New Insights into the Evolution of Passiflora subgenus Decaloba (Passifloraceae): Phylogenetic Relationships and Morphological Synapomorphies

John M MacDougal

—Phylogenetic relationships of Passiflora subgenus Decaloba were examined using 148 taxa and four molecular markers: nuclear nrITS, ncpGS, cp trnL-F, and ndhF. Relationships of subgenus Decaloba to the other four Passiflora subgenera (Astrophea, Deidamioides, Tetrapathea, and Passiflora) are investigated, as are relationships among the eight supersections within subgenus Decaloba. Results indicate that subgenus Deidamioides is not monophyletic. Subgenus Astrophea + subgenus Deidamioides (section Tryphostemmatoides) together form the most basally branching lineage in the genus, followed by a clade comprised of subgenus Passiflora + subgenus Deidamioides (sections Tetrastylis, Polyanthea, and Deidamioides). Passiflora obovata (subgenus Deidamioides section Mayapathanthus) is resolved as part of subgenus Decaloba. The Old World subgenus Tetrapathea is supported as sister to subgenus Decaloba. Subgenus Decaloba is monophyletic and contains seven major lineages that generally correspond to currently recognized supersections. Within subgenus Decaloba, supersection Pterosperma is most basally branching, followed by supersection Hahniopathanthus + P. obovata. The New World species Passiflora multiflora, the type of supersection Multiflora, is resolved as sister to a monophyletic Old World supersection Disemma. The remainder of the former supersection Multiflora is paraphyletic with respect to supersection Auriculata. Supersections Cieca, Bryonioides, and Decaloba are monophyletic. Within supersection Decaloba, two main clades are resolved: 1) section Xerogona + section Decaloba pro parte and 2) the remainder of section Decaloba. The molecular phylogeny supports a New World origin for Passiflora, with two independent radiations to the Old World. Morphological synapomorphies are discussed for the major clades, documenting a pattern of remarkable evolutionary lability in several notable characters.

Systematic Botany (2013), 38(3): pp. 692–713 © Copyright 2013 by the American Society of Plant Taxonomists DOI 10.1600/036364413X670359 New Insights into the Evolution of Passiflora subgenus Decaloba (Passifloraceae): Phylogenetic Relationships and Morphological Synapomorphies Shawn E. Krosnick,1,6 Kristen E. Porter-Utley,2,6 John M. MacDougal,3 Peter M. Jørgensen,4 and Lucinda A. McDade5 1 Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. Southern Arkansas University, Department of Biology, 100 East University Street, Magnolia, Arkansas 71753 U. S. A. 2 Keene State College, Department of Biology, 229 Main Street, Keene, New Hampshire 03435 U. S. A. 3 Harris-Stowe State University, Department of Mathematics and Natural Sciences, 3026 Laclede, St. Louis, Missouri 63103 U. S. A. 4 Missouri Botanical Garden, Post Office Box 299, St. Louis, Missouri 63166 U. S. A. 5 Rancho Santa Ana Botanic Garden, 1500 North College Avenue, Claremont, California 71753 U. S. A. 6 Both authors contributed equally to this work. Authors for correspondence (sekrosnick@saumag.edu or kporterutley@keene.edu). Communicating Editor: Lucia G. Lohmann Abstract—Phylogenetic relationships of Passiflora subgenus Decaloba were examined using 148 taxa and four molecular markers: nuclear nrITS, ncpGS, cp trnL-F, and ndhF. Relationships of subgenus Decaloba to the other four Passiflora subgenera (Astrophea, Deidamioides, Tetrapathea, and Passiflora) are investigated, as are relationships among the eight supersections within subgenus Decaloba. Results indicate that subgenus Deidamioides is not monophyletic. Subgenus Astrophea + subgenus Deidamioides (section Tryphostemmatoides) together form the most basally branching lineage in the genus, followed by a clade comprised of subgenus Passiflora + subgenus Deidamioides (sections Tetrastylis, Polyanthea, and Deidamioides). Passiflora obovata (subgenus Deidamioides section Mayapathanthus) is resolved as part of subgenus Decaloba. The Old World subgenus Tetrapathea is supported as sister to subgenus Decaloba. Subgenus Decaloba is monophyletic and contains seven major lineages that generally correspond to currently recognized supersections. Within subgenus Decaloba, supersection Pterosperma is most basally branching, followed by supersection Hahniopathanthus + P. obovata. The New World species Passiflora multiflora, the type of supersection Multiflora, is resolved as sister to a monophyletic Old World supersection Disemma. The remainder of the former supersection Multiflora is paraphyletic with respect to supersection Auriculata. Supersections Cieca, Bryonioides, and Decaloba are monophyletic. Within supersection Decaloba, two main clades are resolved: 1) section Xerogona + section Decaloba pro parte and 2) the remainder of section Decaloba. The molecular phylogeny supports a New World origin for Passiflora, with two independent radiations to the Old World. Morphological synapomorphies are discussed for the major clades, documenting a pattern of remarkable evolutionary lability in several notable characters. Keywords—Astrophea, Deidamioides, Tetrapathea, molecular phylogeny, New World, Old World. Passiflora L. is a large and diverse genus of more than 560 species of vines, lianas, trees, and shrubs. The genus is primarily distributed throughout Mexico and Central and South America, but 24 species are endemic to Southeast Asia and the Pacific. In the most recent infrageneric classification of Passiflora, Feuillet and MacDougal (2003) recognized four subgenera: Passiflora, Deidamioides (Harms) Killip, Astrophea (DC.) Mast., and Decaloba (DC.) Rchb. Krosnick et al. (2009) recognized subgenus Tetrapathea (DC.) P. S. Green, raising the number of subgenera to five. Subgenus Passiflora includes ca. 250 species and is the largest and best-known of the subgenera, partly because some species have economic importance (Ulmer and MacDougal 2004). Subgenus Passiflora is generally characterized by having large flowers with multiple series of coronal filaments, and is most diverse in South America. Subgenus Deidamioides is a morphologically disparate group of 14 species found in Central and South America. Subgenus Astrophea consists of ca. 60 species of lianas and small to medium-sized trees that are most diverse in the lowlands of northern South America. Subgenus Tetrapathea is the smallest, with three species of dioecious lianas found in northeast Australia, Papua New Guinea, and New Zealand. Lastly, with ca. 230 recognized and more than a dozen as yet undescribed species, subgenus Decaloba, with its characteristically small flowers, rivals subgenus Passiflora in species diversity. The center of diversity for subgenus Decaloba is Mexico (59 species), followed by Colombia (56 species), and Guatemala (40 species). With species in the United States, Mexico, Central and South America, Asia, Australia, and the Pacific, subgenus Decaloba also has the broadest geographical distribution of any of the subgenera: it is the only subgenus to have both New World (NW) and Old World (OW) species. Although Decaloba is the second largest subgenus in Passiflora, comparatively little is known about the evolutionary history of these species. Subgenus Decaloba was originally described by de Candolle (1822) as a section within Passiflora. He recognized this group as having five sepals and five petals, reduced or absent floral bracts, and single-flowered peduncles. Reichenbach (1828) later elevated the section to subgeneric rank. Masters (1871) established subgenus Plectostemma Mast. containing almost the same taxa (Masters 1872), not realizing subgenus Decaloba already existed. The most comprehensive treatment of NW Passifloraceae, including Decaloba, was completed by Killip (1938). He maintained subgenus Plectostemma and recognized 21 additional subgenera; of these, five contained species that are now recognized as part of subgenus Decaloba. The OW species were not revised until De Wilde (1972) formally treated them as part of subgenus Decaloba. One additional subgenus, Porphyropathanthus L. K. Escobar, was established in 1989, containing a single Colombian species (Escobar 1989). Feuillet and MacDougal (1999, 2003) and MacDougal and Feuillet (2004) recognized eight supersections within subgenus Decaloba: Pterosperma (L. E. Gilbert & J. M. MacDougal) J. M. MacDougal & Feuillet (four species), Hahniopathanthus (Harms) J. M. MacDougal & Feuillet (six species), Auriculata J. M. MacDougal & Feuillet (eight species), Cieca (Medik.) J. M. MacDougal & Feuillet (19 species), Disemma (Labill.) J. M. MacDougal & Feuillet (21 species), Bryonioides (Harms) J. M. MacDougal & Feuillet (22 species), Multiflora (Small) J. M. MacDougal & Feuillet (22 species), and Decaloba (DC.) J. M. MacDougal & Feuillet (130 species). The subgenus 692 KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA has a suite of unique characteristics not found elsewhere in Passiflora: relatively small flowers (generally < 4 cm in diameter), a plicate membranous (vs. smooth or filamentous) operculum, and two to three series of coronal filaments (vs. usually four or more). Several groups may be distinguished within the subgenus based on additional unique character combinations such as variegation of juvenile leaves, gravitational orientation of shoot tips, trichome morphology, seed coat ornamentation, absence of petals, and position or absence of laminar or petiolar nectaries. Phylogenetic knowledge of subgenus Decaloba at all taxonomic levels remains limited. Previous phylogenetic studies of the genus have included at most 39 of the 230 species in subgenus Decaloba (Muschner et al. 2003; Yockteng and Nadot 2004a; Krosnick and Freudenstein 2005; Hansen et al. 2006). Since Killip (1938), only four lineages within subgenus Decaloba have been studied in detail thus far: supersection Bryonioides (MacDougal 1994), supersection Cieca (PorterUtley 2003, 2007, in press), supersection Disemma (Krosnick and Freudenstein 2005; Krosnick 2006), and supersection Decaloba section Xerogona (Raf.) Killip (Boza et al. in press). Relationships within and between the remaining supersections, including the largest, Decaloba, are essentially unknown. Phylogenetic analyses of DNA sequence data for Passiflora indicate that aspects of the classification of Feuillet and MacDougal (2003) may be problematic with regard to subgenus Decaloba. For example, Krosnick and Freudenstein (2005) showed that supersection Multiflora is paraphyletic with respect to supersection Auriculata. Another issue that has not been fully addressed is the relationship of subgenus Decaloba to the remainder of the genus. This is complicated by the fact that infrageneric relationships in Passiflora are still poorly understood. The monotypic genera Hollrungia K. Schum. and Tetrapathea (DC.) Rchb. were shown to be part of Passiflora (Yockteng and Nadot 2004a; Hearn 2006; Krosnick et al. 2009). Tetrapathea, however, was resolved within subgenus Decaloba (Yockteng and Nadot 2004a), while in Hearn (2006), it was resolved as sister to Decaloba. In the results of Yockteng and Nadot (2004a), subgenus Deidamioides appears to be paraphyletic as currently defined, with P. cirrhiflora Juss. resolved as sister to the rest of Passiflora and P. tryphostemmatoides Harms resolved as sister to subgenus Astrophea. Hansen et al. (2006) resolved P. deidamioides Harms, P. ovalis Vell. ex M. Roem., and P. cirrhiflora (subgenus Deidamioides) as a monophyletic clade sister to subgenus Decaloba. Increased sampling of species placed in other subgenera, particularly Astrophea, Tetrapathea, and Deidamioides, is needed to test the monophyly of subgenus Decaloba and to identify appropriate outgroups for comparative studies. The present study seeks to address several important goals in order to increase understanding of the evolutionary history of subgenus Decaloba. First, the monophyly of subgenus Decaloba is tested to determine the boundaries of the subgenus relative to the four other subgenera. Second, relationships among the subgenera are clarified, resulting in the identification of the sister lineage to subgenus Decaloba. Third, Feuillet and MacDougal’s (2003) classification of subgenus Decaloba (supersections and sections) is tested with a dense taxon sample for the subgenus and recommendations are made for taxonomic revision of problematic lineages. Lastly, putative morphological synapomorphies are identified for the major lineages supported in the molecular analysis. 693 Materials and Methods Taxon Sampling and Outgroup Selection—Recent analyses strongly support a monophyletic Passiflora (Yockteng and Nadot 2004a; Krosnick and Freudenstein 2005; Hansen et al. 2006). Six taxa were chosen outside of Passiflora, including three Passifloraceae (Adenia heterophylla (Blume) Koord., Paropsia madagascariensis (Mast.) H. Perrier, and Basananthe triloba (Bolus ex Schinz) W. J. de Wilde), two Malesherbiaceae (Malesherbia lanceolata Ricardi, M. weberbaueri Gilg), and one Turneraceae (Turnera ulmifolia L.). Within Passiflora, subgenera Passiflora and Astrophea were sampled to ensure that all major lineages within Passiflora were represented. Six species (of 250 species) from subgenus Passiflora were included, as were seven (of 60) from Astrophea. Since the primary focus of this study was to address relationships within subgenus Decaloba and its position relative to the questionably placed subgenera Deidamioides and Tetrapathea, sampling was most extensive in these groups. Subgenus Decaloba was represented by all eight supersections, including Auriculata (four of eight species), Bryonioides (11 of 22), Cieca (7 of 19), Decaloba (64 of ca. 130), Disemma (13 of 21), Hahniopathanthus (three of five), Multiflora (10 of 22), and Pterosperma (three of four). All three species of subgenus Tetrapathea were included. Subgenus Deidamioides was represented by seven of 14 species, including representatives from all five sections within the subgenus. A total of 148 taxa were sequenced across four loci. Sequences were generated via direct sequencing of DNA from leaf material (see DNA Extraction and Purification). In cases where herbarium samples or older DNA isolations did not amplify for all four loci, alternative accessions of the same taxon were used to ensure that sequence data for a given taxon were as complete as possible for all loci sampled. If alternative accessions were not available, those taxa were included with missing data in the multi-locus analyses but no taxa were included in the analyses unless sequences from at least three of the four loci were available. A total of 19 sequences were obtained from GenBank. Appendix 1 includes herbarium specimen voucher information and GenBank accession numbers for all taxa used in this analysis. DNA Extraction and Purification—Total genomic DNA was isolated from fresh leaf material, tissue preserved in silica gel, or herbarium specimens (sampled with permission of the lending institution). Total genomic DNA was extracted using the CTAB method (Doyle and Doyle 1987) or DNeasy Plant Mini kits (Qiagen Inc., Valencia, California). DNA from herbarium specimen material was isolated using the CTAB protocol with the following modifications: dry leaf tissue was homogenized using a Mini-Beadbeater-8 (BioSpec Products Inc., Bartlesville, Oklahoma) in 1.5 ml microcentrifuge tubes filled to 1/3 volume with 2.3 mm diameter silicon beads or in standard mortars and pestles; following a 24:1 chloroformisoamyl alcohol precipitation, DNA was precipitated in 0.04 volume of 3 M sodium acetate and 0.65 volume of 100% isopropanol for 3–5 wk at –20 C. When necessary, DNA samples were further purified using the Elu-Quik DNA purification kit (Whatman Inc., Piscataway, New Jersey), the QIAquick PCR purification kit (QIAGEN Inc.), or by precipitating the DNA 2–3 times with 10 mM NH4OAc in 76% EtOH. DNA Amplification and Sequencing—The nuclear ribosomal internal transcribed spacer region (nrITS) including ITS1, the 5.8S gene, and ITS2, was directly amplified using primers 5 and 4 of White et al. (1990). In cases where direct amplification was not readily achieved, the primers 17SE and 26SE (Sun et al. 1994) were used in an initial round of PCR, and 0.2–1 ml of PCR product was used as a template in a subsequent reaction using primers 5 and 4. The PCR reaction protocols for nrITS followed Krosnick and Freudenstein (2005). Nuclear expressed glutamine synthetase (ncpGS) was amplified using primers 687 and 994 (Emshwiller and Doyle 1999) in Adenia Forssk., Paropsia Noronha ex Thouars, Basananthe Peyr., Turnera L., and Malesherbia Ruiz & Pav. samples as well as subgenera Passiflora, Deidamioides, Astrophea, and Tetrapathea. In subgenus Decaloba, these same primers amplify the multi-copy nuclear encoded cytosol-expressed glutamine synthetase (cytGS; Yockteng and Nadot 2004b) instead of ncpGS (Yockteng and Nadot 2004a). In these species, ncpGS was specifically targeted using primers 839F and 1056R designed by Yockteng and Nadot (2004a) for use in subgenus Decaloba. The internal primers ncpGS-IntF (50 CATCAAACTCACCTTTTCTTTCC 30 ) and ncpGSIntR (50 ACATCACCTCAATTGGTTTTG 30 ) were designed for use in nested PCR reactions. The ncpGS amplification reactions contained 40 ml HPLC water, 1 ml each of 10 mm primer, 5 ml 10 buffer (100 mM Tris-HCl pH 8.8, 35 mM MgCl2, 250 mM KCl), 0.5 ml of 0.20 mm dNTPs, 0.5 ml Taq polymerase, and 0.5 ml of 10 mg/ml of bovine serum albumen. The amplification program for ncpGS was a single initial cycle of 95 C for 5 min, followed by 35 cycles of 95 C for 1 min, 50 C for 1 min, and 72 C for 2 min, followed by a final 5 min extension at 72 C. + Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] 694 SYSTEMATIC BOTANY Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. + The trnL-F region of chloroplast DNA was amplified with primers “c” and “f” of Taberlet et al. (1991). Internal primers “d” and “e” (Taberlet et al. 1991) were used as necessary for nested PCR to obtain complete sequences for the region. The PCR amplification conditions followed those outlined in Krosnick and Freudenstein (2005). The ndhF region of chloroplast DNA was amplified using primers 5.5F and 10.2R of R. Nyffeler (Davis et al. 2001). For DNAs that would not amplify readily, the primers Pass-ndhF-BAK-1F (50 TGGTTGTATTCACCTATTTTCGC 30 ) and Pass-ndhF-BAK-2R (50 ACAGAGTAAATTCTACAAACTCTCTTAT ACCC 30 ) were used. The ndhF amplification reactions contained 40 ml HPLC water, 1 ml of each of 10 mm primer, 5 ml 10 buffer (100 mM Tris-HCl pH 8.8, 35 mM MgCl2, 250 mM KCl), 0.5 ml of 0.20 mm dNTPs, 0.5 ml Taq polymerase, and 0.5 ml of DMSO. The amplification program for ndhF was a single initial cycle of 94 C for 5 min, followed by 25 cycles of 94 C for 45 sec, 55 C for 45 sec, and 72 C for 1 min, followed by a final 7 min extension at 72 C. Amplification products of nrITS, ncpGS, trnL-F, and ndhF were purified by precipitating with 50 ml of 20% polyethylene glycol-2.5 M NaCl followed by two ethanol precipitations or by using ExoSAP-IT (Affymetrix/ USB, Santa Clara, California) or Qiagen PCR purification kits (Qiagen Inc.). Dideoxy cycle sequencing reactions used BigDye Terminator version 3.1 chemistry (Applied Biosystems, Foster City, California) scaled down to quarter reaction volume. Sequencing reactions were analyzed on an Applied Biosystems 3100 automated sequencer at Rancho Santa Ana Botanic Garden (Claremont, California), or using an Applied Biosystems 3730XL automated sequencer at the High-Throughput Sequencing Solutions lab at University of Washington, Department of Genome Sciences (Seattle, Washington). Bidirectional sequence contigs were assembled and edited using Geneious Pro v. 5.0.3 (Drummond et al. 2011) or Sequencher v. 4.1.1 (Gene Codes Corporation 2000). Dataset Congruence, Phylogenetic Analyses, and Branch Support—All nrITS, ncpGS, trnL-F, and ndhF sequences were initially aligned using Clustal W (Thompson et al. 1994) using the default alignment parameters. The ncpGS, trnL-F, and ndhF matrices were adjusted manually using Se-Al (Rambaut 2000). The nrITS alignment used for phylogenetic analysis was as output by Clustal without further adjustment as manual adjustments did not improve the alignment. Both individual and combined datasets used were deposited in TreeBASE (study number 12855) and all sequences were deposited in GenBank (see Appendix 1). The incongruence length difference (ILD) Test of Farris et al. (1994), as implemented in WinClada and submitted to NONA, was performed among all pairwise combinations of individual single gene matrices as well as between the nuclear and chloroplast datasets. All parsimony uninformative characters were deactivated prior to the ILD analyses. Following the recommendations of Davis et al. (2004), five hundred paired replicate analyses (# of replications) of random character partitions were performed, with each replicate comprising four search initiations (# of mult reps/replication) and up to 20 trees retained (# trees to hold/mult rep) during TBR swapping after each initiation. This was followed by TBR of all shortest trees from each set of four initiations, including those generated during this phase of swapping, with up to 100 trees retained (# trees for hold*). Unweighted maximum parsimony (MP) analyses were undertaken using Winclada (BETA) ver. 1.00.08 (Nixon 2002). All characters were treated as non-additive, and uninformative characters were deactivated for all analyses. Datasets were analyzed separately (nrITS, ncpGS, ndhF, and trnL-F) and in combination (chloroplast loci, nuclear loci, and all loci combined). The parsimony ratchet of Nixon (1999), as implemented in Winclada and submitted to NONA, was used as the primary search strategy for both the individual and combined matrices. For single locus analyses, the following parameters were used: 20 sequential ratchets were performed, each with 500 iterations per replication, holding two trees per replication, in which 10% of the characters were re-weighted, using a random constraint level of 10. All trees obtained as a result of the Ratchet runs were retained in the tree buffer within Winclada, and these were then submitted to NONA for additional swapping (max out) with the upper limit on the number of trees retained set to 100,000 trees (max 100,000). For combined locus analyses (chloroplast, nuclear, and all loci combined), trees obtained as a result of the Ratchet runs were retained in the tree buffer within Winclada, and these were then submitted to NONA for additional swapping (max out) with the upper limit on the number of trees retained set to 500,000 trees (max 500,000). All MP trees were saved and summarized through strict consensus. The consistency (CI) and retention (RI) indices for each dataset were calculated including both informative and uninformative characters. Branch support for the MP analyses was assessed using 10,000 jackknife replicates (MP JK) in Winclada, with random character removal set at 37%. Heuristic searches [Volume 38 were performed using two starting trees per replicate (mult*2), with two trees held per replicate (hold/2). Only clades with a frequency of 50% or higher were retained in the jackknife consensus tree. For maximum likelihood (ML) and Bayesian inference (BI) analyses, molecular evolution model parameters were estimated from the individual nrITS, ncpGS, ndhF, and trnL-F datasets using the Akaike information criterion (AIC) in jModelTest v. 0.1.1 (Posada 2008). All models selected incorporated the gamma distribution for rate heterogeneity. The Q-matrices selected were all variants of TIM, TPM, TVM, or GTR. ML analyses were performed for the combined nrITS, ncpGS, ndhF, and trnL-F using GARLI v. 2.0 (Zwickl 2006). Model parameters and rate multipliers obtained for each locus from jModelTest were used to configure independent partitions in GARLI for maximum likelihood analyses of the concatenated alignment. Starting topologies for tree searches were generated in GARLI starting from random trees and using 5,000,000 generations per search (five search replicates), with indels treated as missing. Maximum likelihood bootstrap values (ML BS) were estimated from 100 bootstrap replicates in GARLI. Saved trees were summarized as majority rule consensus trees in PAUP* v. 4.0b10 (Swofford 2002). Bayesian analyses were performed in MrBayes on TG v. 3.1.2 (Huelsenbeck and Ronquist 2001) on the CIPRES cluster (Miller et al. 2010) for the combined molecular dataset with each gene region treated as a separate partition. Each analysis was done using the same models used for the ML analyses and consisted of one run of 10,000,000 generations from a random starting tree using a variable rate prior, and four Markov chains sampled every 1,000 generations. The resulting branch posterior probabilities and consensus topology were summarized using the sumt command in MrBayes, excluding trees from the initial 1,000 generations as burn-in. The combined posterior distribution was summarized using a 50% majority-rule consensus tree of all the post-burn-in trees. Results Molecular Dataset Characteristics—Seven datasets were assembled: individual nrITS, ncpGS, trnL-F, ndhF, combined nuclear loci (nrITS + ncpGS), combined chloroplast loci (ndhF, trnL-F), and four loci combined (Table 1). Owing to variable success in PCR amplifications across the loci, the individual datasets vary in the number of taxa included. nrITS was obtained for the greatest number of taxa, followed by ndhF, ncpGS, and trnL-F. Of the individual datasets, nrITS provided the greatest number of parsimony-informative characters (PICs), followed by ncpGS, ndhF, and trnL-F. The percentage of missing data was greatest for the trnL-F dataset, owing to large sequence differences between distantly related outgroup genera with the ingroup, and mononucleotide repeats that made obtaining full-length sequences difficult. Similarly, many data were missing for ncpGS owing to the use of primers 839/1056 (Yockteng and Nadot 2004a) for subgenus Decaloba. These primers amplify a shorter portion of the ncpGS gene compared to the primers used for taxa outside subgenus Decaloba (i.e. 687/994; Emshwiller and Doyle 1999). The combined four-locus dataset had most taxa included, with 148 accessions in total. The nuclear dataset had the most PICs (due to the inclusion of nrITS), followed by the four-locus dataset, with the fewest PICs observed in the chloroplast dataset. Phylogenetic Analyses of Individual Datasets—Maximum parsimony analysis of the individual nrITS, ncpGS, ndhF, and trnL-F datasets revealed variable levels of resolution and support for relationships among the subgenera and within subgenus Decaloba (Table 1). The nrITS dataset produced 100,411 equally most parsimonious trees of 3,051 steps (Supplemental Fig. 1A; CI = 0.31, RI = 0.74); this locus provided the most resolution at the level of subgenus and supersection, with jackknife support ³ 70% for most clades along the backbone of the tree and for most Decaloba supersections. The ncpGS dataset produced 100,188 equally 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA 695 Table 1. Characteristics of the four individual (nrITS, ncpGS, trnL-F and ndhF) and three combined (nuclear, chloroplast, and four-gene combined) datasets. Taxon sampling differed between the four loci (see Appendix 1). Missing data values for combined datasets do not include placeholder taxa that were entirely lacking for that locus. CI and RI were calculated from parsimony analysis of individual and combined datasets. Locus Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ITS ncpGS ndhF trnL-F ITS + ncpGS ndhF + trnL-F All loci combined Number of taxa Aligned length Constant sites Variable sites (%) Parsimony informative sites (%) Missing data # MP trees recovered CI RI MP tree length 142 133 135 129 148 147 148 806 760 751 1,128 1,566 1,879 3,445 237 269 347 526 506 873 1,379 117 (14%) 201 (26%) 170 (22%) 292 (25%) 318 (20%) 462 (24%) 780 (22%) 452 (56%) 290 (38%) 234 (31%) 310 (27%) 742 (47%) 544 (29%) 1,286 (37%) 22% 34% 10% 37% 26% 23% 24% 100,441 100,188 100,201 100,264 513,095 500,040 41,024 0.31 0.54 0.44 0.59 0.34 0.39 0.34 0.74 0.83 0.87 0.71 0.74 0.70 0.71 3,051 905 916 1,362 4,166 2,285 6,797 parsimonious trees of 905 steps (Supplemental Fig. 1B; CI = 0.54, RI = 0.83). The ncpGS strict consensus showed most resolution at the level of supersection and below. Jackknife support was ³ 70% for several supersections in subgenus Decaloba. The ncpGS dataset did not support expected outgroup relationships, as Adenia and Basananthe were resolved within Passiflora, and some members of subgenus Decaloba supersection Decaloba were placed basally within Passiflora. The combined nuclear dataset (nrITS + ncpGS) produced 513,095 equally parsimonious trees of 4,166 steps (Supplemental Fig. 1C; CI = 0.34, RI = 0.74). There was no resolution for outgroup relationships, but several supersections and sections within subgenus Decaloba were well resolved and supported as monophyletic with ³ 70% jackknife support. The ndhF dataset produced 100,201 trees of 916 steps (Supplemental Fig. 2A; CI = 0.44, RI = 0.87); this locus provided greatest resolution at the level of subgenus and supersection, providing good jackknife support (³ 70%) for relationships among most outgroups (except Malesherbia and Adenia, which were placed within subgenus Decaloba). The trnL-F dataset produced 100,264 equally most parsimonious trees of 1,362 steps (Supplemental Fig. 2B; CI = 0.59, RI = 0.71). This region did not provide strong signal for resolution of relationships within subgenus Decaloba, but did provide jackknife support of ³ 70% for relationships among outgroups Malesherbia, Turnera, and Paropsia. In addition, subgenus Astrophea and portions of subgenus Deidamioides were resolved by these data. The remaining taxa were generally unresolved. The combined chloroplast dataset (ndhF and trnL-F) produced 500,040 equally most parsimonious trees of 2,285 steps (Supplemental Fig. 2C; CI = 0.39, RI = 0.70). The chloroplast data provided greatest resolution for relationships among the outgroup genera (Malesherbia, Turnera, Basananthe, and Paropsia), as well as for relationships among subgenera Passiflora, Deidamioides, Astrophea, and Tetrapathea. Outgroup relationships were resolved as expected with the exception of Adenia, which was resolved within subgenus Decaloba. Clade support was greatest along the backbone of the tree, although some terminal clades were also supported with jackknife values of 70% or higher. Thus, whereas the nuclear data provide greatest resolution and support for relationships at the level of supersection and section in subgenus Decaloba, the chloroplast data provided most signal with respect to the deeper clades (genera and subgenera). Across the four datasets, nrITS provided the greatest resolution, followed by ncpGS, ndhF, and trnL-F. Evaluation of Incongruence Between the Datasets—All pairwise comparisons of loci, as well as between the com- bined chloroplast vs. combined nuclear loci revealed significant incongruence (p = 0.002). The ILD test has been shown to be susceptible to several factors that increase the chance of detecting significant differences erroneously (type I error) including differences in taxon sample and size, matrix size, amount of homoplasy within each dataset, and amount of missing data (Dolphin et al. 2000; Barker and Lutzoni 2002; Hipp et al. 2004). To test for impact of differences in taxon sample size, additional analyses were run including only taxa for which there were no missing data in either of the matrices being compared. In these cases, incongruence was still significant at p = 0.002, suggesting that the incongruence detected by the ILD is due to weak signal and/or homoplasy within the individual datasets, or genuine incongruence. The strict consensus of MP trees generated from the individual analyses were, with the exception of the nrITS dataset, poorly resolved (Supplemental Figs. 1, 2), suggesting that the individual datasets have limited signal. Comparisons of jackknife support were made among the topologies present in the strict consensus trees produced by individual loci and revealed no strongly supported differences in resolution of the deeper nodes in Passiflora (subgenera, supersections). However, a few well-supported conflicts exist among terminal taxa. For example, Adenia heterophylla was sister to P. multiflora L. in the ndhF dataset (MP JK = 99%), P. helleri Peyr. was sister to P. vespertilio L. (MP JK = 97%) in the ncpGS topology. Passiflora tenella Killip was sister to section Xerogona (Raf.) Killip (MP JK = 93%) in the nrITS dataset, but sister to P. sagasteguii Skrabal & Weigend (MP JK = 83%) in the ncpGS dataset. Further study revealed that these cases of conflicting placement were primarily due to either high levels of sequence divergence which made unambiguous alignment difficult, or shorter sequence lengths that introduced additional missing data into the matrix. However, any taxa that behaved anomalously were prioritized for cloning to rule out additional factors such as heteroplasmy or hybridization. Data from all four loci were analyzed together to permit full interaction of characters and to allow secondary signal within the datasets to be revealed in a robust phylogeny constructed from the combined data. Combined Molecular Dataset—The combined dataset contained 148 taxa and 3,445 nucleotide characters, of which 1,286 (37%) were parsimony informative (Table 1). The percentage of missing data within the combined dataset was 34%. Parsimony analyses produced 41,024 equally parsimonious trees of 6,797 steps (CI = 0.34, RI = 71). For the ML and BI analyses, models of sequence evolution were: nrITS—TPM2uf + I + G; ncpGS—TIM2 + G; trnL-F—TVM + G; Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 696 SYSTEMATIC BOTANY ndhF—GTR + G. Maximum likelihood analyses yielded a single most-likely tree (–lnL score = 46,517). The Bayesian MCMC runs retained 8,000 post burn-in trees. Comparison among the independent runs showed that all had mixed adequately, and stability was achieved by 350,000 generations. The ML topology was chosen to represent and discuss results from all three analytical approaches for two reasons. First, the MP, ML, and BI topologies are congruent, the only differences being in the amount of resolution (ML being the most resolved, followed by BI, then MP). Second, the ML topology was the most resolved, thus yielding the greatest insight into relationships within subgenus Decaloba supersection Decaloba, the least well-understood group in the subgenus. A simplified diagram of phylogenetic relationships resolved by ML analysis of the combined molecular dataset is shown as Fig. 1. Clades of particular importance were assigned letters to facilitate their identification across all figures and in the text. The detailed ML phylogeny is divided into two figures with Fig. 2 spanning the outgroup genera through clade M, and Fig. 3 presenting clades N–Y. Support values shown on the ML topology include ML bootstrap (ML BS), MP jackknife (MP JK) and Bayesian posterior probabilities (BPP) with thresholds for presentation of ³ 50% for ML BS and MP JK, and ³ 0.50 for BPP. Incongruences between analytical methods are discussed below. With regard to outgroup genera, the MP, ML, and BI analyses resolved relationships similarly. With Malesherbia designated as the root, Turnera was sister to the remainder of the taxa in the analysis. In the ML and BI analyses, Basananthe and Paropsia were weakly resolved as sisters (ML BS = < 50%, BPP = 0.84), whereas in the MP analysis, Paropsia (99% MP JK) was resolved below Basananthe (54% MP JK) in a basal grade that leads to the rest of the family. In all analyses Adenia was strongly supported as sister to Passiflora (ML BS = 98%, BPP = 1.0, MP JK = 93%; support values will be presented in this same order subsequently); similarly, the genus Passiflora was well supported as monophyletic (95%, 1.0, 99%). Subgeneric relationships in Passiflora were congruently resolved across the MP, ML and BI trees. Subgenera Astrophea and Passiflora were supported as monophyletic lineages in all three analyses. Subgenus Deidamioides was polyphyletic, with species placed in three different locations in the tree. The basally branching clade in Passiflora was comprised of subgenus Astrophea + subgenus Deidamioides section Tryphostemmatoides Harms (clade A: 92%, 1.0, 99%). The next branching lineage consisted of subgenus Passiflora sister to clade B, which contained three sections of subgenus Deidamioides: sections Polyanthea, Tetrastylis, and Deidamioides, though with somewhat weak support (clade C: 64%, 0.99, 77%). Next, subgenus Tetrapathea + subgenus Decaloba formed a well-supported clade (clade D: 100%, 1.0, 98%). Subgenus Tetrapathea was weakly supported as monophyletic by both ML and BI analyses (clade E: ML BS = <50%; BPP = 0.79). In the MP analysis, P. kuranda Krosnick & A. J. Ford and P. aurantioides (K. Schum.) Krosnick were well-supported as sisters (MP JK = 97%) while P. tetrandra Banks ex DC. was unresolved relative to these other two members of subgenus Tetrapathea, forming a polytomy with P. kuranda + P. aurantioides and subgenus Decaloba. Within subgenus Decaloba (clade F), all supersections recognized by Feuillet and MacDougal (2003) were supported as monophyletic with the exception of supersections Multiflora and Auriculata, which were resolved as paraphyletic with [Volume 38 respect to one another in all three analyses. In addition, Passiflora multiflora L., the type of supersection Multiflora, was resolved as sister to supersection Disemma (clade K). As a result, supersection Multiflora becomes monotypic excluding the remainder of the species placed in that section by Feuillet and MacDougal (2003). Within Decaloba, supersection Pterosperma was well-supported as the most basal clade (clade G: 100%, 1.0, 100%). Passiflora obovata Killip (subgenus Deidamioides section Mayapathanthus Killip ex J. M. MacDougal & Feuillet) + the remainder of subgenus Decaloba formed a strongly supported clade (clade I: 100%, 1.0, 99%). Passiflora obovata was weakly supported as sister to supersection Hahniopathanthus in the ML and BI topology (ML BS = 63%, BPP = 0.77), but was unresolved at the base of clade H in the MP tree. Whereas the ML and BI analyses provided resolution for relationships between the remaining supersections, the MP topology was unresolved with regard to the backbone relationships between those same clades. The next lineage to diverge was the OW supersection Disemma + NW P. multiflora L. (clade K: 73%, 1.0; 75%). Supersection Disemma was strongly supported as monophyletic (99%, 1.0, 92%). After clade K, the next lineage resolved was clade M, which included all sampled members of supersections Auriculata and Multiflora (exception P. multiflora; ML BS = 57%, BPP = 0.97), with P. holosericea L. as the basal-most member. Passiflora holosericea was not placed with confidence by MP. Supersection Cieca diverged next along the Decaloba backbone, and was strongly supported as monophyletic (clade O: 100%, 1.0, 100%), followed by supersection Bryonioides, also well supported as monophyletic (clade Q: 95%, 1.0, 93%). Supersection Decaloba, the largest in subgenus Decaloba, was well supported as monophyletic (clade P: 100%, 1.0, 92%). The BI tree was similar to the ML tree with respect to relationships within supersection Decaloba, though with less resolution overall; the MP topology was much less resolved and had several polytomies. The ML tree for supersection Decaloba indicated that two main clades, designated as clades S and W, were strongly supported as monophyletic (clade S: 93%, 1.0, 83%; clade W: 100%, 1.0, 99%). Within clade S, the first clade to diverge consisted of P. lutea L., P. filipes Benth., and P. pavonis Mast., and was weakly supported (ML BS = 56%, BPP = 1.0); this clade was unresolved at the base of clade S in the MP analysis. Passiflora tenella Killip was weakly supported as sister to the remainder of clade S (ML BS = 54%, BPP = 1.0) but was also unresolved at the base of the clade in the MP analysis. Section Xerogona (clade T: 80%, 1.0; 58%) and clade U (71%, 1.0, 99%) were both moderately supported as monophyletic. Clade V, which consists of P. berteroana Balb. ex DC. and relatives, was strongly supported as monophyletic (100%, 1.0, 99%). In the ML topology, P. tricuspis Mast., P. urnifolia Rusby, and P. misera Kunth formed a weakly supported basal grade within clade W, but this arrangement was not supported in the BI or MP analyses. The remaining relationships within clade W were not well resolved or strongly supported. The ML and BI analyses provided moderate support for clade X (75%, 1.0, MP unresolved) and Y (62%, 1.0, <50%) as monophyletic lineages. Discussion The study presented here represents the largest investigation into evolutionary relationships within Passiflora to date, KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA 697 Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] Fig. 1. Overview of relationships in Passiflora based on the combined nrITS, ncpGS, trnL-F, and ndhF dataset. Subgenera and supersections are lettered following descriptions in text; numbers of species per clade indicated within each triangle (p. p. = pro parte; supersect. = supersection); * indicates supersection Multiflora minus P. multiflora. Image of flower for species typical of each lineage shown to the right of each clade. Photos labeled from left to right, top to bottom, listed with species and photo credit: P. arbelaezii (R. Boender); P. arborea (L. Escobar); P. deidamioides (L. Gilbert); P. incarnata (E. Leiter); P. aurantioides (A. Ford); P. microstipula (J. MacDougal); P. quetzal (J. MacDougal); P. cochinchinensis (S. Krosnick); P. rufa (R. Boender); P. sexocellata (A. Hernández); P. pterocarpa (A. MacVean); P. cisnana (R. Boender); P. sp. (A. Hernández). SYSTEMATIC BOTANY [Volume 38 Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 698 Fig. 2. Phylogenetic relationships in Passiflora based on the combined nrITS, ncpGS, trnL-F, and ndhF dataset: clades A-M. Maximum likelihood topology shown with maximum likelihood bootstrap values (³ 50%) above branch; under branch, Bayesian inference posterior probabilities (³ 0.50) to the left, and parsimony jackknife values (³ 50%) to the right (* = 100% ML BS, BPP, or MP JK support; – = < 50% ML BS, BPP, or MP JK support). Subgenera and supersections indicated to the right of the terminals (supersect. = supersection). See text for full explanation of each lettered clade. KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA 699 Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] Fig. 3. Phylogenetic relationships in Passiflora subgenus Decaloba based on the combined nrITS, ncpGS, trnL-F, and ndhF dataset: clades N–Y. Maximum likelihood topology shown with maximum likelihood bootstrap values (³ 50%) above branch; under branch, Bayesian inference posterior probabilities (³ 0.50) to the left, and parsimony jackknife values (³ 50%) to the right (* = 100% ML BS, BPP, or MP JK support; – = < 50% ML BS, BPP, or MP JK support). Supersections and sections indicated to the right of the terminals (supersect. = supersection). See text for full explanation of each lettered clade. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 700 SYSTEMATIC BOTANY with 139 species of Passiflora included. It is also the first study to focus on resolving the placement of subgenera Deidamioides and Tetrapathea relative to subgenus Decaloba, as well as on relationships within subgenus Decaloba. Compared to earlier studies, data for the most commonly used molecular markers in Passiflora (nrITS, trnL-F, and ncpGS) is expanded by 30–80 species per locus; the ndhF dataset is entirely new. This expanded matrix (i.e. both taxa and characters) has allowed for a more comprehensive analysis of relationships in subgenus Decaloba and allied subgenera, providing a new framework for examination of morphological character transformations. Phylogenetic Utility of Molecular Markers—NUCLEAR LOCI— nrITS has been one of the primary sources of data for reconstructing relationships in Passifloraceae (Muschner et al. 2003; Krosnick and Freudenstein 2005; Hearn 2006). However, the problem of intra-individual variation in nrITS sequences has been well documented both in Passiflora (Porter-Utley 2003; Hansen 2004; Mader et al. 2010) and in other vascular plant genera (Alvarez and Wendel 2003; Bailey et al. 2003). The problem of non-concerted evolution of nrITS copies in Passiflora appears to be most problematic in cases of hybridization and/or polyploidization (PorterUtley 2003; Hansen 2004). Passiflora is characterized by significant differences in genome size across the subgenera. For example, Yotoko et al. (2011) showed that subgenus Passiflora has a genome approximately three times larger than the average sized genome in subgenus Decaloba. The genus displays substantial variation in chromosome number as well. Subgenus Passiflora is generally n = 9 (meiotic chromosome count), but may be n = 10 or 11 in a few species, whereas subgenus Astrophea is n = 12 (Hansen et al. 2006). Subgenus Deidamioides section Tryphostemmatoides is known from one count of 2n = 22 (mitotic chromosome count; J. MacDougal, unpubl. data), and subgenus Tetrapathea is n = 12 (Hair and Beuzenberg 1959). Subgenus Decaloba is generally n = 6, though one count in a basal lineage is n = 9 (Snow and MacDougal 1993). Polyploidy has been documented in subgenus Decaloba supersection Cieca, supersection Bryonioides, and supersection Decaloba (Snow and MacDougal 1993; de Melo et al. 2001; Hansen et al. 2006), and also in subgenus Passiflora (Hansen 2004). For a large taxon sample such as that included here, it is not practical to clone nrITS amplicons for each taxon to ensure that all unique copies have been identified. To account for the possibility of non-concerted evolution among nrITS copies owing to polyploidy in Passiflora, known polyploid taxa were eliminated from the analysis if sequence contigs displayed frequent nucleotide polymorphisms or regions of significant disagreement. Following these criteria, nrITS data were omitted for two taxa (P. suberosa ssp. suberosa and P. suberosa ssp. litoralis). These accessions were removed from the analysis and prioritized for cloning. Proceeding cautiously in this way, the nrITS dataset proved to be a valuable source of phylogenetic signal for the current analysis, with 56% phylogenetically informative characters. While the use of nrITS as a molecular marker in Passiflora carries some risk, it also has the advantage that a great deal of sequence data already exists for this locus. If the acquisition and use of nrITS data is done cautiously (i.e. excluding known polyploids and/or hybrids), and sequences are carefully screened for polymorphisms or other indication of presence of multiple copies, nrITS data should continue [Volume 38 to serve as a valuable tool for phylogenetic reconstruction in Passiflora. Yockteng and Nadot (2004a) first used the chloroplastexpressed copy of glutamine synthetase (Emshwiller and Doyle 1999; Doyle et al. 2003) for phylogenetic reconstruction within Passiflora. In that initial study, ncpGS provided 40% parsimony informative characters. The high proportion of parsimony informative characters, coupled with the fact that it is apparently a single copy nuclear gene, strongly support the use of ncpGS for reconstruction of phylogenetic relationships within Passiflora. It is also straightforward to align across outgroup genera as well as within Passiflora itself, with discrete gaps that could be useful as indel characters, though that was not explored in the current analysis. In Yockteng and Nadot’s (2004a) analysis, data from this gene provided the strongest signal at the subgeneric and supersectional levels rather than among the terminals. In the current analysis, the ncpGS data matrix provided 38% informative characters with most variation among supersections in subgenus Decaloba. A few taxa were resolved in unexpected positions by the ncpGS dataset; these are hypothesized to be due to shorter sequence lengths caused by differences in primer location and/or large gap regions. Any taxa with unexpected placements were selected for future cloning to further characterize these sequences (e.g. presence of multiple copies or evidence of hybridization). CHLOROPLAST LOCI—The use of chloroplast markers is complex in Passiflora because the mode of inheritance of the chloroplast may be maternal, paternal, or biparental (Muschner et al. 2006; Hansen et al. 2007). The three modes of inheritance have the potential to complicate interpretation of phylogenetic relationships in Passiflora by yielding intraindividual variation or heteroplasmy that may or may not stem from hybridization events. Hansen et al. (2007) cited several examples of Passiflora species resolved in unexpected phylogenetic positions in prior analyses due to suspected heteroplasmy, and noted that these cases are most easily detected when the placement of the specific taxon is in direct conflict with morphology. Thus, similar to the use of nrITS data, chloroplast loci must be used cautiously as phylogenetic markers in Passiflora. This is the first study to use ndhF as a phylogenetic marker for reconstructing relationships in Passiflora. This marker was chosen due to its relatively high rate of evolution compared to other chloroplast regions (Olmstead and Reeves 1995; Scotland et al. 1995; Kim and Jansen 1995; Wurdack and Davis 2009). The region is quite variable and generally straightforward to align with single nucleotide substitutions being the primary source of parsimony informative characters. The ndhF alignment yielded 31% parsimony informative characters and provided substantial resolution at the level of outgroup genera and subgenera within Passiflora (Supplemental Fig. 2A). However, two of the outgroup taxa, Malesherbia weberbaueri and Adenia heterophylla, were spuriously resolved within subgenus Decaloba by this gene. In addition, there were several examples of likely erroneous placements within subgenus Decaloba. For example, P. altebilobata Hemsl. (supersection Disemma, China) is resolved with “P. intricata” sp. nov. ined. (supersection Auriculata, Dominican Republic), and P. citrina J. M. MacDougal (section Xerogona, Honduras and Guatemala) is resolved within supersection Disemma (SE Asia, Austral Pacific). In addition, supersection Cieca is not supported as monophyletic by the Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA ndhF data, while all other single-locus topologies examined here do support the monophyly of this group. These results are unexpected based on resolution provided by other markers and morphology but are well supported with jackknife values of > 70% in the single-locus MP analysis of ndhF. These results were most likely due to missing data; alternatively, these apparent anomalies may reflect true cases of heteroplasmy or a paralogous copy of the region that was selectively amplified. Taxa placed unexpectedly were prioritized for cloning of ndhF amplicons to investigate the cause of their erroneous placement. Controlled pollinations to determine the mode of plastid inheritance would be extremely interesting for these taxa. Because relationships resolved by the ndhF region are overall congruent with relationships established based on other data at deeper nodes in the genus, the marker will still be valuable for phylogenetic reconstruction in Passiflora if used in concert with additional sources of data. The chloroplast region trnL-F was first utilized for phylogenetic reconstruction in Passiflora by Muschner at al. (2003), and later by Krosnick and Freudenstein (2005) and Krosnick et al. (2006). In the current analysis, the trnL-F dataset included 27% parsimony informative characters, yet the strict consensus was generally unresolved. The trnL-F data appear to be most valuable in reconstructing relationships at the level of outgroup genera. Passiflora is largely unresolved in the strict consensus (Supplemental Fig. 2B), with the exceptions of subgenus Astrophea, parts of subgenus Deidamioides, and some isolated terminal clades in subgenus Decaloba and subgenus Tetrapathea. COMBINED MOLECULAR DATA—While the individual datasets provide resolution and support at varying taxonomic levels across the genus, none satisfactorily resolves relationships simultaneously at all levels within the tree. It is important to investigate the individual datasets, but a combined approach allows signal to interact among datasets, often resulting in new topologies (Kluge 1989; Nixon and Carpenter 1996). Gatesy et al. (1999) suggested that hidden signal could be quantified by looking at the differences between branch support for a particular clade in the individual analysis and support for the same clade in the combined analysis. The individual analyses of the molecular nrITS, ncpGS, ndhF, and trnL-F datasets each produced more than 100,000 MP trees, whereas the combined dataset produced 47,032 MP trees. This suggests that the total signal present in the combined analysis is strong enough to eliminate many of the alternative topologies present in the single locus analyses. In general, the combined molecular analysis had higher jackknife values for identically resolved clades than did the individual partitions. For example, the nrITS dataset, which provided the greatest support and resolution for relationships at all levels across the phylogeny, resolves subgenus Decaloba as monophyletic with 83% jackknife support whereas in the combined analysis, this same clade has 99% jackknife support (Fig. 2, clade F). Support for Astrophea + Deidamioides from the nrITS dataset (81%) increases to 99% in the combined analysis, and support for subgenus Tetrapathea as sister to subgenus Decaloba increases from 83% (nrITS alone) to 98% in the combined analysis. In several cases, strict consensus of the individual datasets provided no resolution or weak support for placement of individual species, whereas these same species were resolved with strong support in the combined analysis. For example, 701 the combined nuclear dataset (nrITS and ncpGS; Supplemental Fig. 1C) shows no resolution of relationships among outgroup genera, whereas these same taxa are fully resolved with strong jackknife support in the combined analysis (Figs. 2, 3). The increase in jackknife support and resolution suggests that hidden signal within the individual datasets is combining to produce a strongly-supported phylogeny when all four loci are analyzed together. The combined dataset is robust to the three different analyses methods used (MP, ML, and BI). Of the three, the MP tree is the least resolved with respect to the backbone of subgenus Decaloba, while the BI and ML trees have much greater levels of resolution, much of it with strong support. Phylogenetic Relationships Among Outgroup Genera— The placement of Malesherbia and Turnera has varied across phylogenetic studies. In some studies, they are sister groups (Chase et al. 2000; Chase et al. 2002; Sosa et al. 2003), whereas in others, Malesherbiaceae is sister to Passifloraceae + Turneraceae (Davis et al. 2005; Korotkova et al. 2009; Tokuoka 2012). In addition, the APG III classification recognizes Malesherbiaceae and Turneraceae as part of Passifloraceae s.l. (Bremer et al. 2009). Although Malesherbia was designated as the outgroup in the present analysis, confident resolution of the relationships of Malesherbiaceae and Turneraceae to Passifloraceae will require much greater sampling. Within Passifloraceae, two tribes are recognized: Passifloreae and Paropsieae (De Wilde 1971, 1974; Feuillet and MacDougal 2007). Paropsia belongs to tribe Paropsieae, while Adenia, Basananthe and Passiflora belong to Passifloreae. Relationships among the 17 genera currently recognized (Feuillet and MacDougal 2007) in Passifloraceae have been poorly understood. However, Tokuoka (2012) provides the densest sampling to date for Passifloraceae s.s., with 15 genera represented. In that analysis, Paropsia is resolved as sister to a larger clade containing Basananthe, Passiflora and Adenia. In the current study, Basananthe and Paropsia are weakly supported as sisters in the ML and BI topologies, but are resolved as a basal grade with Paropsia below Basananthe in the MP tree. In Tokuoka (2012), Adenia is resolved as sister to a clade containing Passiflora, Basananthe and several additional genera. In the present study, Adenia is strongly supported as sister to Passiflora. The ML topology does not support the monophyly of tribes Paropsieae and Passifloreae, as Basananthe (Passifloreae) is resolved as sister to Paropsia (Paropsieae). As the limited generic-level sampling in Passifloraceae was primarily used to test the monophyly of Passiflora, it is not possible to confidently resolve the positions of subfamilies and genera relative to one another in the present analysis. The Genus Passiflora—With a taxon sample that included 139 species representing all recognized subgenera, the MP, ML, and BI topologies strongly support monophyly of the genus. Characteristics that unite the genus as a whole may include the liana habit, chromosome number of n = 12, plants nearly glabrous, presence of two prophylls on the vegetative bud, small stipules, two petiolar nectaries, laminar nectaries none or marginal, presence of a primary peduncle (sensu Krosnick and Freudenstein 2005) with two small and unrecaulesced floral bracts, subequal calyx and corolla, reticulate seed coat, and mammal dispersal of seed from large fragrant fruits. Passiflora Subgenus Astrophea Sister to Subgenus Deidamioides Section Tryphostemmatoides—Passiflora subgenus Astrophea (Fig. 2 Clade A) consists of 60 species of Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 702 SYSTEMATIC BOTANY woody or shrubby lianas, shrubs, and small to medium trees endemic to South America with chromosome counts of n = 12 or 2n = 24 (Berry 1987; De Melo et al. 2001). Some tree species in Astrophea have higher order branching, a synapomorphy for tribe Passifloreae (De Wilde 1971). In the current analysis, subgenus Astrophea is supported as monophyletic. Subgenus Astrophea + subgenus Deidamioides section Tryphostemmatoides is strongly supported as a monophyletic lineage and is resolved as sister to the remainder of the genus. Yockteng and Nadot (2004a) also found a similar result in their analysis, with P. tryphostemmatoides sister to subgenus Astrophea. These results are not unexpected as the monophyly of subgenus Deidamioides has been in doubt for some time (Ulmer and MacDougal 2004). However, plants in clade A are extremely divergent with respect to morphology: whereas Astrophea are lianas with unbranched tendrils or small–medium trees without tendrils, species in section Tryphostemmatoides have branched tendrils with terminal adhesive disks and are generally slender climbers with small leaves. Only one chromosome count has been made within clade A (section Tryphostemmatoides: P. aff. gracillima, 2n = 22, MacDougal 4752GR; J. MacDougal, unpubl. data). Shared morphological characteristics for clade A may include scarlike sessile petiolar nectaries at the blade base, absent or reduced pubescence, retention of the primary peduncle, coronal filaments in 2–3 series, and outer coronal filaments mostly yellow in color. Subgenus Passiflora Sister to Subgenus Deidamioides Sections Polyanthea, Deidamioides, and Tetrastylis—Subgenus Passiflora (Fig. 2 Clades B, C) is strongly supported as monophyletic in the current analysis, with potential synapomorphies including loss of the primary peduncle, presence of large stipules, bracts, and flowers, and recaulescence of floral bracts resulting in three bracts per pedicel. Subgenus Deidamioides appears again in clade B, this time as a wellsupported lineage consisting of three sections (Polyanthea, Deidamioides, and Tetrastylis). Section Polyanthea is monotypic (P. cirrhiflora), as is section Deidamioides (P. deidamioides). Section Tetrastylis contains two species, P. ovalis and P. contracta Vitta. The three species sampled in the current analysis are extremely divergent from one another morphologically, and have therefore been difficult to place with confidence. In Muschner et al. (2003), only Passiflora ovalis was included and it was resolved as sister to subgenus Passiflora. Yockteng and Nadot (2004a) included only P. cirrhiflora, which was resolved as sister to the rest of Passiflora with moderate support. Hansen et al. (2006) included all three species, and found that P. ovalis, P. cirrhiflora, and P. deidamioides together were monophyletic with moderate bootstrap support. Within clade B, Passiflora cirrhiflora is moderately supported as sister to P. deidamioides in both the ML and BI analyses presented here. Both species are completely glabrous, and interestingly, these two species have pedunculate simple cymes ending in a tendril and a plicate operculum (C. Feuillet, pers. comm.); they also have compound leaves, a rare condition in the genus as a whole. Compound leaves are also observed in a few species in subgenus Passiflora and in one species in subgenus Decaloba. Clade B, which contains P. ovalis, P. cirrhiflora, and P. deidamioides, is moderately supported as sister to subgenus Passiflora. This differs from the placement of the same clade in Hansen et al. (2006) where these species were resolved as sister to subgenus Decaloba. Passiflora ovalis and the closely allied P. contracta [Volume 38 (not sampled here) have both evolved bat pollination syndromes (Jørgensen et al. 2012); pollinators for the others in clade B are unknown. Synapomorphies that unite P. cirrhiflora, P. ovalis, and P. deidamioides with subgenus Passiflora may include the loss of higher order branching in the inflorescence, and the presence of a well-developed corona in five or more series (corona reduced in P. ovalis). The base chromosome number for subgenus Passiflora is n = 9 (Snow and MacDougal 1993), but no chromosome counts are available for any of the species in clade B. Obtaining chromosome counts for the four species in sections Polyanthea, Deidamioides, and Tetrastylis may further clarify our understanding of relationships among these highly divergent taxa. The phylogeny presented here suggests that hummingbird pollination evolved multiple times in clade C, and bat pollination at least twice. Much greater sampling in subgenus Passiflora would be required to document these patterns completely. Subgenus Tetrapathea Sister to Subgenus Decaloba—The combined molecular dataset (Fig. 2 Clades D, E) strongly supports placement of OW subgenus Tetrapathea sister to subgenus Decaloba (clade D). Subgenus Tetrapathea comprises three species (P. kuranda, P. aurantioides, and P. tetrandra) from Australia, Papua New Guinea, and New Zealand. This subgenus is readily distinguished from subgenus Decaloba as the three species are dioecious canopy lianas that lack a plicate operculum (instead, the operculum has vertical striations). The chromosome number for this subgenus (n = 12) is known from a single count of P. tetrandra (Hair and Beuzenberg 1959). Supersection Disemma (subgenus Decaloba, Fig. 2 clade K) is the only other OW clade in Passiflora. Clade D thus contains both of the OW lineages in the genus, but these two groups are only distantly related. This same result was obtained by Krosnick and Freudenstein (2005), who included P. kuranda and P. tetrandra as well as nine species from supersection Disemma in a preliminary analysis focused on testing the monophyly of supersection Disemma. It appears that two separate dispersals to the OW have occurred within Passiflora: one that resulted in subgenus Tetrapathea in the Austral-Pacific and a second event that resulted in supersection Disemma in Indochina, Southeast Asia, and the Austral-Pacific. Clade D also includes species with higher order branching within their inflorescences. Compound cymes are common in the Passifloraceae, but are relatively rare in Passiflora: some tree species in subgenus Astrophea (clade A) have branched inflorescences, but this character is not observed in clade C (subgenus Passiflora + subgenus Deidamioides sections Tetrastylis, Deidamioides, and Polyanthea). Higher order branching is again observed in subgenus Tetrapathea, and is then absent in other lineages of subgenus Decaloba, implying multiple gains or losses of this character. Clade D is also marked by reduction of coronal filaments from four or more series to just two or three: subgenus Tetrapathea has two series as do most members of subgenus Decaloba. However, the basally branching supersections Pterosperma and Hahniopathanthus have 3 – 10 series, as do a small number of species nested elsewhere in the subgenus. Subgenus Tetrapathea (clade E) is resolved as monophyletic in the ML and BI analyses, though support is low. In the MP analysis, the individual trees show two alternative resolutions for these plants, one as depicted in Fig. 2, the other indicating a non-monophyletic subgenus Tetrapathea with Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA P. kuranda + P. aurantioides basal to P. tetrandra, which is in turn sister to the remainder of subgenus Decaloba. These alternative resolutions result in a trichotomy in the MP strict consensus (i.e. P. kuranda + P. aurantioides, P. tetrandra, remainder of subgenus Decaloba). When included as the lone representative of subgenus Tetrapathea, P. tetrandra has been similarly unstable in recent analyses: Yockteng and Nadot (2004a) found that this species was resolved within subgenus Decaloba, Hearn (2006) showed P. tetrandra as unresolved at the base of a clade containing subgenera Astrophea, Deidamioides, and Decaloba, and Hansen et al. (2006) showed that BI analyses supported P. tetrandra as sister to the genus Dilkea Mast. The fact that the ML and BI analyses resolve subgenus Tetrapathea as monophyletic in the current analysis, while the MP analysis does not, may indicate that P. tetrandra behaves as a long branch due to many autapomorphies, thus reducing support for monophyly of the clade. Two reproductive characteristics support monophyly of subgenus Tetrapathea. First, the three species in subgenus Tetrapathea are all dioecious. Dioecy is observed in Passifloraceae outside of Passiflora (e.g. Adenia), but is rare within the genus. While some Passiflora species may be functionally andromonoecious (MacDougal 1994), subgenus Tetrapathea is the only clade to display dioecy. Green (1972) hypothesized that isolation of P. tetrandra facilitated the evolution of dioecy in this species, as the condition is relatively common in New Zealand endemics. Interestingly, P. tetrandra, P. aurantioides and P. kuranda display varying levels of dioecy (Krosnick et al. 2009). In P. tetrandra, male flowers have only rudimentary carpels and female flowers have aborted stamens. In P. aurantioides, both stamens and carpels are present, though these organs are more or less exaggerated depending on the sex of the plant. However, P. kuranda is functionally dioecious such that sex can only be determined by performing crosses and observing if fruit is produced. The second synapomorphy shared by these three species is variability in carpel number. Though this phenomenon is extremely rare in angiosperms (Endress 1994; Endress and Igersheim 1997; Krosnick et al. 2006), all three of these species show variation in carpel number among individual plants (P. tetrandra: 2–4 carpels; P. aurantioides: 3–5; P. kuranda: 5–8). Subgenus Decaloba (Clade F)—The monophyly of subgenus Decaloba has been supported in recent analyses (Muschner et al. 2003; Yockteng and Nadot 2004a; Hansen et al. 2006) and is strongly supported here. Subgenus Decaloba is supported by a number of synapomorphies, including variegation in juvenile leaves, presence of a plicate membranous floral operculum, reduction of the corona to just two to three series (rarely more, then considered secondarily derived). Many species have multiple bands of red, purple, or violet on the corona. The chromosome number for this clade is normally n = 6, but n = 9 has also been reported (Snow and MacDougal 1993; Hansen et al. 2006). The lower count appears to be a synapomorphy for a large sublineage within the subgenus (see discussion of n = 6 group below). Interestingly, the current analysis places the poorly known P. obovata Killip in subgenus Decaloba. Passiflora obovata is a large liana from Mexico and Central America that Feuillet and MacDougal (2003) placed in subgenus Deidamioides. The phylogenetic position of this species was first examined by Krosnick (2006), who obtained results similar to those obtained here. 703 Supersection Pterosperma (Clade G)—Supersection Pterosperma is well supported as monophyletic in the current analysis, and is the most basally branching lineage within subgenus Decaloba. This placement is similar to results obtained in previous analyses (Muschner et al. 2003; Yockteng and Nadot 2004a; Hansen et al. 2006). Earlier classifications had placed this group in subgenus Deidamioides (Feuillet and MacDougal 1999; Gilbert and MacDougal 2000), but it has since been recognized as a member of subgenus Decaloba (MacDougal and Hansen 2003). This supersection consists of four species endemic to southeastern Mexico and Central America: Passiflora lancetillensis J. M. MacDougal & Meerman, P. microstipula L. E. Gilbert & J. M. MacDougal, P. pedicellaris J. M. MacDougal, and P. eueidipabulum Knapp & Mallet (P. eueidipabulum not sampled here). These species are easily recognized by a number of morphological features, including unlobed leaves, cernuous shoot tips, multiple pairs of extrafloral nectaries along the petiole (lost in P. pedicellaris), conspicuously winged seeds, retention of a primary peduncle, and (2) 3–4 series of coronal filaments. The fruits are believed to be dispersed by bats (Gilbert and MacDougal 2000). Chromosome number is n = 9 from a single count of P. microstipula (Snow and MacDougal 1993). Supersection Hahniopathanthus + Passiflora obovata Sister to the Rest of Decaloba—Clade H (Fig. 2 Clades H, I) is strongly supported as monophyletic, and comprises clade I, supersection Hahniopathanthus + P. obovata (subgenus Deidamioides section Mayapathanthus), plus the remainder of subgenus Decaloba. Clade H is distinguished by the absence of the primary peduncle. Within clade I, the monophyly of supersection Hahniopathanthus itself is strongly supported by the molecular data. Species placed in supersection Hahniopathanthus have several notable morphological characters: presence of cernuous shoot tips; large, foliose stipules and floral bracts; loss or extreme reduction of one of three floral bracts on the pedicel, and absence of coronal banding. In the current analysis, P. obovata is weakly supported as sister to supersection Hahniopathanthus (clade I) by the ML and BI analyses, but is unresolved in the MP topology. Passiflora obovata is quite different from species in section Hahniopathanthus with regard to morphological characters. Krosnick (2006) found weak support for this same placement; in that study, possible long-branch attraction was investigated by removing species one by one from subgenus Pterosperma and Hahniopathanthus during phylogenetic analysis. Under all taxon inclusion schemes, P. obovata was resolved as sister to the remaining taxa in section Hahniopathanthus. In the current analysis, a second DNA isolation of P. obovata was sequenced to confirm that contamination was not the cause of this unexpected placement. Although P. obovata is quite distinct relative to subgenus Hahniopathanthus, placement of this species in subgenus Decaloba is supported by presence of a plicate operculum and two series of coronal filaments. Superficially, P. obovata is similar to species in subgenus Tetrapathea based on growth form and presence of an erect operculum. Juveniles climb by adhesive disks, as in subgenus Deidamioides section Tryphostemmatoides, but tendrils are not branched in P. obovata. However, this species does share some notable features with supersection Hahniopathanthus, including absence of the primary peduncle and presence of marginal laminar nectaries. Juvenile leaves are peltate, as are the leaves in most species of Hahniopathanthus. The chromosome number Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 704 SYSTEMATIC BOTANY for supersection Hahniopathanthus was noted as n = 11 or 12 based on an ambiguous count by MacDougal (Hansen et al. 2006). No counts are available for P. obovata, but focusing on this species and those in supersection Hahniopathanthus for future cytological studies may help to clarify relationships in this clade. The n = 6 Group—The remaining six supersections of subgenus Decaloba (Fig. 2 Clade J) are resolved within clade J. These taxa share a number of morphological similarities, including reduction of vegetative prophylls from two to one, submarginal or abaxial laminar nectaries, small purple-black fruits, small seeds, conspicuous pubescence, reduction of the corona to two rows with the inner row much shorter than the outer row, and reduction in habit from forest lianas to small vines and climbers at forest edges. Seeds are often dispersed by birds. Most notably, however, this clade is distinguished by having a chromosome number of n = 6, indicating a major historical shift in the chromosomal makeup of these species relative to the rest of the genus. Recent molecular work has begun to confirm differences in genetic makeup of the n = 6 clade relative to the rest of Passiflora. For example, Yockteng and Nadot (2004b) found that a cytosolic-expressed copy of glutamine synthetase (cytGS) was preferentially amplified in the n = 6 members of subgenus Decaloba, while in the rest of the genus, the same primers amplified the chloroplast-expressed copy (ncpGS). Repeated attempts to amplify cytGS in the remainder of subgenus Decaloba (supersections Pterosperma and Hahniopathanthus) and subgenera Tetrapathea, Deidamioides, Astrophea and Passiflora have been unsuccessful, suggesting that the cytGS copy may be absent outside of the n = 6 lineage (K. PorterUtley and S. Krosnick, unpubl. data). Similarly, a single copy of CRABS CLAW (CRC) is present in species of the n = 6 group that have been sequenced to date, whereas multiple copies have been detected outside of this clade (Krosnick, in prep.). These data, while preliminary, suggest that a significant rearrangement or reduction of genetic information has occurred in this lineage. Passiflora multiflora Sister to Supersection Disemma)— Within the n = 6 group (Fig. 2 Clade K, a clade containing P. multiflora + supersection Disemma is well supported as sister to the remainder of the lineage. The placement of P. multiflora + supersection Disemma suggests a New World origin for the n = 6 group (clade J), followed by a biogeographic event that led to the OW supersection Disemma. Passiflora multiflora is native to southernmost Florida and the Caribbean, and supersections Pterosperma and Hahniopathanthus are all endemic to Central America. Recent age estimates for the emergence of Passifloraceae s. s. range from ca. 71– 65 MYA (Davis et al. 2005; Hearn 2006) to 37 MYA (based on the age of Malesherbiaceae; Gengler-Nowak 2002), whereas Passiflora itself appeared ca. 40 MYA (Hearn 2006). Several unconfirmed Passiflora fossils have been described from the Eocene and Miocene in Eastern Europe (Rásky 1960; Mai 1967; Gregor 1982), and Mexico (Graham 1976). Recently, an unambiguous fossil seed of Passiflora from the Miocene was discovered in Panama (M. Carvalho pers. comm.). While an explicit examination of biogeographical relationships in Passiflora was not conducted as part of this study, given that two serial lineages of Passiflora (Fig. 2 clades A, C) are NW, as are Malesherbiaceae, it is most parsimonious to posit a NW ancestor for the genus and clades within it until clades E (subgenus Tetrapathea) and K (subgenus Decaloba [Volume 38 supersection Disemma) which, as described above, are distributed throughout Indochina, Southeast Asia and the Austral Pacific. Taking the age estimates for Passifloraceae and Passiflora into account, it is possible that the ancestors of clades E and K arrived in the Old World by any of three possible mechanisms: 1) species may have moved from Central/South America to Asia/Austral Pacific via the North Atlantic Land Bridge during the Eocene/Oligocene (Boreotropics hypothesis: McKenna 1972; Wolfe 1975; Tiffney 1985; Lavin and Luckow 1993); 2) more recently via the Bering Land Bridge during the Pleistocene (Beringian hypothesis: Colinvaux 1981; Hopkins et al. 1981; Sher 1999; Waltari et al. 2007), or 3) via long-distance dispersal of seeds, given that most Passiflora are animal dispersed (Ulmer and MacDougal 2004). However, without strong fossil evidence, discerning among these possible hypotheses with confidence will be difficult. Supersection Disemma consists of 21 species from China, India, Southeast Asia, Australia, and Papua New Guinea. The phylogenetic affinities of this group have long been debated because of the unique morphological features they display. The group is divided into three sections: Disemma, Octandranthus, and Hollrungiella. While limited synapomorphies are apparent at the sectional level and below, the supersection has no clear unifying features due to the high level of morphological diversity observed even among closely related species. Krosnick and Freudenstein (2005) confirmed the monophyly of the group with limited taxon sampling; in that study, NW P. multiflora was resolved as sister to Disemma. With full sampling of all 21 species and much expanded outgroup sampling, Krosnick (2006) also confirmed the monophyly of Disemma, but parsimony analyses could not resolve the position of this clade relative to the rest of subgenus Decaloba. In Krosnick (2006), P. multiflora was resolved as sister to P. holosericea instead of Disemma. The current analysis shows strong support for monophyly of Disemma but somewhat weaker support for placement of P. multiflora as sister to Disemma (clade K). It is notable that the MP analysis does support P. multiflora as sister to Disemma (75% jackknife support), but does not provide resolution for the position of any supersections distal to supersection Pterosperma. Morphological features shared by P. multiflora and supersection Disemma are difficult to identify because of the lack of apparent synapomorphies in supersection Disemma as a whole. Passiflora multiflora is unusual in that it has highly branched inflorescences, a feature that is characteristic of supersection Disemma section Octandranthus, but this trait also occurs elsewhere in the n = 6 group. Within supersection Disemma, section Disemma (three species, Australia) is strongly supported as monophyletic and is resolved as sister to the remainder of the supersection. All three species in this clade have tube-shaped flowers with a 5-lobed nectar chamber, an erect operculum, sepals with a keel, and lack a limen at the base of the androgynophore. Interestingly, the ML and BI analyses presented here resolve monotypic section Hollrungiella (P. hollrungii) as sister to the Asian section Octandranthus, whereas the MP analysis leaves this species unresolved at the base of supersection Disemma. This species is endemic to Papua New Guinea and has a number of features in common with the Australian species, such as the five-lobed nectar chamber, tube-shaped flower, larger fruits that are green at maturity, and absence of a limen at the base of the androgynophore. However, this Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA species also has some characteristics in common with Octandranthus, notably an incurved operculum and smooth, unkeeled sepals. Section Octandranthus (17 species, Indochina and SE Asia) is strongly supported as monophyletic in the combined analysis. Species in this clade have truncated midveins, extensively branched inflorescences, and a widened operculum, with reversals of these characters in some species. Single Loss of rpoC1 Intron—Although weakly supported in the current analysis (Figs. 2, 3 Clade L), an interesting synapomorphy uniting clade L is loss of the rpoC1 intron, first noted by Hansen et al. (2006) as a potentially informative phylogenetic marker for relationships in subgenus Decaloba. In their analysis, the intron was shown to be present in supersections Multiflora, Auriculata, Disemma, Pterosperma, and Hahniopathanthus, and lost in the remainder of the subgenus. However, the topology obtained from their analysis of the trnL/trnT spacer region indicated that it was most parsimonious to hypothesize multiple losses across the subgenus, suggesting that the intron might be too evolutionarily vagile to be useful as a phylogenetic marker. In contrast, the topology obtained in the present analysis supports a single loss of the rpoC1 intron, an event that distinguishes clade L from the rest of the subgenus. Notably, this character is also congruent with phylogenetic results presented here that show supersection Multiflora sensu Feuillet and MacDougal (2003) is not monophyletic: whereas P. multiflora has the intron, the remaining species in the supersection (here placed within clade M, see below) do not. The loss of the rpoC1intron also supports the basal position of supersections Pterosperma, Hahniopathanthus, and Disemma, which retain the intron, relative to the rest of the subgenus. Supersection Auriculata and Former Supersection Multiflora are Paraphyletic (Clade M)—Supersection Auriculata, as circumscribed by Feuillet and MacDougal (2003), consists of eight species distinguished by presence of a single pair of auriculate petiolar nectaries, laminar nectaries that are neither strictly submarginal nor in lines between the primary veins, a short androgynophore, and reduced petals. In contrast, supersection Multiflora, as circumscribed by Feuillet and MacDougal (2003), includes 22 species with combinations of apomorphic and plesiomorphic characteristics that make their placement challenging. For example, some species display higher order branching within the inflorescences (primitive for tribe Passifloreae) whereas others have abaxial nectaries scattered in diffuse lines between the primary veins (advanced within Passiflora). Not surprisingly, the monophyly of supersection Multiflora has been questioned for several years (Ulmer and MacDougal 2004; Krosnick and Freudenstein 2005). As noted earlier, Passiflora multiflora, the type of supersection Multiflora, is shown in this and other recent analyses (Muschner et al. 2003; Krosnick and Freudenstein 2005; Hansen et al. 2006) to be unrelated to the remainder of the supersection. Moreover, the remaining species in supersection Multiflora are paraphyletic with respect to supersection Auriculata (clade M). To avoid confusion, supersection Multiflora (exclusive of P. multiflora) + supersection Auriculata will be referred to as clade M for the remainder of the discussion. Within clade M, two lineages are consistent with informal groups proposed previously: the lobbii group (Skrabal et al. 2001; Jørgensen and Weigend 2004) and the apoda group (MacDougal and Hernández 2014). Interestingly, while these groups were placed in supersection Multiflora by Feuillet and 705 MacDougal (2003), some species in the lobbii and apoda groups have auriculate leaf glands or unusually short androgynophores, features associated with supersection Auriculata. The ML and BI analyses agree with regard to relationships within clade M, but the MP topology places P. holosericea as unresolved at the base of the n = 6 clade. Passiflora truncata Regel, a poorly understood species with similarities to several supersections in subgenus Decaloba, is well supported as part of clade M where its closest relative is “P. intricata,” an undescribed species from the Dominican Republic with leaves similar to P. auriculata. Muschner et al. (2003) found a similar result, with P. truncata resolved as sister to P. rufa Feuillet & J. M. MacDougal, a species closely related to P. auriculata. Nearly all species in clade M are South American, and it appears that two distinct radiations within this clade occurred in the Andes (lobbii group and apoda group), with additional lowland species (auriculata and relatives). Morphological similarities for clade M include absence of leaf variegation and presence of straight shoot tip growth. Passiflora sierrae L. K. Escobar, the one species in Escobar’s monotypic subgenus Porphyropathanthus, was not sampled in this study for lack of available material. It is somewhat morphologically similar to species in clade M, and future study might place it here. Greater sampling will be necessary to unravel the detailed relationships among the species in clade M, but it is clear that taxonomic revision will be required. Supersections Cieca Through Decaloba—The next branch resolved in the MP and BI analyses (clade N) consists of three supersections: Cieca (clade O, 19 species), Bryonioides (clade Q, 22 species) and Decaloba (clade R, ca. 130 species). The monophyly of this large clade (Fig. 3 Clades N–R) is well supported in the BI analysis, but only weakly so in the ML topology. Likewise, there is only strong support for relationships among the three supersections only from the BI analysis. No apparent synapomorphies are shared by these three supersections, although geographically they all exhibit species radiations across northern Central America. Within clade N, support for the monophyly of each of the three supersections is strong. Supersection Cieca (clade O) has several clear synapomorphies that unite the clade including loss of petals, peltate leaf shape in seedlings, and floral bract reduction from three to two or fewer. This clade has been examined in depth by Porter-Utley (2003, in press). The present study sampled seven of the 19 species currently recognized in the supersection. The species in this clade are distributed in the southern United States, Mexico, Central America, South America, and the Caribbean. Two species, P. suberosa L. and P. pallida L., are also naturalized in various regions of the OW. The supersection contains two problematic species complexes, P. suberosa and P. coriacea Juss. The P. suberosa complex exhibits polyploidy suggesting a history of hybridization events (Snow and MacDougal 1993; PorterUtley 2003, 2007). Clade P resolves supersection Bryonioides as sister to supersection Decaloba with strong support only from BI; no morphological synapomorphies are known for the clade. Supersection Bryonioides (clade Q) is resolved as monophyletic with the inclusion of P. gracilis J. Jacq. ex Link as the basal-most member, as suggested by MacDougal (1994). Several synapomorphies exist between P. gracilis and supersection Bryonioides: presence of an elongated fruit with irregular dehiscence, bright orange arils, one to several pairs Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 706 SYSTEMATIC BOTANY of teeth at the base of the lamina, a two-ranked corona with the inner series highly reduced to absent, coronal filaments with multiple violet bands, and carinate to shortly horned sepals. However, whereas Passiflora gracilis is well supported as basal within this clade, it is quite distinct from the rest of Bryonioides in several respects: plants are annuals, flowers are apetalous with a zygomorphic gynoecium, stipules and floral bracts are highly reduced, and petiolar nectaries are somewhat reduced. Notably, P. gracilis is completely glabrous, whereas plants of the remainder of species in supersection Bryonioides have distinctive hooked trichomes (MacDougal 1994). Supersection Decaloba—The largest clade (Fig. 3 Clades R–Y) within subgenus Decaloba, supersection Decaloba (clade R), is the least well known, partly due to its wide geographical distribution, with multiple species radiations in Central America, the Caribbean, and South America. Several poorly understood species complexes exist, including the P. alnifolia Kunth and P. cuneata Willd. complexes in Colombia and Ecuador, and the P. misera Kunth complex in other parts of South America. The supersection contains two sections (Feuillet and MacDougal 2003), Xerogona (15 species) and Decaloba (ca. 115 species). The phylogenetic analysis presented here incorporates the largest sampling within the supersection to date (64 of 130 currently recognized species). Supersection Decaloba is strongly supported as monophyletic in the ML, BI, and MP analyses, and is united by several distinct morphological synapomorphies including cernuous shoot tips, loss of petiolar nectaries, laminar central vein equal to or shorter than the lateral veins, often producing a bilobed leaf, and grooved seeds with rugulose ridges. Sampling for the present study is dense enough to reveal some resolution among major lineages within the supersection. The ML, BI and MP analyses strongly support monophyly of two major lineages: section Decaloba DC. pro parte (p. p.) + section Xerogona (clade S) and the remainder of section Decaloba (clade W). The smaller of the two clades, S, contains section Decaloba p. p. with the informal sexflora group (MacDougal 1989a) and bilobata group (Killip 1938), and section Xerogona. Whereas several species radiations have occurred in South America, clade S is most diverse in Mexico, the Caribbean, and Central America. Clade S is readily distinguished by the complete absence of extrafloral nectaries on the plant. Also characteristic of this lineage is highly reduced coronal banding and, except in the subgroup represented by clade U, absence of floral bracts. A number of the species in this clade appear to have evolved traits associated with wasp pollination (MacDougal 1983, 1994). Within clade S, the ML and BI trees support a basal clade containing P. lutea, P. filipes, and P. pavonis as sister to the remaining species, though monophyly of this lineage in weakly supported. Similarities among these three species were first noted by Killip (1938), and it was named as a series by MacDougal (1995). Passiflora tenella, an annual species, is then weakly supported as sister to section Xerogona (clade T) in the ML and BI topologies. In the MP strict consensus, P. lutea, P. filipes + P. pavonis, and P. tenella are unresolved at the base of supersection Decaloba. Boza et al. (in press) formally recognize P. tenella as part of section Xerogona. That section is characterized by having only slightly cernuous shoot tips, seeds with mostly smooth ridges, a corona often reduced to a single series, and a capsular fruit. Passiflora tenella is interesting in this context because the fruits are similar in shape to [Volume 38 the rest of section Xerogona but do not dehisce and the ridges on the seeds are rugulose. Hummingbird pollination has evolved twice in section Xerogona (MacDougal 1989b), and wasp pollination has been noted in P. capsularis and P. costaricensis (J. MacDougal, pers. obs.). Sister to P. tenella + Xerogona is clade U (section Decaloba p. p.), a weakly supported lineage comprised of the informal sexflora and bilobata groups. Shared characteristics for clade U include absence of leaf variegation. Within the sexflora group, synapomorphies include presence of higher order branching within the inflorescence and large bracts. Similar to Xerogona, shoot tips in this clade are barely if at all cernuous; this trait may be a synapomorphy for Xerogona (including P. tenella) + clade U, as shoot tips of P. lutea and closely related species are more strongly cernuous. Clade V, the Caribbean bilobata group, is strongly supported in all three topologies presented, and is distinguished from the sexflora group by having small floral bracts and unbranched inflorescences. Interestingly, this clade includes P. berteroana, a poorly known species from Puerto Rico and the Dominican Republic with deeply lobed to nearly compound leaves. It is hypothesized that P. berteroana will be closely related to P. insueta Feuillet & J. M. MacDougal, a Caribbean species with similarly lobed leaves, when the latter species is sampled in future analyses. Clade W includes the remainder of taxa sampled from subgenus Decaloba in this analysis, and is strongly supported as monophyletic. This clade appears to represent a substantial species radiation, comprising ca. 94 (excluding Decaloba p. p. in clade S) of the 130 total species in the supersection as currently circumscribed. This clade exhibits high species richness in Central America, Mexico, and the Caribbean, but is most diverse in the Andes and lowland South America. This lineage is characterized by the presence of abaxial laminar nectaries arranged in a V-shaped pattern between the primary veins. These nectaries are often ocellate, and in some species appear as butterfly egg mimics (Gilbert 1982). Pollination syndromes are quite variable, with hummingbird pollination evolving at least four times, and bat pollination evolving in P. penduliflora Bertero ex DC. Several species complexes are present in South America, marked by features such as large bracts, flower color, or modifications of the corona. However, most relationships within this lineage are poorly resolved regardless of analytical approach (i.e. ML, BI, MP). Sparse taxon sampling may be partially responsible, but more sequence data may also be necessary to resolve relationships among these species. Two subclades are worthy of note within clade W because they appear in the ML, BI, and MP trees and are also distinguishable by several morphological characteristics. Clade X includes species recognized in the informal apetala group (ca. 13 species). The apetala group is distinctive in having highly reduced petals, strongly variegated leaves at maturity, and corona reduced to a single series in several species (MacDougal 2003). Wasp and bee pollination is known in this group (J. MacDougal, pers. obs.). The center of diversity for this lineage is Central America and Mexico. Passiflora bicornis Houst. ex Mill. is resolved as sister to the apetala group in the ML and BI analyses, but is unresolved at the base of clade W in the MP strict consensus. This species is quite divergent from the others in having numerous rows of coronal filaments, no conspicuous leaf variegation, and large, oily floral bracts. Passiflora lancearia Mast. is also resolved within this Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA clade, but differs markedly in floral, vegetative, and fruit and seed morphology; further investigation is needed to test this placement. Greater sampling in section Decaloba will permit testing of the placement of P. bicornis and P. lancearia. Clade Y, informally known as the murucuja group and formally recognized in the past at various ranks from genus to section (Killip 1938), consists of all the Caribbean red-flowered species and their relatives (Kay 2003). This lineage is distinguished by absence of variegation on leaves in both juveniles and adults. The group is well known for specialized floral morphology associated with hummingbird pollination syndromes. For example, Passiflora murucuja L., P. tulae Urb., and P. orbiculata Cav. have evolved a tubeshaped flower via fusion of the coronal filaments, while other species in clade Y have achieved the same shape through elongation and narrowing of the hypanthium, or floral tube. In the current analysis, P. helleri, a bee-pollinated Central American species (J. MacDougal, pers. obs.), is weakly supported as sister to the murucuja group, suggesting that the bird pollination syndromes in this clade may have evolved from a bee-pollinated ancestor. Passiflora talamancensis Killip is embedded at the middle of an exclusively hummingbird pollinated clade, though support for this placement is weak. This species has white, shallow, diurnal, cup-shaped flowers with thick yellow coronal filaments and a sweet fragrance, features often associated with insect pollination in Passiflora (Faegri and Van Der Pijl 1979; MacDougal 1994), suggesting a reversal to bee-pollination. Lability in traits associated with pollination biology has been clearly documented in this group including the emergence of bat-pollination in P. penduliflora (Kay 2001). In the present analysis, P. penduliflora is also nested within a hummingbird-pollinated clade, suggesting that switches from bee to bird or bird to bat pollination are readily achieved in this group. Lability of Morphological Character Transformations— The phylogenetic analysis presented here permits examination of patterns of character transformation across the genus toward identifying synapomorphies for both new and well established lineages. This investigation has revealed marked lability in morphological characters in Passiflora, with multiple transitions to and from characters present at almost all taxonomic levels examined. For example, higher order branching is scattered across species in subgenus Astrophea, subgenus Tetrapathea, and in subgenus Decaloba supersections Disemma, clade M, and supersection Decaloba. Floral bracts are highly variable across the genus, ranging from large to small and three to none, with the plesiomorphic condition for Passifloraceae being two small bracts per pedicel. Bracts are further reduced to zero in Passiflora lutea and relatives, Passiflora tenella, and section Xerogona. While the number of vegetative bud scales or prophylls is a character that requires better documentation across the genus as a whole, the number varies from two as the plesiomorphic condition, to one in some lineages within subgenus Passiflora, and to one in the n = 6 group of subgenus Decaloba, with rare reappearances of two prophylls in section Decaloba. Cernuous shoot tip orientation first appears in clade F (Fig. 2), is then lost in P. obovata (part of clade I) and in the n = 6 group (clade J), regained in supersection Decaloba (clade R), and reduced or partially lost again in section Xerogona (clade T) and the informal sexflora and bilobata groups (clades U and V), but is present throughout clade W. Another variable character appears to be the plication, 707 or folding, of the operculum. Nearly all species in subgenus Decaloba are characterized by the presence of a strongly plicate operculum, which interacts with the limen at the base of the androgynophore to regulate pollinator access to the nectary. However, subgenus Deidamioides section Tryphostemmatoides has also been documented as having a slightly plicate to plicate operculum (Holm-Nielsen and Jørgensen 1986). Sister clade subgenus Astrophea does not display any plication. In addition, subgenus Deidamioides sections Polyanthea and Deidamioides (clade B) display some degree of folding of the operculum in P. cirrhiflora and P. deidamioides. Again, no plication is observed in the sister clade, subgenus Passiflora. Species in subgenus Tetrapathea (clade E) have marked vertical striations along the operculum, but are not folded. Thus, it appears that operculum plication has appeared at least three times independently across the genus. This character is poorly known overall; careful examination of the operculum condition across the genus is needed. Extrafloral nectaries are one of the best examples of morphological lability in Passiflora. Subgenera Astrophea, Passiflora and Deidamioides may have petiolar and/or marginal laminar nectaries, while subgenus Tetrapathea has both petiolar nectaries and abaxial laminar nectaries that are restricted along the midvein. Some species in subgenus Passiflora have nectaries on the stipules, bracts, and/or sepals. Subgenus Decaloba is the most diverse lineage in Passiflora with respect to nectaries. Supersection Pterosperma has petiolar nectaries in multiple pairs and scattered submarginal abaxial laminar nectaries, while supersection Hahniopathanthus has marginal laminar nectaries and several species have no petiolar nectaries. A single pair of petiolar nectaries and submarginal laminar nectaries are present in supersections Disemma (clade M), Cieca (clade O), and Bryonioides (Clade Q). Lastly, the P. lutea/Xerogona/sexflora clade (clade S) within supersection Decaloba lacks extrafloral nectaries entirely, while the remainder of the supersection has a unique V-shaped arrangement of ocellate abaxial laminar nectaries and no nectaries on the petiole. Subgenus Decaloba alone provides many examples of gains and losses of notable characters. For example, leaf variegation in juvenile plant tissues first appears in subgenus Decaloba (clade F) and is present in supersections Pterosperma (clade G) and Hahniopathanthus (part of clade I). Variegation is absent in P. obovata (part of clade I), P. multiflora and parts of supersection Disemma (clade K), and clade M (supersection Auriculata + remnants of Multiflora s. lat.). Variegation is then present in most species of supersection Cieca (clade O), absent in supersection Bryonioides (clade Q), and again present in sect. Xerogona (clade T). It is absent in the sexflora and bilobata groups (clade U), lost or regained in multiple unrelated lineages in supersection Decaloba section Decaloba (clade W) and lost in the murucuja group (clade Y). The trait is fixed in adult leaves of several unrelated species in supersections Disemma and Decaloba. The variation observed in the characters outlined above undoubtedly has been influenced by the numerous ecological associations that Passiflora has with both pollinators and herbivores. Pollinators include hummingbirds, bats, bees, and wasps, with specific suites of floral characters associated with each syndrome (Ulmer and MacDougal 2004; note that field observations are lacking for most species). This analysis provides a first step toward examining the Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 708 SYSTEMATIC BOTANY evolutionary transitions between these characters across the genus. Hummingbird-pollinated species display large, solitary, diurnal, brightly colored, tube-shaped flowers with well-developed floral nectaries and little to no floral fragrance (Snow 1982; Bawa 1990; Lindberg and Olesen 2001). Across the genus, hummingbird-pollination has evolved in ca. 125 species in at least 20 lineages. Bat pollination is less common, but has been documented in eight species across the genus and only once in subgenus Decaloba (Jørgensen et al. 2012). Bee and wasp pollination appear to be the most common pollination syndromes in Passiflora (Kay 2001; Varassin et al. 2001). These flowers are typically smaller compared to hummingbird or bat-pollinated flowers, dishshaped, emit a strong floral scent, and often have brightly colored coronal filaments (MacDougal 1994; Garcia et al. 2007). While branched inflorescences are relatively infrequent in Passiflora, these flowers are typically smaller in size compared to flowers in unbranched inflorescences in related groups, and are often bee or wasp-pollinated (e.g. supersection Disemma; Krosnick 2006). In some species, branched inflorescences may be associated with mass-flowering events (Ulmer and MacDougal 2004). Pollinator interactions in Passiflora may drive floral diversification through pressures on reproductive traits; conversely, as these relationships become more specialized, they may function as constraints on further evolutionary change. Beyond pollination, species in Passiflora have diverse ecological relationships with many types of insects including Lepidoptera (e.g. tribes Heliconiini, Josiini), ants, beetles, parasitic wasps, and many other specialists and generalists. These interactions have provided some of the best examples of coevolution between plants and animals. For example, Williams and Gilbert (1981) and Gilbert (1982) documented the complex relationship between Heliconius butterflies and extrafloral nectaries (EFNs) of Passiflora. EFNs occur on floral bracts, external surfaces of sepals, leaf, stipules, and petioles, and serve two important roles in Passiflora. First, in some species (e.g. clade W of subgenus Decaloba), ocellate laminar nectaries mimic butterfly eggs and have been shown to deter gravid females from laying eggs on the plant (Williams and Gilbert 1981). Second, EFNs attract ‘bodyguards’ such as ants, predatory wasps, and parasitoids to the plants, which have been shown to reduce herbivory (Apple and Feener 2001; Hossaert-McKey et al. 2001; Wirth and Leal 2001). Another anti-herbivory defense is observed in subgenus Decaloba supersection Bryonioides, where plants have hooked-trichomes. Gilbert (1971) showed that the sturdy hooked trichomes of P. adenopoda puncture the integument of early instar Heliconius butterfly larvae, resulting in death. Reduction of host-plant use by gravid butterflies, coupled with the benefits of plant bodyguards and mechanical defenses such as hooked trichomes, likely increase plant fitness. In turn, this increased fitness drives selection for their presence, as well as for traits such as location and appearance, thus increasing morphological diversity. The examples here highlight a small number of the many plant-animal interactions that involve Passiflora. They offer insight into the selective agents that underlie the morphological diversity observed across the genus. Additional studies that document specific plant-animal interactions associated with characters of interest in Passiflora are sorely needed, and will be immensely valuable in understanding the true signif- [Volume 38 icance of these characters in an ecological as well as phylogenetic context. A New Understanding of Subgenus Decaloba—The objectives of this analysis were to elucidate the position of subgenus Decaloba relative to the rest of the genus, test the infrageneric classification of Feuillet and MacDougal (2003), and examine relationships among the supersections. The combined molecular analysis has provided new insights into the evolution of this subgenus, resulting in the identification of clades in need of revision, as well as those that require additional investigation with regard to morphological characters, chromosome evolution, and/or molecular cloning. First, it is now clear that subgenus Decaloba as currently defined is monophyletic and consists of at least 230 species, eight major lineages that can be recognized as supersections, and several additional clades that need to be formally named as sections. As a result of examining the phylogenetic position of subgenus Decaloba relative to the other four subgenera, it is clear that subgenus Deidamioides is a polyphyletic assemblage that includes at least one species (P. obovata) best placed in subgenus Decaloba. The OW subgenus Tetrapathea is sister to subgenus Decaloba, the only other lineage in Passiflora that contains OW taxa. Subgenus Tetrapathea is sister to subgenus Decaloba, yet the basal lineages in subgenus Decaloba have a NW distribution. Thus, it would seem that the biogeographical history of these clades is quite complex, with multiple diversification events in both the NW and OW. Subgenus Decaloba consists of several clades that can be readily identified by suites of morphological characters (e.g. supersections Pterosperma, Bryonioides, and Cieca). However, many well-supported clades have no clear morphological synapomorphies (e.g. supersection Disemma and clade P [supersection Bryonioides with supersection Decaloba]). These are likely to be interesting examples of rapid speciation and adaptation, but such hypotheses will require further investigation into the rate and timing of these events. This study has provided the first insights into relationships within subgenus Decaloba supersection Decaloba, the largest and least well-understood clade in the subgenus. Molecular data have elucidated two monophyletic lineages: a smaller lineage completely lacking extrafloral nectaries (clade S), and a larger one where plants display elaborate nectaries (clade W). The present study has also highlighted the need for additional research on chromosome numbers across the genus. The n = 6 group is well established, but more work is needed on the basal lineages of subgenus Decaloba (e.g. supersections Pterosperma, Hahniopathanthus, and P. obovata). Additional chromosome counts for subgenus Tetrapathea are also needed in order to shed light on the genome-level changes that occurred in the evolution of subgenus Decaloba. This study has also emphasized the need for careful consideration of the specific evolutionary factors that may be influencing each locus used in phylogenetic reconstruction. Passiflora has a complex genetic history due in part to polyploidization and hybridization events in some clades. Subgenus Decaloba has its own suite of challenges including suspected cases of heteroplasmy, gene copy number evolution, and polyploidy. This study has provided many new insights into the evolution of subgenus Decaloba, but reveals as many new challenges that need to be addressed. Notably, strengthening support for the backbone of relationships 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. across the subgenus warrants focused effort, as does achieving greater resolution of relationships in supersection Decaloba. Such improvements will provide a solid basis for taxonomic revisions of the group, clarify evolutionary patterns and processes, and allow for more detailed studies of morphological character transformation and biogeography in this charismatic lineage. Acknowledgments. The work presented here provides the first insights that result from the Passiflora subgenus Decaloba revisionary systematics working group (Rancho Santa Ana Botanic Garden, Missouri Botanical Garden, Keene State College, Harris-Stowe State University, and Southern Arkansas University). This research was supported by a collaborative Revisionary Systematics Grant awarded by the National Science Foundation (DEB 0717151 to SEK and LAM; DEB 0717084 to KPU; DEB 0717115 to PMJ; DEB 0716940 to JMM), by grants to KPU at Keene State College (Faculty Development Grant, Office of the Dean of Sciences and Social Sciences, Office of the Provost), and by a Faculty Research Grant to SEK at Southern Arkansas University. We would like to thank Christian Feuillet and one anonymous reviewer for valuable comments on the manuscript. We thank the following individuals for assistance with fieldwork: Miguel Angel, Jorge Aranda, Roy Banka, Tatiana Boza, Rubén Martı́nez Camilo, Segundo Chimbolema, Teodoro Clase, Mireya Correa, A. P. Das, Yunfei Deng, Michael Ferrero, Andrew Ford, Carmen Galdames, Nguyen Tien Hiep, Jorge Lezcano, Ana Lucrecia MacVean, Cuong Nguyen Manh, Carlos Martinez, Idalmi Martı́nez R., Marı́a Cristina Martı́nez, Ruben Martı́nez, Nayely Martı́nez Meléndez, Anders Lindström, Pedro Pardo, Miguel Ángel Pérez, Jennifer Petersen, Yocupı́tzia Ramı́rez-Amezcua, Jack Regalado, Eyvar Rodrı́guez, Victor Steinman, Wayne Takeuchi, Hong Wang, Jun Wen, Dianxiang Zhang. The following individuals have graciously shared plant material: Richard Abbott, Ronald Boender, Christian Feuillet, Karla Gengler, Arthur Gibson, Lawrence Gilbert, Douglas Goldman, David Hearn, Katie Hansen, Alexandra Hernández, Myles Irvine, Elma Kay, George Keeney, Klaas Kingma, Yero Kuethe, Joan Leonard, Miguel Molinari, Piet Moerman, Clinton Morse, Jorge Ochoa, Elizabeth Peters, Mario Posla, Tim Skimina, Phillip Tomlinson, Erin Tripp, Torsten and Bettina Ulmer, John Vanderplank, Sula Vanderplank, Max Weigend, Henk Wouters, Roxana Yockteng, and the San Francisco Botanical Garden at Strybing Arboretum. We thank the following students for assistance in the laboratory with DNA sequencing: Lisa Bergeron, Kristin Bissonnette, Erika Brooks, Candice Canady, Tyler Chafin, Cornelia Clarke, Tess Deresienski, Katherine Dockter, Elizabeth Georgian, Siti Isa, Diana Jolles, Carrie Keil, Elizabeth Kempton, Samson King, Thuy Ly, Cristina Martinez, Saeideh Mashayekhi, Scott Massed, Anna McLean, Kate Moss, Sandra Namoff, Nitish Narula, Jake Neal, Gilberto Ocampo, Jared Peters, Amber Poirier, Nicolle Siddall, Subir Shakya and Nicholas Tyack. The following individuals from Missouri Botanical Garden assisted in specimen databasing and measuring, managing herbarium loans, literature scanning, library databasing, and georeferencing: Daniel Adams, Burgund Bassuner, Helena Bedalli, Tatiana Boza, Sara Cogburn, Christina Graves, Suzanne Hirth, Tiffanie Jones, Lori Kupski, Mary Malast, Gloria Mills, Jolsna Puthanpurayil, Frank Reynard, Shirley Rohmann, Cynthia Strickland, and Suzanne Struemph. Finally, we are grateful to the curators at MO, L, and US for permission to sample herbarium specimens. Literature Cited Alvarez, I. and J. F. Wendel. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417 – 434. Apple, J. L. and D. H. Feener. 2001. Ant visitation of extrafloral nectaries of Passiflora: the effects of nectary attributes and ant behavior on patterns in facultative ant-plant mutualisms. Oecologia 127: 409– 416. Bailey, C. D., T. G. Carr, S. A. Harris, and C. E. Hughes. 2003. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Molecular Phylogenetics and Evolution 29: 435–455. Barker, F. K. and F. M. Lutzoni. 2002. The utility of the incongruence length difference test. Systematic Biology 51: 625– 637. Bawa, K. S. 1990. Plant-pollinator interactions in tropical rainforests. Annual Review of Ecology and Systematics 21: 399– 422. Berry, P. 1987. Chromosome number reports XCV. Taxon 36: 493. Boza, T. E., P. M. Jørgensen, and J. M. MacDougal. 2014. A taxonomic revision of Passiflora section Xerogona (Raf.) Killip (Passifloraceae) 709 using principal component analysis. Annals of the Missouri Botanical Garden (in press). Bremer, B., K. Bremer, M. W. Chase, M. F. Fay, J. L. Reveal, D. E. Soltis, P. S. Soltis, P. F. Stevens, A. A. Anderberg, M. J. Moore, R. G. Olmstead, P. J. Rudall, K. J. Sytsma, D. C. Tank, K. Wurdack, J. Q. Y. Xiang, and S. Zmarzty. 2009. An update of the angiosperm phylogeny group classification for the orders and families of flowering plants: APG III. Botanical Journal of the Linnean Society 161: 105–121. de Candolle, A. P. 1822. Passifloraceae. Mémoires de la Société de Physique et d’Histoire Naturelle de Genève 1: 435. Chase, M. W., M. F. Fay, and V. Savolainen. 2000. Higher-level classification in the angiosperms: new insights from the perspective of DNA sequence data. Taxon 49: 685–704. Chase, M. W., S. Zmarzty, M. D. Lledo, K. J. Wurdack, S. M. Swensen, and M. F. Fay. 2002. When in doubt, put it in Flacourtiaceae: a molecular phylogenetic analysis based on plastid rbcL DNA sequences. Kew Bulletin 57: 141–181. Colinvaux, P. 1981. Historical ecology in Beringia - the south land bridge coast at St. Paul Island. Quaternary Research 16: 18–36. Davis, C. C., W. R. Anderson, and M. J. Donoghue. 2001. Phylogeny of Malpighiaceae: evidence from chloroplast ndhF and trnL-F nucleotide sequences. American Journal of Botany 88: 1830–1846. Davis, C. C., C. O. Webb, K. J. Wurdack, C. A. Jaramillo, and M. J. Donoghue. 2005. Explosive radiation of Malpighiales supports a mid-Cretaceous origin of modern tropical rain forests. American Naturalist 165: E36–E65. Davis, J. I., D. W. Stevenson, G. Petersen, O. Seberg, L. M. Campbell, J. V. Freudenstein, D. H. Goldman, C. R. Hardy, F. A. Michelangeli, M. P. Simmons, C. D. Specht, F. Vergara-Silva, and M. Gandolfo. 2004. A phylogeny of the monocots, as inferred from rbcL and atpA sequence variation, and a comparison of methods for calculating jackknife and bootstrap values. Systematic Botany 29: 467–510. de Melo, N. F., A. C. Cervi, and M. Guerra. 2001. Karyology and cytotaxonomy of the genus Passiflora L. (Passifloraceae). Plant Systematics and Evolution 226: 69–84. De Wilde, W. J. J. O. 1971. The systematic position of the tribe Paropsieae, in particular the genus Ancistrothyrsus, and a key to the genera of Passifloraceae. Blumea 14: 99–104. De Wilde, W. J. J. O. 1972. The indigenous Old World Passifloras. Blumea 21: 327–356. De Wilde, W. J. J. O. 1974. The genera of tribe Passifloreae (Passifloraceae) with special reference to flower morphology. Blumea 22: 37–50. Dolphin, K., R. Belshaw, C. D. L. Orme, and D. L. J. Quicke. 2000. Noise and incongruence: interpreting results of the incongruence length difference test. Molecular Phylogenetics and Evolution 17: 401–406. Doyle, J. J. and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11– 15. Doyle, J. J., J. L. Doyle, and C. Harbison. 2003. Chloroplast-expressed glutamine synthetase in Glycine and related Leguminosae: phylogeny, gene duplication, and ancient polyploidy. Systematic Botany 28: 567– 577. Drummond, A., B. Ashton, S. Buxton, M. Cheung, A. Cooper, C. Duran, M. Field, J. Heled, M. Kearse, S. Markowitz, R. Moir, S. Stones-Havas, S. Sturrock, T. Thierer, and A. Wilson. 2011. Geneious v. 5.4. Auckland: Biomatters Ltd. Emshwiller, E. and J. J. Doyle. 1999. Chloroplast-expressed glutamine synthetase (ncpgs): potential utility for phylogenetic studies with an example from Oxalis (Oxalidaceae). Molecular Phylogenetics and Evolution 12: 310–319. Endress, P. K. 1994. Diversity and evolutionary biology of tropical flowers. Cambridge: Cambridge University Press. Endress, P. K. and A. Igersheim. 1997. Gynoecium diversity and systematics of the Laurales. Botanical Journal of the Linnean Society 125: 93–168. Escobar, L. K. A. 1989. A new subgenus and five new species of Passiflora (Passifloraceae) from South America. Annals of the Missouri Botanical Garden 76: 877–885. Faegri, K. and L. Van Der Pijl. 1979. The principles of pollination ecology. New York: Pergamon Press. Farris, J. S., M. Källersjö, A. G. Kluge, and C. Bult. 1994. Testing significance of incongruence. Cladistics 10: 315–319. Feuillet, C. and J. M. MacDougal. 1999. Infrageneric classification of Passiflora L. (Passifloraceae), XVI International Botanical Congress, St. Louis, Missouri. Feuillet, C. and J. M. MacDougal. 2003. [2004]. A new infrageneric classification of Passiflora L. (Passifloraceae). Passiflora 13: 34–38. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 710 SYSTEMATIC BOTANY Feuillet, C. and J. M. MacDougal. 2007. Passifloraceae. Pp. 270 –281 in The families and genera of vascular plants vol. 9, ed. K. Kubitzki. Berlin: Springer. Garcia, M. T. A., B. G. Galati, and P. S. Hoc. 2007. Ultrastructure of the corona of scented and scentless flowers of Passiflora species (Passifloraceae). Flora 202: 302– 315. Gatesy, J., P. O’Grady, and R. H. Baker. 1999. Corroboration among data sets in simultaneous analysis: hidden support for phylogenetic relationships among higher level artiodactyl taxa. Cladistics 15: 271– 313. Gene Codes Corporation. 2000. Sequencher, v. 3.1.1. Ann Arbor: Gene Codes Corporation. Gengler-Nowak, K. 2002. Reconstruction of the biogeographical history of Malesherbiaceae. Botanical Review 68: 171–188. Gilbert, L. E. 1971. Butterfly-plant coevolution: has Passiflora adenopoda won the selectional race with Heliconiine butterflies? Science 172: 585–586. Gilbert, L. E. 1982. The coevolution of a butterfly and a vine. Scientific American 247: 110–121. Gilbert, L. E. and J. M. MacDougal. 2000. Passiflora microstipula, a new species of Passifloraceae from southeast Mexico. Lundellia 3: 1–5. Graham, A. 1976. Studies in neotropical paleobotany. II. The Miocene communities of Veracruz, Mexico. Annals of the Missouri Botanical Garden 63: 787–842. Green, P. S. 1972. Passiflora in Australasia and the Pacific. Kew Bulletin 26: 539–558. Gregor, H.-J. D. 1982. Die Jungtertiären Floren Süddeutschlands: Paläokarpologie, Phytostratigraphie, Paläoökologie, Paläoklimatologie. Stuttgart: I. Enke. Hair, J. B. and E. J. Beuzenberg. 1959. Contributions to a chromosome atlas of the New Zealand flora. 2. Miscellaneous families. New Zealand Journal of Science 2: 148–156. Hansen, A. K. 2004. Systematic studies in Passiflora L. (Passifloraceae). Ph. D. Dissertation. Austin, Texas: The University of Texas. Hansen, A. K., L. K. Escobar, L. E. Gilbert, and R. K. Jansen. 2007. Paternal, maternal, and biparental inheritance of the chloroplast genome in Passiflora (Passifloraceae): implications for phylogenetic studies. American Journal of Botany 94: 42– 46. Hansen, A. K., L. E. Gilbert, B. B. Simpson, S. R. Downie, A. C. Cervi, and R. K. Jansen. 2006. Phylogenetic relationships and chromosome number evolution in Passiflora. Systematic Botany 31: 138–150. Hearn, D. J. 2006. Adenia (Passifloraceae) and its adaptive radiation: phylogeny and growth form diversification. Systematic Botany 31: 805– 821. Hipp, A. L., J. C. Hall, and K. J. Sytsma. 2004. Congruence versus phylogenetic accuracy: revisiting the incongruence length difference test. Systematic Biology 53: 81–89. Holm-Nielsen, L. B. and P. M. Jørgensen. 1986. Passiflora tryphostemmatoides and its allies. Phytologia 60: 119–124. Hopkins, D. M., P. A. Smith, and J. V. Matthews. 1981. Dated wood from Alaska and the Yukon - implications for forest refugia in Beringia. Quaternary Research 15: 217–249. Hossaert-McKey, M., J. Orivel, E. Labeyrie, L. Pascal, J. H. C. Delabie, and A. Dejean. 2001. Differential associations with ants of three co-occurring extrafloral nectary-bearing plants. Ecoscience 8: 325–335. Huelsenbeck, J. P. and F. Ronquist. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. Jørgensen, P. M. and M. Weigend. 2004. Passiflora inca, a new species of Passifloraceae from Peru and Bolivia. Novon 14: 79–83. Jørgensen, P. M., N. Muchhala, and J. M. MacDougal. 2012. Passiflora unipetala, a new bat-pollinated species of Passiflora supersect. Tacsonia (Passifloraceae). Novon 22: 174–179. Kay, E. 2001. Observations on the pollination of Passiflora penduliflora. Biotropica 33: 709–713. Kay, E. 2003. Floral evolutionary ecology of Passiflora (Passifloraceae): subgenera Murucuia, Pseudomurucuja and Astephia. Ph. D. Dissertation. St. Louis, Missouri: Saint Louis University. Killip, E. P. 1938. The American species of Passifloraceae. Botanical Series. Field Museum of Natural History 19: 613. Kim, K. J. and R. K. Jansen. 1995. ndhF sequence evolution and the major clades in the sunflower family. Proceedings of the National Academy of Sciences USA 92: 10379–10383. Kluge, A. G. 1989. A concern for evidence and a phylogenetic hypothesis of relationships among Epicrates (Boidae, Serpentes). Systematic Zoology 38: 7–25. Korotkova, N., J. V. Schneider, D. Quandt, A. Worberg, G. Zizka, and T. Borsch. 2009. Phylogeny of the eudicot order Malpighiales: analysis of a recalcitrant clade with sequences of the petD group II intron. Plant Systematics and Evolution 282: 201–228. [Volume 38 Krosnick, S. E. 2006. Phylogenetic relationships and patterns of morphological evolution in the Old World species of Passiflora (subgenus Decaloba: supersection Disemma and subgenus Tetrapathea). Ph. D. Dissertation. Columbus, Ohio: The Ohio State University. Krosnick, S. E. and J. V. Freudenstein. 2005. Monophyly and floral character homology of Old World Passiflora (subgenus Decaloba: supersection Disemma). Systematic Botany 30: 139–152. Krosnick, S. E., E. M. Harris, and J. V. Freudenstein. 2006. Patterns of anomalous floral development in the Asian Passiflora (subgenus Decaloba: supersection Disemma). American Journal of Botany 93: 620– 636. Krosnick, S. E., A. J. Ford, and J. V. Freudenstein. 2009. Taxonomic revision of Passiflora subgenus Tetrapathea including the monotypic genera Hollrungia and Tetrapathea (Passifloraceae), and a new species of Passiflora. Systematic Botany 34: 375–385. Lavin, M. and M. Luckow. 1993. Origins and relationships of tropical North America in the context of the Boreotropics hypothesis. American Journal of Botany 80: 1–14. Lindberg, A. B. and J. M. Olesen. 2001. The fragility of extreme specialization: Passiflora mixta and its pollinating hummingbird Ensifera ensifera. Journal of Tropical Ecology 17: 323–329. MacDougal, J. M. 1983. Revision of Passiflora L. sect. Pseudodysosmia (Harms) Killip emend. J. MacDougal, the hooked trichome group. Ph. D. Dissertation. Durham: Duke University. MacDougal, J. M. 1989a. Passiflora malletii, a new species in section Decaloba (Passifloraceae) from Mesoamerica. Annals of the Missouri Botanical Garden 76: 1172–1174. MacDougal, J. M. 1989b. Passiflora citrina, a new species in section Xerogona (Passifloraceae) from Mesoamerica. Annals of the Missouri Botanical Garden 76: 354–356. MacDougal, J. M. 1994. Revision of Passiflora subgenus Decaloba section Pseudodysosmia (Passifloraceae). Systematic Botany Monographs 41: 1–146. MacDougal, J. M. 1995. Passiflora sanctae-mariae in series Luteae (Passifloraceae), a new species and series in subgenus Decaloba. Novon 5: 48–51. MacDougal, J. M. 2003. Passiflora boenderi (Passifloraceae), a new eggmimic passionflower from Costa Rica. Novon 13: 454–458. MacDougal, J. M. and C. Feuillet. 2004. Systematics. Pp. 27–31 in Passiflora: passionflowers of the world. T. Ulmer and J. M. MacDougal. Portland: Timber Press, Inc. MacDougal, J. M. and A. K. Hansen. 2003. A new section of Passiflora, subgenus Decaloba (Passifloraceae), from Central America, with two new species. Novon 13: 459–466. MacDougal, J. M. and A. Hernández. 2014. Una nueva especie de Passiflora, subgenero Decaloba para Colombia. Novon (in press). Mader, G., P. M. Zamberlan, N. J. R. Fagundes, T. Magnus, F. M. Salzano, S. L. Bonatto, and L. B. Freitas. 2010. The use and limits of ITS data in the analysis of intraspecific variation in Passiflora L. (Passifloraceae). Genetics and Molecular Biology 33: 99–108. Mai, D. H. 1967. Die Florenzonen der Florenwechsel und die Vorstellungen über den Klimaablauf im Jungteriär der Deutschen Demokratischen Republik. Abhandlungen des Zentralen Geologischen Institutes. 10: 55–81. Masters, M. T. 1871. Contributions to the natural history of the Passifloraceae. Transactions of the Linnean Society of London 27: 593 – 645. Masters, M. T. 1872. Passifloraceae. Flora Brasiliensis 13(1F): 529–628, t.106 –128. McKenna, M. C. 1972. Was Europe connected directly to North America prior to the middle Eocene? Evolutionary Biology 6: 179–189. Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Pp. 1– 8 in Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, Louisiana: 14 November. Muschner, V. C., A. P. Lorenz-Lemke, M. Vecchia, S. L. Bonatto, F. M. Salzano, and L. B. Freitas. 2006. Differential organellar inheritance in Passiflora’s (Passifloraceae) subgenera. Genetica 128: 449– 453. Muschner, V. C., A. P. Lorenz, A. C. Cervi, S. L. Bonatto, T. I. Souza-Chies, F. M. Salzano, and L. B. Freitas. 2003. A first molecular phylogenetic analysis of Passiflora (Passifloraceae). American Journal of Botany 90: 1229–1238. Nixon, K. C. 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15: 407– 414. Nixon, K. C. 2002. Winclada (BETA) v. 1.00.08. Ithaca: Published by the author. Nixon, K. C. and J. M. Carpenter. 1996. On simultaneous analysis. Cladistics 12: 221–241. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA Olmstead, R. G. and P. A. Reeves. 1995. Evidence for the polyphyly of the Scrophulariaceae based on chloroplast rbcL and ndhF sequences. Annals of the Missouri Botanical Garden 82: 176–193. Porter-Utley, K. E. 2003. Revision of Passiflora subgenus Decaloba supersection Cieca (Passifloraceae). Ph. D. Dissertation. Gainesville, Florida: University of Florida. Porter-Utley, K. E. 2007. Passiflora tacanensis, a new species of Passiflora subgenus Decaloba supersection Cieca from Mexico. Brittonia 59: 25– 28. Porter-Utley, K. E. Revision of Passiflora subgenus Decaloba supersection Cieca (Passifloraceae). Systematic Botany Monographs (in press). Posada, D. 2008. JModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25: 1253–1256. Rambaut, A. 2000. SE-AL, a manual sequence alignment editor. Oxford: University of Oxford, Department of Zoology. Rásky, K. 1960. Pflanzenreste aus dem Obereozän Ungrans. Senckenbergiana Lethaea 41: 423–449. Reichenbach, L. 1828. Passifloraceae. Pp. 132 in Conspectus regni vegetabilis. Leipzig: Carl Cnobloch. Scotland, R. W., J. A. Sweere, P. A. Reeves, and R. G. Olmstead. 1995. Higher-level systematics of Acanthaceae determined by chloroplast DNA-sequences. American Journal of Botany 82: 266–275. Sher, A. 1999. Traffic lights at the Beringian crossroads. Nature 397: 103 –104. Skrabal, J., H. Tillich, and M. Weigend. 2001. A revision of the Passiflora lobii group (Passifloraceae) including some new species and subspecies. Harvard Papers in Botany 6: 309–338. Snow, A. A. 1982. Pollination intensity and potential seed set in Passiflora vitifolia. Oecologia 55: 231–237. Snow, N. and J. M. MacDougal. 1993. New chromosome reports in Passiflora (Passifloraceae). Systematic Botany 18: 261–273. Sosa, V., M. W. Chase, and C. Barcenas. 2003. Chiangiodendron (Achariaceae): An example of the Laurasian flora of tropical forests of Central America. Taxon 52: 519–524. Sun, Y., D. Z. Skinner, G. H. Liang, and S. H. Hulbert. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26–32. Swofford, D. L. 2002. PAUP* Phylogenetic analysis using parsimony (* and other methods). v. 4.0 beta 10. Sunderland: Sinauer Associates. Taberlet, P., G. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. Tiffney, B. H. 1985. The Eocene North Atlantic Land Bridge: its importance in tertiary and modern phytogeography of the northern hemisphere. Journal of the Arnold Arboretum 66: 73–94. Tokuoka, T. 2012. Molecular phylogenetic analysis of Passifloraceae sensu lato (Malpighiales) based on plastid and nuclear DNA sequences. Journal of Plant Research 125: 489–497. Ulmer, T. and J. M. MacDougal. 2004. Passiflora: passionflowers of the world. Portland: Timber Press, Inc. Varassin, I. G., J. R. Trigo, and M. Sazima. 2001. The role of nectar production, flower pigments and odour in the pollination of four species of Passiflora (Passifloraceae) in south-eastern Brazil. Botanical Journal of the Linnean Society 136: 139–152. Waltari, E., E. P. Hoberg, E. P. Lessa, and J. A. Cook. 2007. Eastward ho: phylogeographical perspectives on colonization of hosts and parasites across the Beringian nexus. Journal of Biogeography 34: 561–574. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315– 322 in PCR protocols: a guide to methods and applications eds. M. Innis, D. Gelfand, J. Sninsky, and T. J. White. San Diego: Academic Press. Williams, K. S. and L. E. Gilbert. 1981. Insects as selective agents on plant vegetative morphology: egg mimicry reduces egg-laying by butterflies. Science 212: 467–469. Wirth, R. and I. R. Leal. 2001. Does rainfall affect temporal variability of ant protection in Passiflora coccinea? Ecoscience 8: 450–453. Wolfe, J. A. 1975. Some aspects of plant geography of the northern hemisphere during the late cretaceous and teritary. Annals of the Missouri Botanical Garden 62: 264–279. Wurdack, K. J. and C. C. Davis. 2009. Malpighiales phylogenetics: gaining ground on one of the most recalcitrant clades in the angiosperm tree of life. American Journal of Botany 96: 1551–1570. 711 Yockteng, R. and S. Nadot. 2004a. Infrageneric phylogenies: a comparison of chloroplast-expressed glutamine synthetase, cytosol-expressed glutamine synthetase and cpDNA maturase K in Passiflora. Molecular Phylogenetics and Evolution 31: 397– 402. Yockteng, R. and S. Nadot. 2004b. Phylogenetic relationships among Passiflora species based on the glutamine synthetase nuclear gene expressed in chloroplast (ncpgs). Molecular Phylogenetics and Evolution 31: 379–396. Yotoko, K., M. Dornelas, P. Togni, T. Fonseca, F. Salzano, S. Bonatto, and L. Freitas. 2011. Does variation in genome sizes reflect adaptive or neutral processes? New clues from Passiflora. PLoS ONE 6: 1– 8. Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the Maximum Likelihood criterion. Ph. D. Dissertation. Austin, Texas: The University of Texas. Appendix 1. Voucher information for DNA sources used in phylogenetic analyses. Each specimen is listed with collector name, number, and voucher location. Four taxa were unvouchered (indicated with a “*”); in these cases, species identifications were independently verified by sequencing vouchered specimens for nrITS, vouchers listed following the asterisk. Four voucher specimens collected by A. Hernández were lost during fieldwork in Colombia, and are indicated with a “§.” Sequence used from Ossowski listed as unvouchered in GenBank is indicated with a “¥.” Loci not sequenced for a particular taxon are indicated as “-.” GenBank accession numbers listed in the following order: nrITS, ncpGS, ndhF and trnL-F. Outgroup Genera—Adenia heterophylla (Blume) Koord. S. Krosnick 4 (OS), JX470766, JX847204, JX679725, JX470860. Basananthe triloba (Bolus ex Schinz) W. J. de Wilde. L. A. McDade & K. Balkwill 1254 (J, MO), DQ521293, JX847205, JX679726, JX470937. Malesherbia lanceolata Ricardi. K. Gengler 54 (OS), JX470765, JX847206, JX679727, JX470861. Malesherbia weberbaueri var. weberbaueri Gilg. K. Gengler 288 (OS), AY632697, -, JX679728, AY632722. Paropsia madagascariensis (Mast.) H. Perrier. M. Zyhra 949 (WIS), -, -, AY757164, AY636105; D. Hearn Mad037 (ARIZ), DQ521377, -, -, -. Turnera ulmifolia L. S. Krosnick 296 (OS), -, -, JX679858, JX470917; D. Hearn Mad009 (ARIZ), DQ521284, -, -, -. Ingroup—Passiflora adenopoda DC. S. Krosnick 258 (OS), AY632702, DQ458122, JX679729, AY632727. Passiflora allantophylla Mast. S. Krosnick 25 (OS), DQ458069, DQ458123, JX679730, DQ458114. Passiflora alnifolia Kunth. L. A. McDade 1339 (MO), -, JX847207, JX679731, JX470862. Passiflora altebilobata Hemsl. S. Krosnick 3 (OS), DQ458078, DQ458124, JX679732, DQ458105. Passiflora ampullacea (Mast.) Harms. S. Krosnick 262 (*P. M. Jørgensen 61434), AY632720, -, JX679733, AY632745. Passiflora anadenia Urb. S. Krosnick 621 (MO), JX470833, JX847208, JX679734, JX470863. Passiflora apetala Killip. E. E. Kay 194 (MO), JX470822, JX847209, JX679735, JX470918. Passiflora apoda Harms. A. Hernández 235 (MO), JX470779, JX847210, JX679736, JX470864. Passiflora arbelaezii L. Uribe. S. Krosnick 259 (OS), AY632703, DQ463766, JX679737, AY632728. Passiflora arborea Spreng. A. Hernández 234 (MO), JX470767, JX847211, JX679738, JX470865. Passiflora aurantia G. Forst. S. Krosnick 24 (OS), AY632704, DQ458125, JX679739, AY632729. Passiflora aurantioides (K. Schum.) Krosnick. B. Gray 2035IV (OS), DQ458057, DQ463767, JX679740, DQ458085. Passiflora auriculata Kunth. S. Krosnick 350 (OS, RSA-POM), DQ284532, DQ458126, JX679741, DQ284534. Passiflora berteroana Balb. ex DC. S. Krosnick 610 (MO), JX470780, JX847212, JX679742, -. Passiflora bicornis Houston ex Miller. K. Porter-Utley 418 (KESC), JX470836, JX847213, JX679743, JX470866. Passiflora bicrura Urb. S. Krosnick 581 (MO), JX470834, JX847214, JX679744, -. Passiflora biflora Lam. E. E. Kay 197 (MO), -, JX847215, JX679745, -; K. Porter-Utley & D. Mondragon-Chaparro 327 (CICY), JX470837, -, -, JX470867. Passiflora boenderi J. M. MacDougal. K. Porter-Utley 416 (KESC), JX470823, JX847259, JX679746, JX470868. Passiflora bryonioides Kunth. D. H. Goldman 2266 (BH), JX470796, JX847217, JX679829, JX470869. Passiflora calcicola Proctor. E. E. Kay 131 (MO), JX470813, JX847218, JX679748, JX470944. Passiflora capsularis L. A. Hernández 262 (§), JX470806, JX847219, JX679749, -; A. P. Lorenz-Lemke s. n. (ICN), -, -, -, DQ123029. Passiflora chelidonea Mast. A. Hernández 175 (MO), JX470838, JX847220, JX679750, JX470870; T. Croat 93100 (MO), -, JX847221, JX679751, JX470871. Passiflora chrysosepala Schwerdtfeger. P. M. Jørgensen & S. Chimbolema 2479 (MO), JX470839, JX847222, JX679793, JX470872. Passiflora cinnabarina Lindl. G. Butler 66949 (CBG), AY632706, DQ458129, JX679753, AY632731. Passiflora cirrhiflora Juss. H. Wouters s. n. (MO), DQ458063, DQ463762, JX679754, DQ458093. Passiflora citrina J. M. MacDougal. S. Krosnick 23 (OS), DQ458083, DQ458130, JX679755, DQ458101. Passiflora cobanensis Killip. K. Porter-Utley, N. Martı́nez M. & M. A. Pérez F. 461 (KESC, HEM), JX470807, -, JX679756, JX470873. Passiflora cochinchinensis Spreng. S. Krosnick 326 (OS), Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 712 SYSTEMATIC BOTANY DQ087421, DQ458150, JX679757, DQ087430. Passiflora colimensis Mast. & Rose. K. Porter-Utley 490 (KESC, HEM), JX470797, JX847223, JX679758, -. Passiflora complanata J. M. MacDougal. MacDougal 555GR (MO), JX470827, JX847224, JX679759, JX470874. Passiflora coriacea Juss. K. Porter-Utley P-68 (FLAS), JX470790, JX847225, JX679760, JX470919. Passiflora cubensis Urban. E. E. Kay 233 (MO), JX470814, JX847226, JX679761, JX470875. Passiflora cuneata Willd. J. M. MacDougal 431 (MO), JX470840, JX847227, JX679762, JX470920. Passiflora cupiformis Mast. S. Krosnick 253 (OS), AY632708, DQ458132, JX679763, AY632733. Passiflora cupraea L. E. E. Kay 227 (MO), JX470815, JX847228, JX679764, JX470876. Passiflora deidamioides Harms. G. Mader s. n. (ICN), EU907257, -, -, -; R. Marquete 3080 (RB), -, -, -, DQ445920. Passiflora discophora Jørgensen & Lawesson. S. Krosnick 352 (MO), JX470772, DQ463761, JX679765, DQ458092. Passiflora dolichocarpa Killip. D. E. Breedlove 58312 (MO), JX470798, JX847229, JX679766, JX470921. Passiflora eberhardtii Gagn. S. Krosnick 292 (OS), JX470778, JX847230, JX679767, JX470877. Passiflora edulis Sims. R. Yockteng 46 (P), -, AY261575, -, -; S. Krosnick 365 (RSA-POM), JX470774, -, JX679769, JX470878. Passiflora escobariana J. M. MacDougal. J. M. MacDougal 3823 (MO), JX470808, JX847232, -, JX470879. Passiflora exsudans Zucc. J. M. MacDougal 3015 (MO), JX470799, JX847233, -, JX470880. Passiflora filipes Benth. D. H. Goldman 2153 (BH), AY632709, DQ458134, JX679853, AY632734. Passiflora foetida L. S. Krosnick 351 (RSA-POM), DQ458053, DQ463760, -, DQ458094. Passiflora gilbertiana J. M. MacDougal. B. E. Hammel 20544 (MO), JX470824, JX847234, JX679771, JX470881. Passiflora gracilis Jacq. ex Link. S. Krosnick 413 (*J. M. MacDougal 1519GR87), JX470800, JX847235, JX679772, -; Passiflora aff. gracillima Killip. S. Krosnick 357 (MO), -, DQ463778, JX679773, -. Passiflora gracillima Killip. P. M. Jørgensen & S. Chimbolema 2466 (MO), JX470773, -, -, JX470882. Passiflora guatemalensis S. Watson. S. Krosnick 347 (*J. M. MacDougal 6297), DQ087419, DQ458137, JX679774, JX470883. Passiflora hahnii (E. Fourn.) Mast. R. Yockteng 65 (P), -, AY261591, -, -; K. Porter-Utley, N. Martı́nez M. & R. Martı́nez C. 436 (KESC, HEM), JX470777, -, JX679775, JX470884. Passiflora helleri Peyr. S. Krosnick 356 (RSA-POM), DQ458082, DQ458138, JX679776, DQ458106. Passiflora henryi Hemsl. S. Krosnick 8 (OS), AY632710, DQ458128, JX679777, AY632735. Passiflora herbertiana Lindl. S. Krosnick 255 (OS), AY632711, DQ458139, JX679778, AY632736. Passiflora hirtiflora Jørgensen & Holm-Nielsen. R. Yockteng 67 (P), JX470841, JX847236, JX679779, JX470861. Passiflora hollrungii K. Schum. R. Banka & S. Krosnick 2051 (LAE), DQ458081, DQ458140, JX679731, DQ458110. Passiflora holosericea L. S. Krosnick 328 (OS), DQ087417, -, JX679781, DQ087426; S. Krosnick 719 (*Porter-Utley 487), JX470781, -, -, -. Passiflora ichthyura Mast. M. H. Nee 36203 (MO), JX470842, JX847237, JX679782, JX470886. “Passiflora ilamo” J. M. MacDougal & MacVean sp. nov. ined. K. Porter-Utley, N. Martı́nez M. & M. A. Pérez F. 434 (KESC, HEM), JX470825, -, -, -; J. M. MacDougal 6203 (MO), -, JX847238, JX679783, -. Passiflora indecora Kunth. R. Yockteng 70 (P), -, AY261596, -, -; S. Krosnick 508 (MO), JX470843, -, JX679784, JX470938. “Passiflora intricata” J. M. MacDougal sp. nov. ined. S. Krosnick 631 (MO), JX470844, JX847239, JX679785, -. Passiflora jatunsachensis Schwerdtfeger. J. M. MacDougal 4983 (MO), -, JX847240, JX679786, JX470923. Passiflora jugorum W. W. Smith. S. Krosnick 15 (OS), AY632712, DQ458143, JX679787, AY632737. Passiflora juliana J. M. MacDougal. K. Porter-Utley & D. Mondragon-Chaparro 357 (CICY), JX470791, -, -, -; K. Porter-Utley & D. Mondragon-Chaparro 359 (CICY, FLAS), -, JX847241, -, -; K. Porter-Utley & D. Mondragon-Chaparro P-4 (FLAS), -, -, -, JX470924. Passiflora jussieui Feuillet. S. Krosnick 261 (MO), JX470768, JX847242, -, JX470943. Passiflora karwinskii Mast. K. Porter-Utley & C. Fernández Rı́os 425 (KESC, HEM), JX470801, JX847243, JX679788, JX470887. Passiflora kuranda Krosnick & A. J. Ford. S. Krosnick 334 (OS), DQ458060, DQ463773, JX679789, DQ458090. Passiflora lancearia Mast. E. E. Kay 222 (MO), JX470845, -, JX679790, JX470888. Passiflora lancetillensis J. M. MacDougal & Meerman. S. Krosnick 447 (MO), -, -, JX679791, JX470925; S. Krosnick 564 (RSA-POM), JX470775, JX847244, -, -. Passiflora lancifolia Ham. K. Porter-Utley & A. Paul P-51 (FLAS), JX470792, JX847245, JX679792, JX470926. Passiflora leptoclada Harms. L. A. McDade 1368 (MO), JX470846, JX847246, JX679793, JX470889. Passiflora lobata (Killip) Hutch. ex J. M. MacDougal. S. Krosnick 486 (MO), JX470802, JX847247, JX679794, JX470927. Passiflora lobbii Mast. subsp. ayacuchoensis Skrabal & Weigend. M. Weigend 2000/385 (MO), JX470782, JX847248, -, JX470928. Passiflora lutea L. J. M. MacDougal 224 (MO), -, -, JX679795, JX470890B. W. Wells 4417 (US), DQ006022, -, -, -. Passiflora macrophylla Spruce ex Mast. S. Krosnick 353 (MO), DQ458062, DQ463776, JX679796, DQ458097. Passiflora maestrensis Duharte. E. E. Kay 231 (MO), JX470816, JX847249, JX679797, JX470891. Passiflora membranacea Benth. S. Krosnick 19 (OS), AY632701, DQ458146, JX679798, AY632726. Passiflora mexicana Juss. D. H. Goldman 1774 (BH), AY632713, DQ458147, JX679840, AY632738. Passiflora micropetala Mast. J. M. MacDougal and Lalumondier 4982 (MO), JX470847, JX847250, JX679800, -. Passiflora microstipula L. Gilbert & J. M. MacDougal. J. M. MacDougal 3012 (MO), DQ458066, DQ463769, JX679801, -. Passiflora [Volume 38 misera Kunth. S. Krosnick 371 (RSA-POM), JX470848, JX847251, JX679802, JX470892. Passiflora monadelpha Jørgensen & Holm-Nielsen. A. Hernández 256 (§), JX470783, JX847252, JX679803, P. Jørgensen, C. Ulloa, E. Narvaez & M. Lara 1774 (MO), -, -, -, DQ087427. Passiflora morifolia Mast. S. Krosnick 311 (OS), DQ284535, DQ458155, JX679804, DQ284535. Passiflora multiflora L. D. H. Goldman 2164 (BH), AY632715, DQ458152, JX679810, AY632740. “Passiflora munchiquensis” A. Hernández sp. nov. ined. A. Hernández 252 (§), JX470784, JX847253, JX679806, JX470893. Passiflora murucuja L. E. E. Kay 217 (MO), JX470817, -, -, JX470894S. Krosnick 263 (OS), -, DQ458153, JX679807, -. Passiflora oblongata Sw. E. E. Kay 177 (MO), JX470818, JX847254, JX679808, JX470895. Passiflora obovata Killip. S. Krosnick 355 (MO), DQ458064, DQ463779, JX679809, DQ458098. Passiflora obtusifolia Sessé & Mociño. L. A. McDade 1348 (MO), JX470793, JX847255, JX679810, JX470896. “Passiflora occidentalis” J. M. MacDougal & Hernández sp. nov. ined. A. Hernández 257 (§), JX470849, JX847256, JX679811, JX470897. Passiflora orbiculata Cav. S. Krosnick 601 (MO), JX470819, JX847257, JX679812, -. Passiflora ornithoura Mast. J. M. MacDougal 6205 (MO), JX470826, JX847258, JX679813, -. Passiflora ovalis Vell. G. Mader s.n. (ICN), EU258359, -, -, -; T. S. Nunes, J. G. Jardim, M. V. Moraes & B. M. Silva 745 (HUEFS), -, -, -, DQ123122. Passiflora pardifolia Vanderplank. Vanderplank s.n. (MO), JX470850, JX847259, JX679814, -. Passiflora pavonis Mast. K. Porter-Utley & N. Martinez M. & M. Perez 467 (KESC, HEM), JX470831, JX847260, JX679815, -. Passiflora pedicellaris J. M. MacDougal. J. M. MacDougal 6215 (MO), JX470776, JX847261, JX679816, -. Passiflora pendens J. M. MacDougal. J. M. MacDougal 571 (MO), JX470803, JX847262, JX679817, JX470929. Passiflora penduliflora Bert. ex DC. E. E. Kay 230 (MO), JX470820, JX847263, JX679818, JX470898. Passiflora perakensis Hall. f. S. Krosnick 314 (OS), DQ087422, DQ458158, JX679819, DQ087431. Passiflora perfoliata L. K. Porter-Utley & A. Paul P55 (FLAS), JX470821, JX847264, JX679820, JX470899. Passiflora pilosa Ruiz & Pav. ex DC. subsp. dimidiata J. M. MacDougal. K. Porter-Utley & D. Mondragon-Chaparro 341 (CICY, FLAS), -, JX847265, JX679821, -. Passiflora pilosa Ruiz & Pav. ex DC. subsp. pilosa. J. M. MacDougal 528GR (MO), JX470804, -, -, JX470930. Passiflora pittieri Mast. R. Boender s.n. (MO), DQ995476, DQ995474, JX679822, DQ995475. Passiflora porphyretica Mast. var. angustata Killip. J. M. MacDougal 2027 (MO), -, JX847266, JX679726, JX470939. Passiflora punctata L. S. Krosnick 363 (RSA-POM), JX470851, JX847267, JX679824, -. Passiflora pusilla J. M. MacDougal. K. Porter-Utley 420 (KESC), JX470809, -, JX679825, JX470900. Passiflora pyrrhantha Harms. S. Krosnick 391 (MO), JX470771, -, JX679826, JX470901. Passiflora quadrangularis L. S. Krosnick 1 (OS), AY636106, DQ463780, JX679827, AY636106. Passiflora rovirosae Killip K. Porter-Utley & D. Mondragon-Chaparro 309 (CICY, FLAS), JX470810, JX847268, JX679828, JX470931. Passiflora rubra L. L. A. McDade 1358 (MO), JX470811, JX847269, JX679829, -. Passiflora rufa Feuillet & J. M. MacDougal. J. M. MacDougal 6019 (MO), JX470789, JX847270, JX679830, JX470902. Passiflora rugosissima Killip. K. PorterUtley, N. Martı́nez M. & R. Martı́nez C. 428 (KESC, HEM), JX470828, JX847271, JX679831, JX470903; R. R. Santos 520 (MO), -, JX847272, JX679832, JX470932. Passiflora sagasteguii Skrabal & Weigend. T. Henning 3 (MO), JX470785, JX847273, JX679833, JX470904. Passiflora sandrae J. M. MacDougal. R. Yockteng 112 (P), -, AY261641, -, -; J. M. MacDougal 6036 (MO), JX470852, -, JX679834, JX470940. Passiflora sanguinolenta Mast. S. Krosnick 28 (OS), JX470812, -, JX679835, JX470905; C. Morse 199800014 (CONN), -, AY261643, -, -. Passiflora serratodigitata L. S. Krosnick 264 (OS), AY636108, AY261645, -, AY636109. Passiflora sexflora Juss. S. Krosnick 626 (MO), JX470830, JX847275, JX679837, JX470906; K. Porter-Utley & A. Paul P-48 (FLAS), JX470829, JX847274, JX679836, -. Passiflora siamica W. G. Craib. S. Krosnick 346 (OS), DQ087423, DQ458162, JX679838, DQ087432. Passiflora sicyoides Schlecht. & Cham. K. Porter-Utley & D. Mondragon-Chaparro 338 (CICY, FLAS), JX470805, -, -, JX470933; R. H. Magana 6414 (MO), -, JX847276, JX679839, -. Passiflora sodiroi Harms. J. M. MacDougal 1941 (MO), JX470786, JX847277, -, JX470907. Passiflora solomonii L. K. Escobar. J. L. Carretero 1031 (MO), JX470787, -, JX679840, JX470908. Passiflora sp. nov. aff. eckmanii Liogier. S. Krosnick 595 (MO), JX470835, JX847231, JX679768, JX470922. Passiflora sphaerocarpa Tr. & Planch. S. Krosnick 418 (MO), JX470769, JX847278, JX679841, JX470909. Passiflora tacanensis Port.-Utl. K. Porter-Utley & N. Martinez M. & R. Martinez C. 435 (KESC, HEM), JX470794, JX847279, JX679842, JX470910. Passiflora talamancensis Killip. R. Yockteng 125 (P), -, AY261653, -, -; J. M. MacDougal 410 (MO), -, -, JX679843, -; J. Vanderplank 1243/07a (NCP), AF454809, -, -, AF454793. Passiflora tatei Killip & Rusby. S. Krosnick 387 (RSA-POM), JX470853, JX847280, JX679844, JX470941. Passiflora telesiphe Knapp & Mallet. R. Yockteng 127 (P), JX470854, JX847281, JX679845, -. Passiflora tenella Killip. B. B. Klitgaard, B. Merino, P. Lozano 2013] KROSNICK ET AL.: PASSIFLORA SUBGENUS DECALOBA Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. & T. Delgado 426 (MO), JX470832, JX847282, JX679846, JX470934. Passiflora tenuiloba Engelm. D. H. Goldman 1770 (BH), AY632719, DQ458154, -, AY632744. Passiflora tetrandra Banks & Sol. ex DC. S. Krosnick 266 (OS), AY632721, DQ463764, JX679847, AY632746. Passiflora tina Boender & Ulmer. S. Krosnick 569 (RSA-POM), JX470770, JX847283, JX679848, JX470911. Passiflora tricuspis Mast. S. Krosnick 385 (RSA-POM), JX470855, JX847284, JX679849, JX470935. Passiflora truncata Regel. S. Krosnick 465 (MO), JX470788, JX847285, JX679850, JX470936. Passiflora tuberosa Jacq. L. A. McDade 1360 (MO), JX470856, JX847286, JX679851, -. Passiflora tulae Urban. S. Krosnick 345 (OS), -, DQ458164, JX679852, JX470912. Passiflora 713 urnifolia Rusby. L. A. McDade 1344 (MO), JX470857, JX847287, JX679853, JX470942. Passiflora vespertilio L. R. Yockteng 137 (P), -, AY261668, -, J. M. MacDougal 6022 (MO), JX470858, -, -, JX470913. Passiflora cf. viridescens L. K. Escobar. P. M. Jørgensen & S. Chimbolema 2468 (MO), JX470859, JX847288, JX679851, JX470914. Passiflora vitifolia Kunth K. Porter-Utley 98–1 (FLAS), -, -, JX679855, JX470915; Tolima Botanical Garden JBAVH 3320 (P), -, AY261670, -, -; A. M. Ossowski s.n. (¥), AF454796, -, -, -; Passiflora wilsonii Hemsl. J. Wen 5973 (F), DQ087425, DQ458165, JX679856, DQ087434. Passiflora xiikzodz J. M. MacDougal. K. Porter-Utley & D. Mondragon-Chaparro 387 (CICY), JX470795, -, JX679857, JX470916.

RELATED PAPERS

RELATED TOPICS

Log In

New Insights into the Evolution of Passiflora subgenus Decaloba (Passifloraceae): Phylogenetic Relationships and Morphological Synapomorphies

New Insights into the Evolution of Passiflora subgenus Decaloba (Passifloraceae): Phylogenetic Relationships and Morphological Synapomorphies

Related Papers

RELATED PAPERS

RELATED TOPICS