; Hilu and Alice, 2001; Columbus et al., 2007; Bouchenak-Khelladi et al., 2008). Even though Sporobolus includes 200 species worldwide (Simon et al., 2009) and sampling within the genus for molecular studies have been rather small (42 species in Ortiz-Diaz and Culham, 2000), we recommend expansion of Sporobolus to include these genera. The monotypic genus, Pogoneura biflora from east Africa, is morphologically quite distinct from others members of Sporobolus since it has 2 or 3-flowered spikelets with short awned lemmas (Clayton and Renvoize, 1986). Sister to the Sporobolinae and Zoysiinae in our plastid and combined trees (we lack ITS sequence) is Urochondra setulosa, a monotypic species from northeast Africa. Like Zoysia, Urochondra has 1-flowered spikelets with 1nerved and awnless glumes, 1-nerved lemmas, and lacks lodicules (Watson and Dallwitz, 1992a). The most derived tribe within the Chloridoideae, the Cynodonteae exhibits a wide range of morphological variation and we currently recognize 13 well supported subtribes. Relationships among these subtribes are fairly well elucidated since there are support indexes at many of the deep nodes in our combined plastid-ITS phylogram. Our clade uniting, in order of divergence, the Hilariinae with Allolepis and Jouvea, Monanthochloinae, Boutelouinae, Scleropogoninae, Sohnsia, Lepturidium, and Muhlenbergiinae is almost entirely New World (western hemisphere) in origin and current distribution. The Muhlenbergiinae are here represented by 33 species and it is clear that Muhlenbergia is polyphyletic and that Aegopogon, Bealia, Blepharoneuron, Chaboissaea, Lycurus, Pereilema, Redfieldia, Schaffnerella, and Schedonnardus are nested within (Duvall et al., 1994; Columbus et al., 2007;in press; Peterson et al., in review). The subgeneric classification within the Muhlenbergiinae has recently been studied and there is strong support for a subgeneric classification to recognize five clades (Peterson, 2000; Peterson and Herrera Arrieta, 2001; Peterson et al., in review). In the combined plastid and ITS tree in Peterson et al. (in review) there is moderate support for M. sect. Bealia that includes Bealia, two species of Blepharoneuron, M. arenicola, and M. torreyi (BS = 83, PP = 0.95); strong support of M. subg. Trichochloa that includes M. emersleyi, M. gigantea, M. macroura, M. rigens, and M. rigida (BS = 99, PP = 1.00); strong support for M. subg. Muhlenbergia that includes two species of Aegopogon, three species of Pereilema, M. appressa, M. brandegei, M. racemosa, and M. schreberi (BS = 100, PP = 0.99); strong support for M. subg. Clomena that includes M. flaviseta, M. montana, and M. peruviana; and strong support for a M. unranked Pseudosporobolus clade that contains three species of Chaboissaea, two species of Lycurus, Redfieldia, Schaffnerella, Schedonnardus, M. arenacea, M. richardsonis, and M. uniflora (BS = 92, PP = 0.66). Sister to the Muhlenbergiinae–Lepturidium–Sohnsia clade is the Scleropogoninae that consists of the following six genera: Blepharidachne, Dasyochloa, Erioneuron, Munroa, Scleropogon, and Swallenia. In a combined ITS and trnL-F tree, Columbus et al. (2007) obtained strong support for a clade of Dasyochloa, Erioneuron, and Munroa. In this same tree Columbus et al. (2007) recovered an unsupported clade containing Blepharidachne, Scleropogon, and Swallenia. Morphologically, these species share lemmas that are often chartaceous to coriaceous with ciliate margins and usually narrow and condensed inflorescences (Watson and Dallwitz, 1992a). Florets are perfect in Dasyochloa, Erioneuron, and Swallenia, can be unisexual in Blepharidachne and Munroa, while individual plants of Scleropogon are male or female (dioecious) or sometimes of both sexes (monoecious). We provide the 593 first molecular support for including Blepharidachne, Scleropogon, and Swallenia in the Scleropogoninae, hence placing Munroinae in synonymy (Peterson et al., 1995). In our study the Monanthochloinae and Boutelouinae are sister (BS = 67, PP = 1.00 in Fig. 3) and both subtribes have been the subject of molecular studies. Based on ITS and trnL-F sequences Columbus (1999) and Columbus et al. (1998, 2000) subsumed nine genera (many of these were unisexual) to accommodate a monophyletic Bouteloua. We also support this view since at least three (Buchloe, Cathestecum, and Opizia) were included in our analysis and all our trees depict a strongly supported Boutelouinae (excluding Neobouteloua). In a three gene study (ITS, ndhF, and trnL-F) of the Monanthochloinae, Bell and Columbus, 2008b proposed expanding Distichlis to include two species of Monanthochloe and Reederochloa eludens (=Distichlis eludens (Soderstr. & H. F. Decker) H. L. Bell & Columbus). Our data does not refute this decision and we agree with their interpretation even though our combined and plastid trees placed M. littoralis and Reederochloa in a clade as sister to the remaining three species of Distichlis. Our analysis did not include M. acerosa (Griseb.) Speg. (=Distichlis acerosa (Griseb.) H. L. Bell & Columbus) or Distichlis australis (Speg.) Villamil, both members of a clade with M. littoralis (=Distichlis littoralis (Engelm.) H. L. Bell & Columbus) and Reederochloa that was sister to all other species of Distichlis (Bell and Columbus, 2008b). The Traginae in our study includes a polyphyletic Tragus and Willkommia with a single species of Monelytrum (ditypic) and Polevansia (monotypic) imbedded within. Clayton and Renvoize (1986) indicate that Polevansia is ‘‘like Willkommia” in that both have Inflorescences with several racemes on an elongated axis and dorsally compressed spikelets; while Tragus and Monelytrum have cylindrical false racemes with each branch short pedunculate, dorsally compressed spikelets, and lower glumes that are usually reduced to small scales. Columbus et al. (2007) was first to link Willkommia with Tragus where they were aligned as a pair with strong support. Our study is the first molecular evidence to link Monelytrum and Polevansia with Tragus–Willkommia. Six out of eight possible species of Tragus and three of the four species of Willkommia are included in our study (Clayton et al. 2008). This is very strong evidence for placing Willkommia within Tragus and it appears that Monelytrum and Polevansia should also be subsumed within Tragus. Species of this tribe are distributed in Africa and only Willkommia texana is endemic to the New World in USA and Argentina. We provide the first molecular support for including Neesiochloa (monotypic) in the Pappophorinae. All nine species of Pappophorum and Neesiochloa barbata are from the New World. The alignment of this subtribe is interesting since it is not part of the New World clade of Hilariinae–Jouvea–Allolepis–Monanthochloinae–Boutelouinae–Scleropogoninae–Sohnsia–Lepturidium–Muhlenbergiinae clade but is found in a different position in each of the three trees. We have moderate support (BS = 83, PP = 1.00 in the combined tree) for the Tripogoninae where Tripogon is polyphyletic with two species of Eragrostiella embedded within. Sister to this are two species of Melanocenchris. This is the first time that Eragrostiella and Tripogon have been linked and they are morphologically similar since both have winged paleas, strongly keeled and glabrous lemmas that are 1–3-nerved, and spike to racemose inflorescences (Watson and Dallwitz, 1992a). We recommend realignment of Tripogon to include Eragrostiella. Columbus et al. (2007) found Melanocenchris sister to Tripogon in their strict consensus tree based on trnL-F and ITS sequences. Most species in this subtribe are from the Old World tropics to Australia and a single species is found in tropical America (Clayton et al., 2008). 594 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 We have low bootstrap values (BS = 78 in ITS tree) but high posterior probability (PP = 1.00 in combined tree) for the Eleusininae and we have pretty good structure for this large and enigmatic subtribe. The Eleusininae as here recognized is a combination of the Pommereullinae, Chloridinae, and Eleusininae sensu Clayton and Renvoize (1986) and earlier authors. Morphologically and geographically this is a very diverse group although most species have racemose inflorescences and many species are found in tropical environments in Africa, Southeast Asia, the Americas, and Australia. Our trees lend support for the monophyly of Lepturus, Microchloa, and Trichloris; and support the expansion of the following: Astrebla (Schoenefeldia gracilis embedded in overall tree only), Chloris (Lintonia and Tetrapogon mossambicensis as sister or embedded within), Cynodon (Brachyachne convergens and B. tenella embedded), and Enteropogon (Eustachys distichophylla embedded in plastid and combined trees). Brachyachne, Eustachys, Leptochloa, and Tetrapogon are all clearly polyphyletic, although there is strong support for three species of Brachyachne (BS = 100, PP = 1.00 in all trees), two species of Eustachys (BS = 100, PP = 1.00 in all trees), and two species of Tetrapogon (BS = 100, PP = 1.00 in all trees). Clearly there is more work to be done to sort out relationships among these genera and to determine monophyletic lineages. This subtribe recovered by Roodt-Wilding and Spies (2006) whose strict consensus trees obtained from ITS and the combined ITS trnL-F sequences indicates moderate to strong support for a clade containing Chloris, Cynodon, Eustachys, Harpochloa, Microchloa, and Rendlia. The identical four genera (Gouinia, Tridens, Triplasis, and Vaseyochloa) in the Tridentinae were found to have moderate support (BS = 84) by Columbus et al. (2007) in their trnL-F + ITS strict consensus tree. Our results are concordant with theirs and we used Gouinia paraguayensis and Triplasis purpurea, two different species in our study. Members of the Tridentinae usually have pubescent lemma nerves, a line of hairs for the ligule, and keeled florets, although the monotypic Vaseyochloa has dorsally rounded florets (Clayton and Renvoize, 1986; Watson and Dallwitz, 1992a). Based on data reported in Columbus et al. (2007), Peterson et al. (2007) erected the subtribe Gouiniinae to include Gouinia and Vaseyochloa; this name is now placed in synonymy to accommodate the larger assemblage. The Orcuttiinae is a small group of nine annuals known from California, Baja California, and Baja California Sur whose unusual features of glandular hairs, leaves without ligules, and mushroom-button bicellular microhairs were first noted by Crampton (1959) and later recognized as a tribe by Reeder (1965). We have not sampled Neostapfia in our study but we still have strong support for two species of Tuctoria being sister to three species of Orcuttia (BS = 100, PP = 1.00 in the combined tree). This subtribe was recovered with strong support (BS = 100) in Columbus et al. (2007) in their trnL-F + ITS strict consensus tree and by Bouchenak-Khelladi et al. (2008) in their Bayesian consensus tree. Roalson and Columbus (1999) presented a phylogeny based on morphological characteristics that depict Tuctoria as a grade. Even though we lack one species of Tuctoria and two species of Orcuttia it appears that these two genera warrant recognition. We have strong support for the monophyly of Aeluropus (BS = 99, PP = 1.00 in combined tree) and Triodia (BS = 96, PP = 1.00 in combined tree), and for their treatment in separate subtribes, the Aeluropodinae and Triodiinae, respectively. We indicate that these two subtribes could be sister (PP = 0.99 in our ITS tree) to one another; and we have weak support for Aeluropodinae as sister to the Orinus–Triodiinae clade (BS = 54, PP = 1.00 in our combined tree). A molecular study of ITS, trnL-F, and ndhF sequences indicated that Aeluropus was related to the African Odyssea Stapf (not sampled in our study) and the Australian Troidia (Bell 2007). 4.1.2. Incertae sedis genera In the ITS tree species of Orinus and Cleistogenes form a clade (PP = 0.99) but in the plastid and combined trees they are not aligned near one another. Morphologically, these species although at first appearing very similar, have quite a few distinguishing characteristics with the former having long scaly rhizomes, pungent leaf blade apices, membranous ligules, and rachilla extensions beyond the upper floret, whereas the latter genus is composed of tufted perennials with unarmed leaf blades, a line of hairs for a ligule, and the occurrence of cleistogamous spikelets. Orinus contains four species from the Himalayas to western China (three spp. endemic) while Cleistogenes contains 13 species with 10 species occurring in China (five spp. endemic) (Chen and Phillips, 2006a,b). The relationship between these two genera warrants further study since we report equivocal results. In our study Dactyloctenium forms a strongly supported monophyletic genus with four species represented, including the Australian, D. australe. The genus contains about 13 species mainly from Africa to India and is characterized by digitate inflorescences composed of several linear to narrowly oblong secund spikes (Phillips, 1974). It has been linked to Eleusine but differs from the latter by having each raceme terminate in a bare rachis extension rather than a fertile floret (Clayton and Renvoize, 1986). We are the first to report Brachychloa as sister with weak support (BS = 66 in combined tree) and sister to these is Neobouteloua lophostachya with moderate support (BS = 73 in combined tree). Columbus et al. (2007) found a weakly supported clade (BS = 59) containing D. aegytium and N. lophostachya in their strict consensus tree based on trnL-F and ITS sequences. We are first to provide molecular evidence for the polyphyletic origin of Perotis (primarily African in distribution with 13 species) since Lopholepis ornithocephala (monotypic) and Craspedorhachis africana are embedded within a weakly supported clade (BS = 51, PP = 0.68 in the combined tree) (Clayton et al., 2008). We have only a single sequence (rps3) for Craspedorhachis and therefore its placement within Perotis may be due to a lack of variation within this single marker. Lopholepis is morphologically similar to Perotis as both share narrow racemes with spikelets borne on a short pedicel and falling with it, flat leaf blades that are cordate near base, laterally compressed spikelets, glumes that are longer than the floret (in Lopholepis this is developed into an obliquely constricted structure resembling a birds head), and awnless lemmas (Bor, 1960; Clayton and Renvoize, 1986; Watson and Dallwitz, 1992a). Sister to the Perotis–Lopholepis clade are Mosdenia leptostachys (PP = 1.00 in the combined tree) and M. phleoides (placed as a synonym of M. leptostachys in Clayton et al., 2008). Morphologically, Mosdenia is similar to Perotis but it has sessile spikelets and awnless glumes (Clayton and Renvoize, 1986). Dignathia (east African to India) appears monophyletic (BS = 94, PP = 1.00 in the combined tree) and these two species form a clade (BS = 83, PP = 1.00) with Gymnopogon grandiflorus (primarily New World in distribution; one species India to Thailand) and Bewsia biflora (monotypic from Africa) (Clayton and Renvoize, 1986). These species then form a clade with Mosdenia–Perotis–Lopholepis (PP = 0.72 in the combined tree). A monophyletic Trichoneura (distributed in Africa, Asia, and America) with two species forms a strongly supported clade (BS = 100, PP = 1.00 in the combined tree) and they are sister (BS = 67, PP = 0.79) to a monophyletic Ctenium (distributed in Africa, Madagascar, and America) with two species. Together, all these species form a clade (PP = 1.00) in the combined tree. Perhaps with greater sampling among species of Ctenium, Gymnopogon, Trichoneura, and all other genera not placed in a subtribe, we will be able to better resolve relationships and circumscribe other lineages within the Cynodonteae. P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 4.2. Biogeography All three phylograms indicate that the Chloridoideae might have originated in Africa and/or Asia since the basal lineage, the tribe Triraphideae, includes sister genera, Neyraudia and Triraphis, both with African and Asian distribution. Neyraudia contains four species all native to Asia with N. arundinacea (L.) Henrard (not in our study) also occurring in tropical Africa (Chen and Phillips, 2006c; Clayton et al., 2008). Triraphis consists of 8 species with six of these native to Africa; T. mollis R. Br. native to Australia and T. devia Filg. & Zuloaga (not in our study) native to South America (Filgueiras and Zuloaga, 1999; Nightingale and Weiller, 2005b). The latter species is more than likely derived and recently dispersed to South America. Because more than half of the genera of Chloridoideae reside in Africa and the larger tribes, such as, the Eragrostideae, Zoysieae, and Cynodonteae, excluding the Muhlenbergiinae, have centers of diversity there, Hartley and Slater (1960) concluded that the subfamily probably originated on the African continent (during the Oligocene) and spread to other parts of the world. Our data is equivocal and we cannot satisfactorily choose Africa or Asia as the likely area for the origin of the subfamily. Within the tribe Eragrostideae, the Cotteinae is sister to the Uniolinae Eragrostidinae clade (Figs. 2 and 3) and includes three genera: Cottea with a single species distributed in the Americas; Schmidtia (not in our study) with two species centered in Africa; and Enneapogon with 16 species native to Australia (15 of these endemic), 8 species native to Africa, and one species, E. desvauxii, distributed worldwide (Weiller and Lazarides, 2005; Clayton et al., 2008). Therefore, it seems likely that the tribe Eragrostideae might have originated in Australia and/or Africa and then radiated to all parts of the world. Eragrostis, the largest chloridoid genus estimated to have 423 species in the derived subtribe Eragrostidinae, has 212 species in Africa, 153 species in the Americas, 74 species in Australasia, 56 in tropical Asia, and 51 in temperate Asia (Clayton et al., 2008; Simon et al., 2009). Zoysia, the basal lineage within the tribe Zoysieae includes 11 species, six species in Asia, four in Australasia, one in Africa, one in the Pacific, and three introduced in the Americas (Peterson et al., 2001; Clayton et al., 2008). The Zoysieae might have originated in Asia where it is most speciose today and subsequently radiated. Sporobolus with 200 species in the derived subtribe Sporobolinae, includes 86 species in the Americas, 83 species in Africa, 59 species in Asia, and 23 species in Australasia (18 native to Australia) (Simon, 2005; Clayton et al., 2008; Simon et al., 2009). Even though we have rather poor backbone support for the derivation of subtribes within the tribe Cynodonteae, the total evidence phylogram (Fig. 3) suggests that Asia and/or Africa might have been the area of origin. The basal lineage, subtribe Aeluropodinae, consists of 5–10 species, five distributed in Asia (two endemic to China), two in Africa, and two in Europe (Chen and Phillips, 2006d; Clayton et al., 2008). Sister to the Aeluropodinae is Orinus with all four species from Asia and subtribe Triodiinae with 68 species in three genera (Monodia S.W.L. Jacobs and Symplectrodia Lazarides (not in our study) and Triodia) all endemic to Australia (Lazarides et al., 2005; Nightingale and Weiller, 2005c; Nightingale et al., 2005). As mentioned earlier, the derived clade containing the Hilariinae with Allolepis and Jouvea, Monanthochloinae, Boutelouinae, Scleropogoninae, Sohnsia, Lepturidium, and Muhlenbergiinae is almost entirely distributed in the Americas. Only six species of Muhlenbergia and one species of Distichlis are known to be disjunct in southeastern Asia and Australia, respectively. Earlier population studies of Chaboissaea, Lycurus, Scleropogon, and Muhlenbergia torreyi indicate that the subtribe Muhlenbergiinae probably originated in North America and has since radiated to South America 595 multiple times (Peterson and Herrera Arrieta, 1995; Peterson and Columbus, 1997; Sykes et al., 1997; Peterson and Morrone, 1998; Peterson and Ortiz-Diaz, 1998; Peterson et al. in review). Based on four Asian species studied within Muhlenbergia, there is evidence for a single colonization event from the Americas to southeastern Asia (Peterson et al., in review). Three other subtribes, the Tridentinae, Orcuttiinae, and Pappophorinae are also entirely New World in distribution but these are usually aligned near Old World-African subtribes and incertae sedis genera in our tree where there is little deep support among the nodes (see Fig. 3). The subtribe Tripogoninae contains three genera: Eragrostiella with six species, five distributed in tropical Asia, one in Australasia, and one in Africa; Melanocenchris with three species, two known in Africa and two from Asia; and Tripogon with approximately 30 species, 22 of these species from tropical Asia, nine from Africa, and three from the Americas. The subtribe Traginae is composed of four genera: Monelytrum and Polevansia each with a single species from Africa; Tragus with nine species, six in Africa, five in Asia, one endemic to Australia, and four introduced in the Americas (Peterson et al., 2001; Nightingale and Weiller, 2005d; Clayton et al., 2008). The subtribe Eleusininae is a diverse assemblage of at least 25 genera (as treated here) and is widely distributed. 4.3. Cytology Within the subfamily Chloridoideae there is a high frequency of polyploids ranging from diploid to 20-ploid (Pleuraphis mutica Buckley, not sampled in our study) and many of these are thought to be alloploids suggesting extensive hybridization (Roodt and Spies, 2003). The common base chromosome number for all chloridoid tribes treated here is x = 10 and this is the predominant number found in the Triraphideae, Eragrostideae, Zoysieae, and Cynodonteae. Lower base numbers are common in the Cotteinae (x = 9, 10), Sporobolinae (x = 7, 8, 9, 10), Eleusininae (x = 9, 10), Hilariinae (x = 9), Scleropogoninae (x = 7, 8, 10), and Muhlenbergiinae (x = 8, 9, 10) (Watson and Dallwitz, 1992a). 4.4. C4 evolution According to molecular dating C4 photosynthesis in the subfamily Chloridoideae originated between 32 and 25 mya in the early Miocene late Oligocene (Christin et al., 2008; Vicentini et al., 2008; Bouchenak-Khelladi et al., 2009). The genetic changes responsible for the evolution of C4 PCK subtype are still unidentified (Christin et al., 2009) and the development of this subtype is probably not identical, i.e., not analogous, in all lineages (Kellogg, 1999). In the Chloridoideae approximately 68% of the species are NAD-ME and as many as 31% have been estimated to be PCK (Taub, 2000). Based on a list of genera containing C4 grasses (Sage et al., 1999), within the Chloridoideae the PCK subtype has arisen many times and is found in the Triraphideae (Neyraudia), Eragrostideae, Zoysieae, and Cynodonteae. However, most of the PCK-like species were identified solely on their anatomical descriptions and very few species have actually been investigated biochemically to determine the predominant decarboxylating enzyme (Sage et al., 1999). In addition to being polyphyletic, the three largest genera: Eragrostis (Eragrostideae), Muhlenbergia (Cynodonteae), and Sporobolus (Zoysieae) apparently contain both PCK and NAD-ME species. With the exception of the Aeluropodinae, Triodiinae, and Orcuttiinae, all subtribes treated have at least one taxon that has been identified as having the PCK subtype. The Orcuttiinae with nine species in three genera (Neostapfia, Orcuttia, and Tuctoria), are the only members of the Chloridoideae that have been identified to be NADP-ME (nicotinamide adenine dinucleotide phosphate cofactor malic enzyme) (Keeley, 1998). The NADP-ME is the primary 596 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 decarboxylating enzyme in the Panicoideae and is found in over 90% of the species in this subfamily (Taub, 2000). 5. Conclusion In this study we have performed a multi-gene phylogenetic analysis of the Chloridoideae with the largest sample size published to date at the species, generic, subtribal, and tribal levels. We have produced a robust classification of the tribes (Triraphideae, Eragrostideae, Zoysieae, and Cynodonteae) and subtribes (Cotteinae, Uniolinae and Eragrostidinae in the Eragrostideae; Zoysiinae and Sporobolinae in the Zoysieae; Aeluropodinae, Triodiinae, Orcuttiinae, Tridentinae, Eleusininae, Tripogoninae, Pappophorinae, Traginae, Hilariinae, Monanthochloinae, Boutelouinae, Scleropogoninae, and Muhlenbergiinae in the Cynodonteae) based on our phylogenetic inferences from six plastid and one nuclear DNA sequences (see Fig. 3, Table 3). We have moderate to strong support for all clades representing the tribes and subtribes (except subtribe Eleusininae where we have only posterior probability support, PP = 1.00) and all were resolved as monophyletic. The Chloridoideae might have originated in Africa and/or Asia since the basal lineage, the tribe Triraphideae, includes species with African and Asian distribution. In our study we have 20 incertae sedis genera (not placed within a subtribe) primarily within the Cynodonteae (19) and a single genus (Urochondra) in the Zoysieae. Based on our phylogenetic treatment the following 15 genera are polyphyletic: Astrebla, Brachyachne, Chloris, Cynodon, Distichlis (ITS tree only), Enteropogon, Eragrostis, Eustachys, Leptochloa, Muhlenbergia, Perotis, Sporobolus, Tetrapogon, Tragus, and Tripogon; and the following 22 genera with two or more species were always portrayed as monophyletic: Aeluropus, Blepharidachne, Bouteloua, Cleistogenes, Ctenium, Dactyloctenium, Dignathia, Erioneuron, Lepturus, Melanocenchris, Microchloa, Mosdenia, Munroa, Orcuttia, Orinus, Trichloris, Trichoneura, Trioidia, Triraphis, Tuctoria, Uniola, and Zoysia. Other genera depicted as monophyletic but found embedded within other genera were: Aegopogon, Blepharoneuron, Chaboissaea, Lycurus (all in Muhlenbergia), Ectrosia (in Eragrostis), and Eragrostiella (in Tripogon). Even though we have tried to sample as many chloridoid genera as possible (95) there are still approximately 46 (of these 30 are monotypic and 11 are ditypic) remaining that we have not yet included in our study. The majority of these unsampled genera are primarily distributed in Africa and we hope to gather these in the future. Acknowledgments We thank the National Geographic Society Committee for Research and Exploration(Grant No. 8087-06) for field and laboratory support; the Smithsonian Institution’s, Restricted Endowments Fund, the Scholarly Studies Program, Research Opportunities, Atherton Seidell Foundation, Biodiversity Surveys and Inventories Program, Small Grants Program, and the Laboratory of Analytical Biology, all for financial support. We would also like to acknowledge Lee Weigt, Jeffery Hunt, and David Erickson for help in the laboratory; Robert J. Soreng, Jeffery M. Saarela, Carol R. Annable, and Nancy F. Refulio Rodriguez for accompanying the first author on numerous field expeditions; Robert J. Soreng for many extended discussions pertinent to the manuscript; and Robert J. Soreng and an anonymous reviewer for providing helpful comments on the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2010.01.018. References Barker, N.P., Linder, H.P., Harley, E.H., 1999. Sequences of the grass-specific insert in the chloroplast rpoC2 gene elucidate generic relationships of the Arundinoideae (Poaceae). Syst. Bot. 23, 327–350. Barker, N.P., Morton, C.M., Linder, H.P., 2000. The Danthonieae: generic composition and relationships. In: Jacobs, S.W.L., Everett, J. (Eds.), Grasses: Systematics and Evolution. CSIRO Publishing, Melbourne, Australia, pp. 221–230. Beilschmied, C.T., 1833. Flora 16(52), 105. Bell, H.L., 2007. Phylogenetic relationships with Chloridoideae (Poaceae) with emphasis on subtribe Monanthochloinae. PhD dissertation. Claremont Graduate School. Claremont, California. Bell, H.L., Columbus, J.T., 2008a. Phylogenetic relationships within Chloridoideae (Poaceae) based on ITS, trnL-F, and ndhF. In: Fifth International Symposium: Grass Systematics and Evolution. Copenhagen, Denmark (abstracts 9). Bell, H.L., Columbus, J.T., 2008b. Proposal for an expanded Distichlis (Poaceae, Chloridoideae): support from molecular, morphological, and anatomical characters. Syst. Bot. 33, 536–551. Bor, N.L., 1960. The grasses of Burma, Ceylon, India, and Pakistan (excluding Bambuseae). Pergamon Press, Oxford. Bouchenak-Khelladi, Y., Salamin, N., Savolainen, V., Forest, F., Van de Bank, M., Chase, M.W., Hodkinson, T.R., 2008. Large multi-gene phylogenetic trees of the grasses (Poaceae): progress towards complete tribal and generic level sampling. Mol. Phylogenet. Evol. 47, 488–505. Bouchenak-Khelladi, Y., Verboom, G.A., Hodkinson, T.R., Salamin, N., Francois, O., Chonghaile, G.N., Savolainen, V., 2009. The origins and diversification of C4 grasses and savanna-adapted ungulates. Global Change Biol. 15, 2397–2417. Brown, W.V., 1977. The Kranz syndrome and its subtypes in grass systematics. Mem. Torrey Bot. Club 23, 1–97. Chen, S.L., Phillips, S.M., 2006a. 126. Cleistogenes Keng, Sinensia 5: 147. 1934. In: Wu, Z.Y., Raven, P.H., Hong, D.Y. (Eds.), Flora of China: Poaceae, vol. 22. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, pp. 460–464. Chen, S.L., Phillips, S.M., 2006b. 127. Orinus Hitchcock, J. Wash. Acad. Sci. 23: 136. 1933. In: Wu, Z.Y., Raven, P.H., Hong, D.Y. (Eds.), Flora of China: Poaceae, vol. 22. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, pp. 464–465. Chen, S.L., Phillips, S.M., 2006c. 125. Neyraudia J.D. Hooker, Fl. Brit. India 7: 305. 1896 [‘‘1897’’]. In: Wu, Z.Y., Raven, P.H., Hong, D.Y. (Eds.), Flora of China: Poaceae, vol. 22. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, pp. 459–460. Chen, S.L., Phillips, S.M., 2006d. 124. Aeluropus Trinius, Fund. Agrost. 143. 1820. In: Wu, Z.Y., Raven, P.H., Hong, D.Y. (Eds.), Flora of China: Poaceae, vol. 22. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, pp. 458–459. Clayton, W.D., 1982. Notes on subfamily Chloridoideae (Gramineae). Kew Bull. 37, 417–420. Clayton, W.D., Harman, K.T., Williamson, H., 2008. GrassBase – The Online World Grass Flora. Available from: <http://www.kew.org/data/grasses-db.html> (accessed June 2009). Clayton, W.D., Renvoize, S.A., 1986. Genera graminum: grasses of the World. Kew Bull. Addit. Ser. 13, 1–389. Columbus, J.T., 1999. An expanded circumscription of Bouteloua (Gramineae: Chloridoideae): new combinations and names. Aliso 18, 61–65. Columbus, J.T., Cerros-Tlatilpa, R., Kinney, M.S., Siqueiros-Delgado, M.E., Bell, H.L., Griffith, M.P., Refulio-Rodriguez, N.F., 2007. Phylogenetics of Chloridoideae (Gramineae): a preliminary study based on nuclear ribosomal internal transcribed spacer and chloroplast trnL-F sequences. Aliso 23, 565–579. Columbus, J.T., Kinney, M.S., Pant, R., Siqueiros-Delgado, M.E., 1998. Cladistic parsimony analysis of internal transcribed spacer region (nrDNA) sequences of Bouteloua and relatives (Gramineae: Chloridoideae). Aliso 17, 99–130. Columbus, J.T., Kinney, M.S., Siqueiros-Delgado, M.E., Porter, J.M., 2000. Phylogenetics of Bouteloua and relatives (Gramineae: Chloridoideae): cladistic parsimony analysis of internal transcribed spacer (nrDNA) and trnL-F (cpDNA) sequences. In: Jacobs, S.W.L., Everett, J. (Eds.), Grasses: Systematics and Evolution. CSIRO Publishing, Melbourne, Australia, pp. 189–194. Columbus, J.T., Peterson, P.M., Refulio Rodríguez, N.F., Cerros Tlatilpa, R., Kinney, M.S., in press. Phylogenetics of Muhlenbergiinae (Poaceae, Chloridoideae, Cynodonteae) based on ITS and trnL-F DNA sequences. In: Seberg, O., Petersen, G., Barfod, A.S., and Davis, J.I. (Eds.), Diversity, Phylogeny, and Evolution in the Monocotyledons – Proceedings of the Fourth International Conference on the Comparative Biology of the Monocotyledons and the Fifth International Symposium on Grass Systematics and Evolution. Aarhus University Press, Aarhus. Crampton, B., 1959. The grass genera Orcuttia and Neostapfia: a study of habit and morphological specialization. Madroño 15, 97–128. Christin, P.A., Besnard, G., Samaritani, E., Duvall, M.R., Hodkinson, T.R., Savolainen, V., Salamin, N., 2008. Oligocene CO2 decline promoted C4 photosynthesis in grasses. Curr. Biol. 18, 37–43. Christin, P.A., Petitpierre, B., Salamin, N., Büchi, L., Besnard, G., 2009. Evolution of C4 phosphoenolpyruvate carboxykinase in grasses, from genotype to phenotype. Mol. Biol. Evol. 26, 357–365. Davis, J.I., Soreng, R.J., 2007. A preliminary analysis of the grass subfamily Pooideae (Poaceae), with attention to structural features of the plastid and nuclear genomes, including an intron loss in GBSSI. Aliso 23, 335–348. Duvall, M.R., Peterson, P.M., Christensen, A.H., 1994. Alliances of Muhlenbergia within the New World Eragrostideae are identified by phylogenetic analysis of mapped restriction sites from plastid DNA’s. Amer. J. Bot. 81, 622–629. P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Ellis, R.P., 1984. Eragrostis walteri — a first record of non-Kranz leaf anatomy in the sub-family Chloridoideae (Poaceae). S. African J. Bot. 3, 380–386. Ellis, R.P., Vogel, J.C., Fuls, A., 1980. Photosynthetic pathways and the geographical distribution of grasses in south west Africa/Namibia. S. African J. Sci. 76, 307– 314. Filgueiras, T.S., Zuloaga, F.O., 1999. A new Triraphis (Poaceae: Eragrostoideae) from Brazil: first record of a native species in the New World. Novon 9, 36–41. Giussani, L.M., Cota-Sánchez, J.H., Zuloaga, F.O., Kellogg, E.A., 2001. A molecular phylogeny of the grass subfamily Panicoideae (Poaceae) shows multiple origins of C4 photosynthesis. Amer. J. Bot. 88, 1993–2012. Grass Phylogeny Working Group (GPWG), 2001. Phylogeny and subfamilial classification of the grasses (Poaceae). Ann. Missouri Bot. Gard. 88, 373–457. Gutierrez, M., Gracen, V.E., Edwards, G.E., 1974. Biochemical and cytological relationships in C4 plants. Planta 119, 279–300. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95– 98. Hartley, W., Slater, C., 1960. Studies on the origin, evolution, and distribution of the Gramineae. III. The tribes of the subfamily Eragrostoideae. Austral. J. Bot. 8, 256–276. Hattersley, P.W., 1992. C4 photosynthetic pathway variation in grasses (Poaceae): its significance for arid and semi-arid lands. In: Chapman, G.P. (Ed.), Desertified Grasslands: Their Biology and Management. Academic Press, London, UK, pp. 181–212. Hattersley, P.W., Watson, L., 1992. Diversification of photosynthesis. In: Chapman, G.P. (Ed.), Grass Evolution and Domestication. Cambridge University Press, Cambridge, UK, pp. 38–116. Hilu, K.W., Alice, L.A., 1999. Evolutionary implications of matK indels in Poaceae. Amer. J. Bot. 86, 1735–1741. Hilu, K.W., Alice, L.A., 2001. A phylogeny of Chloridoideae (Poaceae) based on matK sequences. Syst. Bot. 26, 386–405. Hilu, K.W., Alice, L.A., Liang, H., 1999. Phylogeny of Poaceae inferred from matK sequences. Ann. Missouri Bot. Gard. 86, 835–851. Hilu, K.W., Wright, K., 1982. Systematics of Gramineae: a cluster analysis study. Taxon 31, 9–36. Hsiao, C., Jacobs, S.W.L., Chatterton, N.J., Asay, K.H., 1999. A molecular phylogeny of the grass family (Poaceae) based on sequences of nuclear ribosomal DNA (ITS). Austral. Syst. Bot. 11, 667–688. Huelsenbeck, J.P., Ronquist, F.R., 2001. MrBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Ingram, A.L., Doyle, J.J., 2003. The origin and evolution of Eragrostis tef (Poaceae) and related polyploids: evidence from nuclear waxy and plastid rps16. Amer. J. Bot. 90, 116–122. Ingram, A.L., Doyle, J.J., 2004. Is Eragrostis (Poaceae) monophyletic? Insights from nuclear and plastid sequence data. Syst. Bot. 29, 545–552. Ingram, A.L., Doyle, J.J., 2007. Eragrostis (Poaceae): monophyly and infrageneric classification. Aliso 23, 595–604. Jian, S., Soltis, P.S., Gitzendanner, M.A., Moore, M.J., Li, R., Hendry, T.A., Qiu, Y.L., Dhingra, A., Bell, C.D., Soltis, D.E., 2008. Resolving an ancient, rapid radiation in Saxifragales. Syst. Biol. 57, 38–57. Johnson, L.A., Soltis, D.E., 1995. Phylogenetic inference in Saxifragaceae sensu strict and Gilia (Polemoniaceae) using matK sequences. Ann. Missouri Bot. Gard. 82, 149–175. Keeley, J.E., 1998. C4 photosynthesis modification in the evolutionary transition from land to water in aquatic grasses. Oecologia 116, 85–97. Kellogg, E.A., 1999. Phylogenetic aspects of the evolution of C4 photosynthesis. In: Sage, R.F., Monson, R.K. (Eds.), C4 Plant Biology. Academic Press, San Diego, California, pp. 411–444. Kunth, C.S., 1815. Considérations générales sur les graminées. Mém. Mus. Hist. Nat. 2, 62–75. Kunth, C.S., 1833. Agrostographia Synoptica, Suppl. to vol. 1. Enum. Pl., 1–436, t. 1 40. Lazarides, M., 1997. A revision of Eragrostis (Eragrostideae, Eleusininae, Poaceae) in Australia. Austral. Syst. Bot. 10, 77–187. Lazarides, M., Weiller, C.C., McCusker, A., 2005. Triodia. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 203–256. Nightingale, M.E., Lazarides, M., Weiller, C.M., 2005. Symplectrodia. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 256–259. Nightingale, M.E., Weiller, C.M., 2005a. Ectrosia. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 426–439. Nightingale, M.E., Weiller, C.M., 2005b. Triraphis. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 424–426. Nightingale, M.E., Weiller, C.M., 2005c. Monodia. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, p. 459. Nightingale, M.E., Weiller, C.M., 2005d. Tragus. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 268–269. Nylander, J.A., 2002. MrModeltest v.1.1b. Program distributed by the author. Department of Systematic Zoology, Uppsala University, Uppsala, Sweden. Ortiz-Diaz, J.J., Culham, A., 2000. Phylogenetic relationships of the genus Sporobolus (Poaceae: Eragrostideae) based on nuclear ribosomal DNA ITS sequences. In: Jacobs, S.W.L., Everett, J. (Eds.), Grasses: Systematics and Evolution. CSIRO Publishing, Melbourne, Australia, pp. 184–188. Peterson, P.M., 2000. Systematics of the Muhlenbergiinae (Chloridoideae: Eragrostideae). In: Jacobs, S.W.L., Everett, J. (Eds.), Grasses: Systematics and Evolution. CSIRO Publishing, Melbourne, Australia, pp. 195–212. 597 Peterson, P.M., Columbus, J.T., 1997. Allelic variation in the amphitropical disjunct Scleropogon brevifolius (Poaceae: Eragrostideae). BioLlania, Ed. Espec. 6, 473–490. Peterson, P.M., Columbus, J.T., Pennington, S.J., 2007. Classification and biogeography of New World grasses: Chloridoideae. Aliso 23, 580–594. Peterson, P.M., Herrera Arrieta, Y., 1995. Allozyme variation in the amphitropical disjunct Chaboissaea (Poaceae: Eragrostideae). Madroño 42, 427–449. Peterson, P.M., Herrera Arrieta, Y., 2001. A leaf blade anatomical survey of Muhlenbergia (Poaceae: Muhlenbergiinae). Sida 19, 469–506. Peterson, P.M., Morrone, O., 1998. Allelic variation in the amphitropical disjunct Lycurus setosus (Poaceae: Muhlenbergiinae). Madroño 44, 334–346. Peterson, P.M., Ortiz-Diaz, J.J., 1998. Allelic variation in the amphitropical disjunct Muhlenbergia torreyi (Poaceae: Muhlenbergiinae). Brittonia 50, 381–391. Peterson, P.M., Romaschenko, K., Johnson, G., in review. A phylogeny and classification of the Muhlenbergiinae (Poaceae: Chloridoideae: Cynodonteae) based on plastid and nuclear DNA sequences. Amer. J. Bot. Peterson, P.M., Soreng, R.J., Davidse, G., Filgueiras, T.S., Zuloaga, F.O., Judziewicz, E.J., 2001. Catalogue of New World grasses (Poaceae): II. Subfamily Chloridoideae. Contr. U.S. Natl. Herb. 41, 1–255. Peterson, P.M., Webster, R.D., Valdés-Reyna, J., 1995. Subtribal classification of the New World Eragrostideae (Poaceae: Chloridoideae). Sida 16, 529–544. Phillips, S.M., 1974. 60. Dactyloctenium. In: Polhill, R.M. (Ed.), Flora of Tropical East Africa, Gramineae (Part 2). Whitefrias Press Ltd., London, pp. 250–258. Reeder, J.R., 1965. The tribe Orcuttieae and the subtribes of the Pappophoreae (Gramineae). Madroño 18, 18–28. Roalson, E.H., Columbus, J.T., 1999. Glume absence in the Orcuttieae (Gramineae: Chloridoideae) and a hypothesis of intratribal relationships. Aliso 18, 67–70. Romaschenko, K., Peterson, P.M., Soreng, R.J., Gracia-Jacas, N., Susanna, A., in press. Phylogenetics of Stipeae (Poaceae, Pooideae) based on plastid and nuclear DNA sequences. In: Seberg, O., Petersen, G., Barfod, A.S., and Davis, J.I. (Eds.), Diversity, Phylogeny, and Evolution in the Monocotyledons – Proceedings of the Fourth International Conference on the Comparative Biology of the Monocotyledons and the Fifth International Symposium on Grass Systematics and Evolution. Aarhus University Press, Aarhus. Ronquist, F., Huelsenbeck, J.P., Van der Mark, P., 2005. MrBayes 3.1 manual, draft 5/ 26/2005. Available from: <http://mrbayes.csit.fsu.edu/mb3.1_manual.pdf>. Roodt, R., Spies, J.J., 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An analysis of polyploidy. Taxon 52, 736–746. Roodt-Wilding, R., Spies, J.J., 2006. Phylogenetic relationships in southern African chloridoid grasses (Poaceae) based on nuclear and chloroplast sequence data. Syst. Biodivers. 4, 401–415. Sage, R.F., Li, M., Monson, R.K., 1999. The taxonomic distribution of C4 photosynthesis. In: Sage, R.F., Monson, R.K. (Eds.), C4 Plant Biology. Academic Press, San Diego, California, pp. 551–584. Schneider, E.D., Hilu, K.W., Röser, M., 2009. Phylogenetic structure of the grass family Pooideae based on comparison of plastid matK gene-30 trnK exon and nuclear ITS sequences. Taxon 58, 405–424. Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E., Small, R.L., 2005. tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Amer. J. Bot. 92, 142–166. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in Angiosperms: the tortoise and the hare III. Amer. J. Bot. 94, 275–288. Simon, B.K., 2005. Sporobolus. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 324–346. Simon, B.K., Clayton, W.D., Harman, K.T., Healy, D., Alfonso, Y., 2009. GrassWorld. Availabel from: <http://grassworld.myspecies.info/> (accessed December 2009). Small, R.L., Ryburn, J.A., Cronn, R.C., Seelanan, T., Wendel, J.A., 1998. The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plant group. Amer. J. Bot. 85, 1301–1315. Soreng, R. J., Davidse, G., Peterson, P.M., Zuloaga, F.O., Judziewicz, E.J., Filgueiras, T.S., Morrone, O., 2009. Classification of New World Grasses. Available from: <http:// www.tropicos.org/projectwebportal.aspx?pagename=ClassificationNWG& projectid=10> (accessed September 2009). Soreng, R.J., Davis, J.I., 1998. Phylogenetics and character evolution in the grass family (Poaceae): simultaneous analysis of morphological and chloroplast DNA restriction site character sets. Bot. Rev. 64, 1–85. Soreng, R.J., Davis, J.I., Voionmaa, M.A., 2007. A phylogenetic analysis of Poaceae tribe Poeae sensu lato based on morphological characters and sequence data from three plastid-encoded genes: evidence for reticulation, and a new classification for the tribe. Kew Bull. 62, 425–454. Stanford, A.M., Harden, R., Parks, C.R., 2000. Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. Amer. J. Bot. 87, 872–882. Swofford, D.L., 2000. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4. Sinauer Associates Inc., Sunderland, Massachusetts. Sykes, G.R., Christensen, A.H., Peterson, P.M., 1997. A chloroplast DNA analysis of Chaboissaea (Poaceae: Eragrostideae). Syst. Bot. 22, 291–302. Taub, D.R., 2000. Climate and the U.S. distribution of C4 grass subfamilies and decarboxylation variants of C4 photosynthesis. Amer. J. Bot. 87, 1211–1215. Van den Borre, A., Watson, L., 1997. On the classification of the Chloridoideae (Poaceae). Austral. Syst. Bot. 10, 491–531. Vicentini, A., Barber, J.C., Aliscioni, S.S., Giussani, L.M., Kellogg, E.A., 2008. The age of the grasses and clusters of origins of C4 photosynthesis. Global Change Biol. 14, 2963–2977. 598 P.M. Peterson et al. / Molecular Phylogenetics and Evolution 55 (2010) 580–598 Watson, L., Dallwitz, M.J., 1992a. The Grass Genera of the World. CAB International, Wallingford, UK. Watson, L., Dallwitz, M.J., 1992b. Grass genera of the world: descriptions, illustrations, identification, and information retrieval; including synonyms, morphology, anatomy, physiology, phytochemistry, cytology, classification, pathogens, world and local distribution, and references. Available from: <http://delta-intkey.com/grass> (accessed July 2009). Weiller, C.M., Lazarides, M., 2005. Enneapogon. In: Mallett, K. (Ed.), Flora of Australia, vol. 44B. CSIRO Publishing, Melbourne, Australia, pp. 188–202. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J., White, T. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, California, pp. 315–322. Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD dissertation. University of Texas. Austin, Texas. Appendix A. Specimens sampled, localities, vouchers, and GenBank accession numbers for DNA sequences. All accessions are newly submitted sequences to GenBank and all vouchers are deposited in the United States National Herbarium (US). Predominant native distribution indicated by taxon colour: American−red, African−green, Asian−blue, and Australian−purple. ITS ndhA intron ndhF rpl32trnL rps3 rps16 intron rps16trnK Taxon Locality Voucher Acrachne racemosa (B. Heyne ex Roem. & Schult.) Ohwi Aegopogon cenchroides Humb. & Bonpl. ex Willd. Aegopogon tenellus (DC.) Trin. Aeluropus lagopoides (L.) Trin. ex Thwaites Aeluropus littoralis (Gouan) Parl. South Africa Mexico Mexico Iraq Greece Aeluropus pungens (M. Bieb.) K. Koch China Smook 9899 Peterson 22045 & Saarela Peterson 22044 & Saarela Weinert s.n. & Mosawi Ferguson 634 Yunatov s.n., Li Shyin & Yuan Yfen Allolepis texana (Vasey) Soderstr. & H.F. Decker ♀ Mexico Hitchcock 7541 GU359264 GU359388 GU359577 GU360015 GU360088 GU360318 GU360573 Allolepis texana (Vasey) Soderstr. & H.F. Decker ♂ Apochiton burttii C.E. Hubb. Mexico Tanzania Le Roy 1412 & Harvey Greenway 11513 & Polhill GU359265 GU359387 GU359588 GU360016 GU360089 GU360306 GU360572 Aristida gypsophila Beetle Mexico GU359267 GU359386 GU359977 GU360091 GU360286 GU360570 Aristida scribneriana Hitchc. Astrebla elymoides F. Muell. ex F.M. Bailey Astrebla lappacea (Lindl.) Domin Astrebla pectinata (Lindl.) F. Muell. ex Benth. Astrebla squarrosa C.E. Hubb. Austrochloris dichanthioides (Everist) Lazarides Mexico Australia Australia Australia Australia Australia Peterson 15839 & Valdes-Reyna Peterson 15985 & GonzalezElizondo Hubbard 7976 McKinlay s.n. Chalmers 5 Hubbarrd 7940 Anson s.n. GU359268 GU359412 GU360010 GU360092 GU360314 GU360569 Bealia mexicana Scribn. Mexico GU359258 GU359859 GU360098 GU360309 GU360550 Bewsia biflora (Hack.) Gooss. Blepharidachne benthamiana (Hack.) Hitchc. Blepharidachne bigelovii (S. Watson) Hack. Blepharidachne kingii (S. Watson) Hack. Blepharoneuron shepherdii (Vasey) P.M. Peterson & Annable Blepharoneuron tricholepis (Torr.) Nash Bouteloua aristidoides (Kunth) Griseb. Bouteloua barbata Lag. Bouteloua curtipendula (Michx.) Torr. Africa Argentina Mexico USA Peterson 7946, Annable & Herrera Davidse 6471, Simon, Drummond & Bennett Melix 570 & Cherobini Johanston 9401 Reeder 7347 & Reeder GU359274 GU359583 GU359858 GU360084 GU360294 GU360564 GU359275 GU359582 GU359857 GU360100 GU359277 GU359419 GU359580 GU359854 GU360102 GU360320 GU360560 Bouteloua dactyloides (Nutt.) Columbus Bouteloua dimorpha Columbus Mexico Mexico Peterson 22452 & Saarela Peterson 22099 & Saarela Peterson 21994 & Saarela Peterson 22002 & Saarela Peterson 22005 & Saarela Peterson 21441, Saarela & Stančik Peterson 22281 & Saarela Mexico Mexico Mexico Mexico Mexico GU360099 GU359259 GU359403 GU359613 GU360011 GU360143 GU360274 GU360578 GU359260 GU359392 GU359592 GU360012 GU360128 GU360278 GU360577 GU359261 GU359391 GU359591 GU360013 GU360085 GU360284 GU360576 GU359262 GU359390 GU359590 GU360018 GU360086 GU360308 GU360575 GU359263 GU359389 GU359589 GU360014 GU360087 GU360319 GU360574 GU359266 GU359594 GU360090 GU360316 GU360571 GU359269 GU359414 GU359587 GU360093 GU360313 GU359270 GU359395 GU359586 GU360009 GU360094 GU360312 GU360568 GU359286 GU359421 GU359585 GU359861 GU360095 GU360311 GU360567 GU360096 GU359272 GU359420 GU359584 GU359860 GU360113 GU360310 GU360566 GU360579 GU359581 GU359856 GU360101 GU360307 GU360562 GU359276 GU359855 GU360561 GU359278 GU359418 GU359576 GU359853 GU360103 GU360305 GU360559 GU359279 GU359417 GU359570 GU359852 GU360104 GU360304 GU360558 GU359280 GU359416 GU360105 GU360303 GU360557 GU359281 GU359415 GU360106 GU360556 GU359282 GU359404 GU359569 GU359851 GU360107 GU360302 GU360555 GU359283 GU359413 GU360108 GU360301 GU360554 Bouteloua diversispicula Columbus Bouteloua gracilis (Kunth) Lag. ex Griffiths Bouteloua hirsuta Lag. Bouteloua parryi (E. Fourn.) Griffiths Bouteloua reflexa Swallen Mexico Mexico Mexico Mexico Mexico GU359284 GU359423 GU360109 GU360553 GU359285 GU359411 GU360110 GU360552 GU359410 GU360111 GU360593 Mexico Australia Zambesia Kenya Peterson 22254 & Saarela Peterson 22015 & Saarela Peterson 22203 & Saarela Peterson 22252 & Saarela Peterson 22125 & Saarela Peterson 21232, Gonzalez Elizondo, Rosen & Reid Peterson 21289, Saarela & Flores Villegas Peterson 21423, Saarela & Stančik Adams 851 Robson 1122 Bogdan 7075 Bouteloua repens (Kunth) Scribn. Mexico Bouteloua simplex Lag. Mexico Bouteloua uniflora Vasey Brachyachne convergens (F. Muell.) Stapf Brachyachne fibrosa C.E. Hubb. Brachyachne patentiflora (Stent & Rattray) C.E. Hubb. Brachyachne patentiflora (Stent & Rattray) C.E. Hubb. Brachyachne tenella (R. Br.) C.E. Hubb. Zimbabwe Australia Laegaard 16295 Lazarides 4281 GU359254 GU359374 GU359708 GU359883 GU360119 GU360458 GU360584 Brachychloa schiemanniana (Schweick.) S.M.Phillips Calamovilfa longifolia (Hook.) Hack. ex Scribn. & Southw. Chaboissaea atacamensis (Parodi) P.M. Peterson & Annable Chaboissaea ligulata E. Fourn. Africa USA GU359256 GU359776 GU359881 GU360117 GU360582 GU359300 GU359357 GU359716 GU359880 GU360116 GU360441 GU360548 Chaboissaea subbiflora (Hitchc.) Reeder & C. Reeder Chasmanthium latifolium (Michx.) H.O. Yates Chasmanthium laxum (L.) H.O. Yates Chasmanthium sessiliflorum (Poir.) H.O. Yates Chloris barbata Sw. Chloris radiata (L.) Sw. Chloris submutica Kunth Chloris virgata Sw. Mexico USA USA USA Mexico Mexico Mexico Mexico Chloris virgata Sw. Chrysochloa hindsii C.E. Hubb. Peru Burundi Cleistogenes mucronata Keng ex P.C. Keng & L. Liu Cleistogenes squarrosa (Trinius) Keng Coelachyrum lagopoides (Burm. f.) Senaratna Coelachyrum poiflorum Chiov. China China India Ethiopia Cottea pappophoroides Kunth Craspedorhachis africana Benth. Crypsis aculeata (L.) Aiton Peru South Africa China Schweickerdt 1911 Hatch 5738 & Bearden Peterson 19626, Soreng, Salariato, & Panizza, Peterson 22416 & Saarela Peterson 21158, Saarela, Rosen & Reid Peterson 22463 Kanal 694 Peterson 20823 & Saarela Peterson 22255 & Saarela Peterson 22278 & Saarela Peterson 22393 & Saarela Peterson 22179 & Saarela Peterson 21468, Soreng, LaTorre & Rojas Fox Reekmans 11068 Soreng 5406, Peterson & Sun Hang Soreng 5156 & Peterson Saldanha 15334 Burger 2915 Peterson 21463, Soreng, LaTorre & Rojas Fox Zohy 504 & Schweikeidt Soreng 5469 & Peterson Argentina Mexico GU359244 GU359409 GU360112 GU360300 GU360563 GU359242 GU359408 GU360176 GU360299 GU360565 GU359271 GU359407 GU359568 GU359850 GU360131 GU360298 GU360608 GU359231 GU359406 GU359571 GU359834 GU360132 GU360297 GU360607 GU359232 GU359383 GU359567 GU359848 GU360133 GU360296 GU360606 GU359252 GU359349 GU359714 GU359885 GU360121 GU359253 GU359348 GU359233 GU359350 GU360586 GU359884 GU360120 GU360444 GU360585 GU359862 GU360134 GU360295 GU360605 GU359255 GU359376 GU359715 GU359882 GU360118 GU360442 GU360583 GU359344 GU359382 GU359729 GU359879 GU360115 GU360489 GU360595 GU359273 GU359381 GU359718 GU359863 GU360069 GU360440 GU360551 GU359318 GU359428 GU359707 GU359877 GU360036 GU360439 GU360518 GU359319 GU359379 GU359720 GU359891 GU360097 GU360438 GU360517 GU359405 GU359721 GU359875 GU360050 GU360437 GU360516 GU359378 GU359722 GU359874 GU360436 GU360515 GU359320 GU359377 GU359723 GU359873 GU360049 GU360435 GU360514 GU359321 GU359366 GU359724 GU359872 GU360048 GU360434 GU360513 GU359322 GU359375 GU359725 GU359871 GU360047 GU360471 GU360512 GU359323 GU359384 GU359726 GU359870 GU360046 GU360443 GU360511 GU359324 GU359373 GU359727 GU359869 GU360045 GU360445 GU360510 GU359325 GU359728 GU359868 GU360044 GU360485 GU360509 GU359234 GU359422 GU359696 GU359846 GU360144 GU360351 GU360604 GU359235 GU359393 GU359566 GU359845 GU360136 GU360473 GU360603 GU359364 GU359572 GU359844 GU359236 GU360602 GU359843 GU360129 GU360457 GU360601 GU359237 GU359363 GU359579 GU359842 GU360138 GU360456 GU360600 GU360139 GU359238 GU359362 GU359573 GU359841 GU360140 GU360402 GU360599 Crypsis schoenoides (L.) Lam. USA GU359239 GU359361 GU359574 GU359840 GU360141 GU360455 GU360598 USA Brazil Ceylon Mexico Peterson 19814, Saarela & Sears Peterson 14235, Weakley & LeBlond Grola 1452 & Filgueiras Clayton 5836 Peterson 22000 & Saarela Ctenium aromaticum (Walter) Alph. Wood Ctenium cirrhosum (Nees) Kunth Cynodon arcuatus J. Presl Cynodon dactylon (L.) Pers. Cynodon hirsutus Stent South Africa Smook 6616 GU359229 GU359358 GU359751 GU359876 GU360135 GU360452 GU360594 Cynodon incompletus Nees Cynodon incompletus Nees Cynodon maritimus Kunth Cynodon pascuus Nees Cynodon plectostachyus (K. Schum.) Pilg. Cynodon plectostachyus (K. Schum.) Pilg. Cynodon transvaalensis Burtt Davy Dactyloctenium aegyptium (L.) Willd. Dactyloctenium australe Steud. South Africa South Africa Bahamas Mexico Ruwanda Honduras South Africa Mexico South Africa GU359246 GU359849 GU359245 GU359347 GU359593 GU359847 Dactyloctenium bogdanii S.M. Phillips Dactyloctenium giganteum B.S. Fisher & Schweick. Danthonia compressa Austin Dasyochloa pulchella (Kunth) Willd. ex Rydb. Dignathia hirtella Stapf Dignathia villosa C.E. Hubb. Dinebra retroflexa (Vahl) Panz. Kenya Weissen Nossob USA Mexico Kenya Ethiopia Kenya Smook 2408 & Gussell Smook 10152 Howard 10214 & Howard Morgan 12518 Troupin 11610 Morazan 25803 Smook 6710 Peterson 22283 & Saarela Davidse 6945 Kabuye 714, Luke, Robertson, Mungai & Mathenge GU359328 Distichlis humilis Phil. Argentina Distichlis scoparia (Nees ex Kunth) Arechav. Argentina Distichlis spicata (L.) Greene Argentina Distichlis spicata (L.) Greene Ectrosia leporina R. Br. Ectrosia scabrida C.E. Hubb. Ectrosia schultzii Benth. Argentina Australia Australia Australia Eleusine indica (L.) Gaetrn. Enneapogon desvauxii P. Beauv. Enteropogon macrostachyus (Hochst. ex A.Rich.) Munro ex Benth. Mexico Mexico Seydel 2701 Peterson 21986 & Levine Peterson 21992 & Saarela Welski 5251 Ellis 204 Ndegwa 610 Peterson 19362, Soreng, Salariato & Panizza Peterson 17475, Soreng & Refulio-Rodriguez Peterson 17484, Soreng & Refulio-Rodriguez Peterson 19309, Soreng, Salariato & Panizza Lazarides 3928 Lazarides 4772 Latz 2237 Peterson 21362, Saarela & Flores Villegas Peterson 21999 & Saarela Zimbabwe Laegaard 15902 GU359340 GU359472 GU359700 GU359795 GU360029 GU360470 GU360494 GU359240 GU359575 GU359839 GU359241 GU359838 GU360142 GU360353 GU360597 GU359257 GU359360 GU359578 GU359837 GU360114 GU360454 GU360596 GU359243 GU359359 GU359603 GU359836 GU360137 GU360453 GU360580 GU360450 GU360451 GU360609 GU359248 GU359365 GU359710 GU359889 GU360126 GU360448 GU360591 GU359249 GU359354 GU359711 GU359888 GU360125 GU360447 GU360590 GU359247 GU359356 GU359709 GU359890 GU360127 GU360449 GU360592 GU359353 GU360124 GU360589 GU359250 GU359352 GU359712 GU359887 GU360123 GU360446 GU360588 GU359251 GU359351 GU359713 GU359886 GU360122 GU360432 GU360587 GU359326 GU359372 GU360043 GU360508 GU359327 GU359371 GU359717 GU359867 GU360042 GU360484 GU360507 GU359687 GU359866 GU360041 GU360491 GU359345 GU359370 GU359688 GU359865 GU360040 GU360483 GU360521 GU359330 GU359369 GU359689 GU359864 GU360039 GU360482 GU360505 GU359316 GU359368 GU359690 GU360023 GU360481 GU360490 GU359367 GU359691 GU359820 GU360037 GU360480 GU360519 GU359332 GU359355 GU359692 GU359778 GU360052 GU360479 GU360503 GU359333 GU359430 GU359693 GU359835 GU360035 GU360478 GU360502 GU359334 GU359480 GU359694 GU359803 GU360034 GU360477 GU360501 GU359335 GU359479 GU359706 GU359802 GU360033 GU360476 GU360500 GU359346 GU359478 GU359695 GU359801 GU360032 GU360475 GU360499 GU359336 GU359484 GU359685 GU359800 GU360474 GU360498 GU359317 GU359476 GU359697 GU359799 GU360459 GU360497 GU359337 GU359798 GU359338 GU359473 GU359698 GU359797 GU360031 GU360472 GU360496 GU359339 GU359474 GU359699 GU359796 GU360030 GU360486 GU360495 Enteropogon ramosus B.K. Simon Entoplocamia aristulata (Hack. & Rendle) Stapf Eragrostiella bifaria (Vahl) Bor Eragrostiella leioptera (Stapf) Bor Australia SW Africa Ceylon India Eragrostis barrelieri Daveau Mexico Eragrostis cilianensis (Bellardi) Vignolo ex Janch. Mexico Eragrostis curvula (Schrad.) Nees Peru Eragrostis desertorum Domin Australia Eragrostis dielsii Pilg. Australia Eragrostis eriopoda Benth. Eragrostis intermedia Hitchc. Australia Mexico Eragrostis kennedyae F.Turner Australia Eragrostis lanicaulis Lazarides Australia Eragrostis lugens Nees Peru Eragrostis lugens Nees Eragrostis lurida subsp. contracta (Pilg.) P.M. Peterson & Sánchez Vega Eragrostis lurida J. Presl lurida Mexico Eragrostis mexicana (Hornem.) Link Peru Eragrostis minor Host USA Eragrostis nigricans (Kunth) Steud. Peru Eragrostis parviflora (R.Br.) Trin. Australia Eragrostis pastoensis (Kunth) Trin. Peru Eragrostis pectinacea (Michx.) Nees Mexico Eragrostis pergracilis S.T.Blake Australia Peru Peru Peterson 14367, Soreng & Rosenberg Seydel 187 Clayton 5950 Chand 7961 Peterson 21429, Saarela & Flores Villegas Peterson 21286, Saarela & Flores Villegas Peterson 20542, Soreng & Romaschenko Peterson 14358, Soreng & Rosenberg Peterson 14399, Soreng & Rosenberg Peterson 14321, Soreng & Rosenberg Peterson 22302 & Saarela Peterson 14446, Soreng & Rosenberg Peterson 14288, Soreng, Rosenberg & Macfarlane Peterson 21601, Soreng, LaTorre & Rojas Fox Peterson 21428, Saarela & Stančik GU359341 GU359470 GU359701 GU359794 GU360028 GU360469 GU360493 GU359342 GU359469 GU359702 GU359793 GU360027 GU360468 GU360492 GU359828 GU359305 GU359486 GU359769 GU359827 GU360066 GU360529 GU359295 GU359496 GU359759 GU359781 GU360075 GU360401 GU360539 GU359296 GU359495 GU359760 GU359780 GU360068 GU360488 GU360538 GU359306 GU359497 GU359826 GU360392 GU359289 GU359471 GU359719 GU359787 GU360038 GU360462 GU360545 GU359297 GU359494 GU359761 GU359779 GU360077 GU360400 GU360537 GU359290 GU359485 GU359754 GU359786 GU360070 GU360461 GU360544 GU359298 GU359501 GU359762 GU359818 GU360078 GU360399 GU360536 GU359291 GU359500 GU359755 GU359785 GU360071 GU360460 GU360543 GU359292 GU359499 GU359756 GU359784 GU360072 GU360418 GU360542 GU359302 GU359467 GU359704 GU359791 GU360025 GU360466 GU360535 GU359343 GU359468 GU359703 GU359777 GU360026 GU360467 GU360533 Peterson 21797 & Soreng GU359293 GU359498 GU359757 GU359783 GU360073 GU360378 GU360541 Peterson 21798 & Soreng GU359294 GU359492 GU359758 GU359782 GU360083 GU360433 GU360540 Peterson 21155, Saarela, Rosen & Reid GU359307 GU359483 GU359770 GU359825 GU360377 GU360528 Peterson 19739, Saarela & Sears Peterson 21623, Soreng, LaTorre & Rojas Fox Peterson 14445, Soreng & Rosenberg Peterson 21690, Soreng, LaTorre & Rojas Fox Peterson 21431, Saarela & Stančik Peterson 14347, Soreng & Rosenberg GU359308 GU359475 GU359771 GU359824 GU360065 GU360390 GU360527 GU359299 GU359491 GU359775 GU359790 GU360079 GU360398 GU360520 GU359331 GU359466 GU359804 GU360024 GU360465 GU360506 GU359315 GU359490 GU359764 GU359792 GU360080 GU360397 GU360534 GU359301 GU359489 GU359753 GU359832 GU360081 GU360396 GU360549 GU359329 GU359465 GU359731 GU359789 GU360067 GU360464 GU360547 Eragrostis pilgeri subsp. ancashensis (P.M. Peterson, Refulio & Tovar) P.M. Peterson & Sánchez Vega Eragrostis reptans (Michx.) Nees Peru USA Eragrostis soratensis Jedwabn. Eragrostis tenuifolia (A. Rich.) Hochst. ex Steud. Eragrostis weberbaueri Pilg. Peru Mexico Peru Erioneuron avenaceum (Kunth) Tateoka Argentina Erioneuron nealleyi (Vasey) Tateoka Eustachys distichophylla (Lag.) Nees Eustachys paspaloides (Vahl) Lanza & Mattei Eustachys petraea (Sw.) Desv. Gouinia paraguayensis (Kuntze) Parodi Mexico Indonesia Kenya USA Argentina Gymnopogon grandiflorus Roseng., B.R. Arill. & Izag. Peru Harpachne harpachnoides (Hack.) B.S. Sun & S. Wang Hilaria cenchroides Kunth China Mexico Hilaria cenchroides Kunth Jouvea pilosa (J. Presl) Scribn. Leptochloa dubia (Kunth) Nees Leptochloa filiformis (Pers.) P. Beauv. Mexico Mexico Mexico Mexico Leptochloa uninervia (J. Presl) Hitchc. & Chase Leptochloa viscida (Scribn.) Beal Lepturidium insulare Hitchc. & Ekman Mexico Mexico Cuba Lepturus acutiglumis Steud. Whistler 5756 Lepturus repens R. Br. USA:Hawaii USA: Wake Is. Kenya Minni-Minni Diego Gracia Is. Lepturus schlechteri Pilg. Lintonia nutans Stapf Lopholepis ornithocephala (Hook.) Steud. Lycurus setosus (Nutt.) C. Reeder South Africa Tanzania Ceylon Mexico Schlechter s.n. Mwasumbi 14374 Clayton 5582 Peterson 22008 Lepturus gasparricensis Fosberg Lepturus radicans (Steud.) A. Camus Peterson 21809 & Soreng Peterson 9545 Peterson 16274, Cano, LaTorre, Ramire & Susanibar Peterson 22279 & Saarela Peterson 21807 & Soreng Peterson 19329, Soreng, Salariato & Panizza GU359288 GU359464 GU359686 GU359788 GU360082 GU360463 GU360546 Peterson 19964 & Lara Contreras Fowler s.n. Ndegway 741 Strong 3124 Peterson 11526 & Annable Peterson 16642 & RefulioRodriguez Soreng 5288, Peterson & Sun Hang Peterson 22339 & Saarela Peterson 21326, Saarela & Flores Villegas Peterson 11017 & Annable Peterson 22334 & Saarela Peterson 22185 & Saarela Peterson 21305, Saarela & Flores Villegas Peterson 22184 & Saarela Ekman 12060 GU359311 GU359309 GU359432 GU359772 GU359823 GU360064 GU360526 GU359287 GU359488 GU359766 GU359831 GU360053 GU360395 GU360532 GU359303 GU359487 GU359767 GU359830 GU360076 GU360394 GU360531 GU359304 GU359482 GU359768 GU359829 GU360074 GU360393 GU360530 GU359310 GU359441 GU359773 GU359822 GU360063 GU360403 GU360525 GU359774 GU359821 GU360062 GU360388 GU360524 GU359440 GU359742 GU359805 GU360061 GU360387 GU360523 GU359312 GU359439 GU359740 GU359819 GU360060 GU360386 GU360522 GU359313 GU359438 GU359763 GU359833 GU360059 GU360385 GU360637 GU359314 GU359437 GU359732 GU359817 GU360058 GU360384 GU360504 GU359200 GU359436 GU359733 GU359816 GU360057 GU360383 GU360581 GU359113 GU359435 GU359734 GU359815 GU360382 GU360611 GU359143 GU359424 GU359736 GU359813 GU360055 GU360380 GU360697 GU359230 GU359735 GU359814 GU360056 GU360381 GU360698 GU359144 GU359433 GU359737 GU359812 GU360173 GU360379 GU360696 GU359145 GU359442 GU359738 GU359811 GU360051 GU360416 GU360695 GU359146 GU359431 GU359810 GU360130 GU360389 GU359147 GU359461 GU359739 GU359809 GU360234 GU360391 GU360694 GU359148 GU359429 GU359752 GU359808 GU360233 GU360430 GU360693 GU360232 GU360231 Herbst 9687 Gilleopie 38 GU359149 GU359477 GU359741 GU359807 GU360230 GU360429 GU360692 Whistler 9853 GU359150 GU359427 GU359730 GU359893 GU360228 GU360428 GU360691 GU359806 GU360229 GU360227 GU359151 GU359426 GU359743 GU359980 GU360226 GU360427 GU360690 GU359878 GU360225 GU360689 GU359153 GU359451 GU359745 GU359975 GU360223 GU360425 GU360687 Lycurus setosus (Nutt.) C. Reeder Melanocenchris monoica (Rottler) C.E.C. Fisch. Melanocenchris royleana Hook. f. Mexico Ceylon India Peterson 20960, Saarela, Lara Contreras & Reyna Alvarez Clayton 5634 Wisner 24 Microchloa caffra Nees Microchloa kunthii Desv. Monanthochloe littoralis Engelm. South Africa Mexico Mexico Smook 10441 Peterson 22152 & Saarela Moran 10570 GU359155 GU359453 GU359746 GU359972 GU360206 GU360424 GU360670 Monelytrum luederitzianum Hack. South Africa Smook 10031 GU359158 GU359459 GU359749 GU359969 GU360218 GU360421 GU360682 Mosdenia leptostachys (Ficalho & Hiern) Clayton South Africa Smook 1145 Mosdenia phleoides (Hack.) Stent Muhlenbergia appressa C.O. Goodd. Muhlenbergia arenacea (Buckley) Hitchc. South Africa USA Mexico Schweickerdt 1542 Peterson 4183 & Annable Peterson 10624 & Annable GU359159 GU359458 GU359750 GU359967 GU360216 GU360420 GU360681 Muhlenbergia arenicola Buckley Muhlenbergia brandegeei C. Reeder Muhlenbergia emersleyi Vasey Muhlenbergia flaviseta Scribn. Muhlenbergia gigantea (E. Fourn.) Hitchc. Muhlenbergia macroura (Kunth) Hitchc. Muhlenbergia montana (Nutt.) Hitchc. Muhlenbergia peruviana (P. Beauv.) Steud. Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico GU359166 GU359462 GU359620 GU359960 GU360209 GU360413 GU360674 Muhlenbergia racemosa (Michx.) Britton Muhlenbergia ramulosa (Kunth) Swallen USA Mexico Peterson 19947 & LaraContreras Peterson 4760 & Annable Peterson 22096 & Saarela Peterson 22409 & Saarela Peterson 22260 & Saarela Peterson 22062 & Saarela Peterson 22234 & Saarela Peterson 22440 & Saarela Peterson 20924, Saarela & Howard Peterson 22447 & Saarela Muhlenbergia richardsonis (Trin.) Rydb. Muhlenbergia rigens (Benth.) Hitchc. USA Mexico GU359163 GU359454 GU359617 GU359978 GU360212 GU360431 GU360677 Muhlenbergia rigida (Kunth) Kunth Peru Muhlenbergia schreberi J.F. Gmel. Argentina Muhlenbergia torreyi (Kunth) Hitchc. ex Bush Muhlenbergia uniflora (Muhl.) Fernald Argentina USA Munroa andina Phil. var. andina Argentina Munroa argentina Griseb. Neesiochloa barbata (Nees) Pilg. Neobouteloua lophostachya (Griseb.) Gould Chile Brazil Argentina Peterson 19817, Saarela & Sears Peterson 22129 & Saarela Peterson 21637, Soreng, LaTorre & Rojas Fox Peterson 19443, Soreng, Salariato & Panizza Peterson 19429, Soreng, Salariato & Panizza Peterson 20862 & Saarela Peterson 19552, Soreng, Salariato & Panizza Peterson 15505, Soreng & Judziewicz Swallen 4491 Peterson 11515 & Annable GU359152 GU359425 GU359744 GU359976 GU360224 GU360426 GU360688 GU359974 GU359169 GU360686 GU359973 GU360222 GU359141 GU359434 GU359747 GU359971 GU360220 GU360423 GU360684 GU359157 GU359460 GU359748 GU359970 GU360235 GU360422 GU360699 GU359968 GU360217 GU359164 GU359443 GU359618 GU359962 GU360211 GU360415 GU360676 GU359165 GU359452 GU359619 GU359961 GU360210 GU360414 GU360675 GU359167 GU359450 GU359621 GU359959 GU360208 GU360412 GU360711 GU359168 GU359449 GU359622 GU359958 GU360207 GU360411 GU360672 GU359127 GU359448 GU359623 GU359957 GU360250 GU360410 GU360685 GU359160 GU359457 GU359663 GU359966 GU360215 GU360419 GU360680 GU359125 GU359447 GU359624 GU359956 GU360265 GU360409 GU360683 GU359162 GU359455 GU359705 GU359964 GU360213 GU360417 GU360678 GU359154 GU359446 GU359625 GU359955 GU360221 GU360408 GU360713 GU359114 GU359445 GU359638 GU359954 GU360253 GU360407 GU360716 GU359115 GU359444 GU359627 GU359953 GU360254 GU360406 GU360717 GU359117 GU359481 GU359629 GU359951 GU360256 GU360357 GU360729 GU359116 GU359380 GU359616 GU359952 GU360255 GU360405 GU360718 GU359161 GU359456 GU359765 GU359950 GU360214 GU360404 GU360679 GU359118 GU359630 GU359992 GU360266 GU360267 GU360720 GU359119 GU359463 GU359631 GU359994 GU360258 GU360275 GU360715 GU359120 GU359394 GU359632 GU359965 GU360251 GU360722 GU359121 GU359385 GU359633 GU360006 GU360260 GU360723 GU359122 GU359634 GU360005 GU360261 GU360279 GU360724 GU359123 GU359396 GU359635 GU360004 GU360262 GU360273 GU360725 Neyraudia reynaudiana (Kunth) Keng ex Hitchcock Orcuttia inaequalis Hoover Orcuttia tenuis Hitchc. Orcuttia viscida (Hoover) Reeder China USA USA USA Orinus kokonorica (K. S. Hao) Keng ex X. L. Yang China Orinus thoroldii (Stapf ex Hemsely) Bor China Orinus thoroldii (Stapf ex Hemsely) Bor China Pappophorum pappiferum (Lam.) Kuntze Peru Pereilema beyrichianum (Kunth) Hitchc. Peru Pereilema ciliatum E. Fourn. Pereilema crinitum J. Presl Perotis hildebrandtii Mez Mexico Mexico Tanzania Perotis hordeiformis Nees Perotis indica (L.) Kuntze Perotis rara R. Br. China South Africa Australia Pogoneura biflora Napper Polevansia rigida De Winter Tanzania South Africa Psammagrostis wiseana C.A. Gardner & C.E. Hubb. Redfieldia flexuosa (Thurb. ex A. Gray) Vasey Reederochloa eludens Soderstr. & H.F. Decker Australia USA Mexico Rytidosperma penicellatum (Labill.) Connor & Edgar USA Rytidosperma pictum (Nees & Meyen) Nicora var. pictum Sclerodactylon macrostachyum (Benth.) A.Camus Argentina Domincan Republic Mexico USA Darfur Kenya Seychelles, Aldabra Island Scleropogon brevifolius Phil. Argentina Saugetia fasciculata Hitchc. & Chase Schaffnerella gracilis (Benth.) Nash Schedonnardus paniculatus (Nutt.) Trel. Schoenefeldia gracilis Kunth Schoenefeldia transiens (Pilg.) Chiov. Soreng 5318 & Peterson Hoover 1256 Stone 771 Reeder 6234 & Reeder Soreng 5447, Peterson & Sun Hang Soreng 5515, Peterson & Sun Hang Soreng 5529, Peterson & Sun Hang Peterson 21689, Soreng, La Torre & Rojas Fox Peterson 20366, Soreng & Romaschenko Peterson 20106, Hall, Alvarez Marvan & Alvarez Jimenez Peterson 22191 & Saarela Renvoize 1784 & Abdallah Soreng 5717, Peterson & Sun Hang Godfrey 1661 Roc 1900 Greenway 10620, Turner & Watson Smook 6000 Peterson 14345, Soreng & Rosenberg Peterson 7845 & Annable Reed 6430 GU359124 GU359397 GU359636 GU360003 GU360263 GU360272 GU359605 GU360002 GU360264 GU359398 GU360001 GU360726 GU360271 GU360727 GU360000 GU360236 GU359140 GU359399 GU359628 GU359999 GU360259 GU360270 GU360728 GU359126 GU359400 GU359626 GU359998 GU360257 GU360269 GU360721 GU359112 GU359401 GU359595 GU359997 GU360249 GU360268 GU360714 GU359128 GU359402 GU359596 GU359996 GU360248 GU360276 GU360700 GU359129 GU359493 GU359597 GU359995 GU360247 GU360280 GU360712 GU359130 GU359516 GU359598 GU359979 GU360246 GU360281 GU360719 GU359131 GU359519 GU359599 GU359993 GU360245 GU360282 GU360710 GU360008 GU360244 GU360709 GU359132 GU359520 GU359600 GU359991 GU360243 GU360283 GU360708 GU359133 GU359521 GU359990 GU360242 GU360293 GU360707 GU359134 GU359989 GU360241 GU360285 GU360706 GU359987 GU360239 GU359136 GU359523 GU359602 GU360704 GU360238 GU360287 GU359137 GU359533 GU359615 GU359986 GU360237 GU360288 GU360703 GU359138 GU359525 GU359604 GU359985 GU360191 GU360289 GU360702 GU359139 GU360158 GU360290 GU360701 Peterson 19685, Saarela & Sears GU359183 GU359518 GU359606 GU359984 GU360219 GU360291 GU360671 Peterson 19182, Soreng, Salariato & Panizza GU359227 GU359527 GU359607 GU359983 GU360172 GU360292 GU360655 Ekman s.n. Schaffner 134 Peterson 12070 & Annable Quezel & Bourreil s.n. Greenway 9781 Stoddart 741 Peterson 19280, Soreng, Salariado & Panizza GU359156 GU359528 GU359608 GU359982 GU360171 GU360317 GU360638 GU359981 GU359201 GU359529 GU359609 GU359936 GU360170 GU360375 GU360673 GU360169 GU359202 GU359610 GU360007 GU360168 GU360349 GU360636 GU359963 GU359203 GU359530 GU359611 GU359919 GU360167 GU360635 Sohnsia filifolia (E. Fourn.) Airy Shaw Sohnsia filifolia (E. Fourn.) Airy Shaw Mexico Mexico GU359204 GU359531 GU359612 GU359918 GU360166 GU360350 GU360634 USA Chile Peterson 11129 & Annable Reeder 4073 & Reeder Peterson 19154, Soreng, Salariado & Panizza Peterson 22342 & Saarela Peterson 22003 & Saarela Peterson 22025 & Saarela Peterson 21879, Soreng & Sanchez Vega Peterson 14233, Weakley & LeBlond Peterson 21163, Saarela, Rosen & Reid Peterson 19224, Soreng, Salariado & Panizza Peterson 14232, Weakley & LeBlond Peterson 15683 & Soreng Spartina densiflora Brongn. Sporobolus atrovirens (Kunth) Kunth Sporobolus cryptandrus (Torr.) A. Gray Sporobolus indicus (L.) R. Br. Argentina Mexico Mexico Mexico Sporobolus lasiophyllus Pilg. Peru Sporobolus pinetorum Weakley & P.M. Peterson USA Sporobolus pyramidalis P. Beauv. Mexico Sporobolus rigens (Trin.) Desv. Argentina Sporobolus teretifolius R.M. Harper Sporobolus virginicus (L.) Kunth Sporobolus wrightii Munro ex Scribn. Swallenia alexandrae (Swallen) Soderstr. & H.F. Decker Mexico USA Peterson 19841 & LaraContreras Carter 2784 GU359216 GU359511 GU359668 GU359906 GU360155 GU360348 GU360624 GU359217 GU359512 GU359669 GU359920 GU360154 GU360364 GU360639 Tetrachne dregei Nees Tetrapogon mossambicensis (K. Schum.) Chippend. ex. B. S. Fisher Tetrapogon spathaceus (Hochst. ex Steud.) Hack. ex T. Durand & Schinz South Africa Jarman 120 GU359218 GU359513 GU359670 GU359904 South Africa Oakes 1211 GU359219 Ash 2561 GU359220 Tetrapogon villosus Desf. Tragus australianus S.T. Blake Ethiopia Gran Canaria Australia GU359221 GU359514 GU359684 GU359901 GU360151 GU360367 GU360619 Tragus berteronianus Schult. Tragus berteronianus Schult. Tragus heptaneuron W.D.Clayton Peru Peru Kenya Johannes s.n. Symon 13792 Peterson 21615, Soreng, LaTorre & Rojas Fox FLSP 457 Gillett 13019 Tragus koelerioides Asch. Tragus mongolorum Ohwi Tragus pedunculatus Pilg. Trichloris crinita (Lag.) Parodi Trichloris pluriflora E. Fourn. South Africa Ceylon South Africa Bolivia Mexico GU359226 GU359551 GU359677 GU359896 GU360146 GU360372 GU360614 Trichloris pluriflora E. Fourn. Peru Smook 6844 Clayton 5229 Schweickerdt 2297 Bastian 341 Sohns 1258 Peterson 15048 & RefulioRodriguez Trichoneura eleusinoides (Rendle) Ekman South Africa Seydel 448 GU359135 GU359522 GU359601 GU359988 GU360240 GU360277 GU360705 GU359205 GU359532 GU359614 GU359917 GU360165 GU360332 GU360633 GU359206 GU359510 GU359640 GU359916 GU360164 GU360352 GU359207 GU359508 GU359915 GU360163 GU360315 GU360632 GU359208 GU359524 GU359674 GU359914 GU360162 GU360354 GU360631 GU359209 GU359504 GU359637 GU359913 GU360161 GU360355 GU360630 GU359210 GU359505 GU359664 GU359912 GU360145 GU360356 GU360629 GU359211 GU359506 GU359911 GU360159 GU360358 GU359228 GU359507 GU359665 GU359910 GU360174 GU360359 GU360628 GU359213 GU359517 GU359666 GU359909 GU360157 GU360360 GU360627 GU359199 GU359509 GU359908 GU360156 GU360376 GU360626 GU359215 GU359502 GU359667 GU359892 GU359903 GU360153 GU360362 GU360610 GU360365 GU360622 GU360621 GU359671 GU359902 GU360152 GU360366 GU360620 GU359222 GU359515 GU359673 GU359900 GU360150 GU360368 GU360618 GU359223 GU359535 GU359662 GU359899 GU360149 GU360369 GU360617 GU359224 GU359503 GU359675 GU359898 GU360148 GU360370 GU360616 GU359225 GU359526 GU359676 GU359897 GU360147 GU360371 GU360615 GU359894 GU360204 GU360612 GU359185 GU359552 GU359678 GU359895 GU360189 GU360373 GU360613 GU359171 GU359555 GU359907 GU360193 GU360363 GU360625 GU359214 GU359553 GU359679 GU359934 GU360160 GU360374 GU360653 GU359212 GU359554 GU359680 GU359905 GU360192 GU360334 GU360623 Trichoneura weberbaueri Pilg. Tridens muticus (Torr.) Nash Chile Mexico Triodia basedowii Pritz. Australia Triodia brizoides N.T. Burb. Australia Triodia bynoei (C.E. Hubb.) Lazarides Triodia desertorum (C.E. Hubb.) Lazarides Triodia fitzgeraldii N.T. Burb. Australia Australia Australia Triodia intermedia Cheel Triodia irritans var. laxispicata N.T. Burb. Australia Australia Triodia melvillei (C.E. Hubb.) Lazarides Triodia pungens R. Br. Australia Australia Triodia rigidissima (Pilg.) Lazarides Australia Triplasis purpurea (Walter) Chapm. Tripogon spicatus (Nees) Ekman Tripogon yunnanensis J.L. Yang ex S.M. Phillips & S.L. Chen Triraphis andropogonoides (Steud.) E. Phillips USA Peru Triraphis mollis R. Br. Triraphis purpurea Hack. Triraphis ramosissima Hack. Triraphis schinzii Hack. Tuctoria fragilis (Swallen) Reeder Tuctoria greenei (Vasey) Reeder Uniola condensata Hitchc. Australia South Africa South Africa South Africa Mexico USA Ecuador Uniola paniculata L. Urochondra setulosa (Trin.) C.E. Hubb. Vaseyochloa multinervosa (Vasey) Hitchc. Willkommia annua Hack. Willkommia sarmentosa Hack. Willkommia texana Hitchc. var. texana Zoysia japonica Steud. Zoysia macrantha Desv. Zoysia macrantha subsp. walshii M.E. Nightingale USA Pakistan USA South Africa South Africa USA Japan Australia Australia China South Africa Peterson 15686 & Soreng Peterson 21997 & Saarela Peterson 14437, Soreng & Rosenberg Peterson 14432, Soreng & Rosenberg Peterson 14424, Soreng & Rosenberg Lepschi 4499 & Craven Lazarides 3169 Peterson 14384, Soreng, & Rosenberg Hind 5731, D'Aubert & Jones Peterson 14383, Soreng & Rosenberg Thompson BUC800 & Simon GU359172 GU359565 GU359681 GU359948 GU360194 GU360361 GU360668 Spjut 7263, White, Phillips & Lacy Peterson 14238, Weakley & LeBlond Peterson 21784 & Soreng Soreng 5564, Peterson & Sun Hang Mennell s.n. Peterson 14344, Soreng & Rosenberg Schweickerdt 2115 Seydel 4278 Smook 1933 Reeder 7255 & Reeder Reeder 6656 & Reeder Peterson 9342 & Judziewicz Peterson 11160, Annable & Valdes-Reyna Reichinger 27496 Swallen 10041 Hackel s.n. Schweickerdt 2181 Gould 12525 Kuragadake s.n. Soreng 5913 & Peterson Loch 435 GU359198 GU359556 GU359646 GU359937 GU360198 GU360331 GU360657 GU359173 GU359557 GU359682 GU359947 GU360195 GU360321 GU360667 GU359174 GU359550 GU359683 GU359946 GU360205 GU360322 GU360666 GU359175 GU359559 GU359651 GU359945 GU360197 GU360323 GU360665 GU359176 GU359560 GU359649 GU359944 GU360190 GU360324 GU360664 GU359177 GU359561 GU359672 GU359943 GU360199 GU360325 GU360663 GU359178 GU359562 GU359641 GU359942 GU360200 GU360326 GU360662 GU359179 GU359563 GU359642 GU359941 GU360201 GU360327 GU360661 GU359180 GU359564 GU359643 GU359940 GU360202 GU360328 GU360660 GU359181 GU359542 GU359644 GU359939 GU360203 GU360329 GU360659 GU359182 GU359540 GU359645 GU359938 GU360175 GU360330 GU360658 GU359184 GU359536 GU359647 GU359921 GU360196 GU360347 GU360656 GU359170 GU359537 GU359648 GU359935 GU360188 GU360333 GU360640 GU359186 GU359538 GU360187 GU360487 GU359661 GU359949 GU360186 GU360335 GU360654 GU359187 GU359539 GU359650 GU359933 GU360185 GU359549 GU359639 GU359932 GU360184 GU359188 GU359541 GU359652 GU359931 GU360183 GU359653 GU359930 GU359189 GU359929 GU360182 GU359190 GU359928 GU360181 GU360336 GU360337 GU360338 GU360339 GU360669 GU360652 GU360651 GU360650 GU359191 GU359534 GU359654 GU359927 GU360180 GU360340 GU360649 GU359192 GU359543 GU359655 GU359926 GU360179 GU360341 GU360648 GU360178 GU360647 GU359193 GU359544 GU359656 GU359925 GU360177 GU360342 GU360646 GU360019 GU359194 GU359545 GU359657 GU359924 GU360252 GU360343 GU360645 GU359195 GU359546 GU360054 GU360344 GU360644 GU359196 GU359547 GU359658 GU359923 GU360022 GU360643 GU359142 GU359558 GU359660 GU360017 GU360020 GU360346 GU360641 GU359197 GU359548 GU359659 GU359922 GU360021 GU360345 GU360642