zyxwvutsrqpon zyxwvutsrqpo zyxwvutsr Eur. J. Biochem. 244, 604-612 (1997) 0 FEBS 1997 A serine/threonine protein kinase from Mycobacterium tuberculosis Priska PEIRS, Lucas DE WIT, Martine BRAIBANT, Kris HUYGEN and Jean CONTENT zyxwvut Departernent of Virology, Institut Pasteur, Brussels, Belgium (Received 29 November 1996) - EJB 96 1767J1 Genomic DNA sequencing in the vicinity of the pstA-1 gene from Mycobacterium tuberculosis allowed us to clone, sequence and identify a gene encoding a 70-kDa protein. The size of the protein was confirmed by in vitru coupled transcriptiodtranslation. Its N-terminal domain shows extensive sequence similarity with the catalytic domain of eukaryotic serinelthreonine protein kinases, and the protein was therefore called Mbk (mycobacterial protein kinase). The deduced amino acid sequence contains two transmembrane segments, which flank a highly repetitive region, suggesting a receptor-like anchoring. The mbk gene was overexpressed in Escherichia coli and the gene product (Mbk) was purified as a fusion protein with gluthatione S-transferase. Recombinant Mbk was found to be autophosphorylated on threonine residues and capable of phosphorylating myelin basic proteins from bovine brain and histones from calf thymus on serine residues, both in a manganese-dependent manner. The phosphorylation of myelin basic proteins by Mbk was inhibited by calcium and by staurosporine, a widely used inhibitor of eukaryotic protein serinekhreonine kinases. A similar gene was found in Mycobacterium bovis BCG DNA by Southern blot analysis. Its expression was detected in cultures of M. bovis BCG by reverse transcriptasel PCR. Although its biological role is unknown, it is the first serine/threonine protein kinase characterized in Mycobacteria. Keywords: serinelthreonine protein kinase; phosphate transport; amino-acid-sequence repeat; Mycobacteriuin tuberculosis. Phosphorylation is one of the major regulatory mechanisms in the signal-transduction systems of eukaryotic and prokaryotic cells. The main phosphorylation sites known in eukaryotes are on tyrosine and serinekhreonine residues [l], whereas in prokaryotes phosphorylation occurs often on histidine/asparagine residues, as in two-component signal-transduction systems [2]. In recent years, tyrosine-phosphorylating and serinekhreoninephosphorylating enzymes have also been identified in prokaryotic organisms (Streptomyces, Anabaena, M ~ X O C O C Cand U S Yer.siniu 13- 81). Although their exact biological function is usually unknown, they have been shown to be involved in signal transduction required for cell-cell interactions and cell differentiation. It would be therefore of great interest to examine new examples of such enzymes in other bacteria, especially in human pathogens, since this would permit evaluation of their role in virulence or host-parasite relationships. Recently, we have cloned and sequenced two potential Mycobucteriunz tuberculosis operoris similar to the Escherichia coli pst (phosphate-specific transport) system. The first includes pstB, pstS-I, p t C - I and pstA-2, and the second consists of p t S - 3 , pstC-2 and pstA-l [9, lo]. We now report the identifica- tion of an open reading frame downstream the M. tuberculosis pstA-1 gene, encoding a protein kinase (Mbk) with extensive similarity to eukaryotic and prokaryotic serinelthreonine protein kinases [l, 111. In this communication we describe the deduced primary structure of the Mbk protein, and characterize the activity of the purified recombinant Mbk protein, expressed in E. coli as a fusion protein with glutathione S-transferase (GST). MATERIALS AND METHODS Cloning and sequencing of Mbk. Preparation of plasmid DNA, restriction-enzyme digests, and ligation and transformation of E. coli were performed essentially as described by Sambrook et al. [12]. An EcuRI DNA fragment of 3.0 kb, encoding the PstA-I gene [13], was subcloned into the pBluescript I1 SK+ vector. This subclone, pBS-A, ?, was subjected to DNA sequencing by means of Sanger’s technique with a T7 sequencing kit (Pharmacia Biotech) or Taq DNA polymerase (Promega) and 2-deoxy-7-deaza-guanine triphosphate, and by Texas-Red-dyeprimer cycle sequencing on an automatic sequencer with a Thermosequenase core-sequencing kit and 2-deoxy-7-deaza-guanine triphosphate (Vistra DNA System, Amersham). The 7-deaza analog of dGTP has been used for resolution of abnormal and compressed regions in dideoxynucleotide sequencing of cloned DNA [ 141. Nucleotide and deduced amino acid sequences were analyzed by means of the DNA Strider program [15] and the Genetic Computer Group program [16] of the Belgian EMBnet Node (network facility). zyxwvuts Corrrspondrncr to J. Content., lnstitut Pasteur, Departement of Virology. Engelandstraat 642, B-1180 Brussels, Belgium Fax: +32 2 373 32 79. Abbreviation.s. Mbk, Mycohacteviurn tubercu1osi.s serinekhreonine protein kinase; pst, phosphate-specific transport; GST, gluthatione Stransferase. En:ynrs. DNA polymerase (EC: 2.7.7.7); gluthatione S-transferase (EC 2.5.1.18). Note. The nucleotide sequence data of the mbk gene have been deposited in the EMBL data bank and are available under the accession number XYY618. Expression and purification of Mbk as a fusion protein with GST. The mbk gene was subcloned in frame with the GST coding region into the E m R I site of pCex-SX-3 (Pharmacia BioTech) to give pCex-Mbk, and was transformed into E. coli z zyxwvutsr zyxwvutsr zyxw zyxwvutsr 605 Peirs et al. (Euc J. Biockem. 244) A c 7 2680 / / / 2880 I ,I Contigs \ / \ / zyxwvutsrqpo zyx EeoA I I loo0 - PstS-3 PstC-2 2 z zyxwvutsr \ BamH I I 2ooo I I 4Mo 3wo PstA-1 1 m I I r/////lc I PstS-2 - I ORF (MbK) Fig. 1. Identification and sequence of the mbk gene. (A) Genomic location of the mbk gene. Location of the DNA of the mbk ORF in the region downstream thepstA-1 gene in the 4297-kb EcoRI fragment of the dgtll M. tuberculosis clone A1 [13]. The upper part of the figure represents a schematic drawing adapted from the published full M. tuberculosis integrated map [46]. The gene cluster pstb.p.rts-I(pab).pstC-l.pstA-2 is located immediately downstream of pstS-2 [9]. The mbk sequence encodes a kinase catalytic domain (hatched) and two transmembrane domains (regions I1 and 111). (B) Nucleotide and amino acid sequence of the M. t~iberculosismbk gene. Roman numerals represent subdomains (underlined) from the catalytic domain of eukaryotic-type protein kinases [I]. Amino acids corresponding to consensus domain sequences are in bold. The two predicted membrane-spanning segments are boxed. Basic amino acid residues in the regions preceding the first transmembrane domain and following the second transmembrane domain, are circled. The six repeats (=40 amino acids) are marked with a hook sign and their four 4-6-amino-acids constituant motifs are in bold underlined letters. ( C ) A schematic representation of the GST Mbk protein, derived from the predicted amino acid sequence. The deduced amino acid sequence has two predicted transmembrane domains and contains three regions : 1, N-terminal catalytic kinase domain containing 8 of the 11 subdomains constituting the consensus catalytic domain of eukaryotic-like serinekhreonine protein kinases. 11, is a positively charged intracytoplasmic domain. 111, predicted extracytoplasmic domain containing six amino-acid-sequence repeats (Fig. 1B). The 97-kDa and 70-kDa recombinant fusion proteins and a potential cleavage site (arrow head) are indicated. DH5rx. The recombinant Mbk fusion protein was purified by affinity chromatography on a GST-purification module (Pharmacia Biotech) from 500-ml cultures as described by the manufacturer except that 20 mM Tris, 100 mM NaC1, 1 mM EDTA, pH 7.0, was used instead of 140 mM NaCl, 2.7 mM KCl, 10 mM Na'HPO,, 1.8 mM KH,PO,, pH 7.3, to suspend the isopropylthio-P-D-galactoside-induced cells after centrifugation. The eluates were analyzed by 0.1 % SDS/15% PAGE and proteins were revealed with Coomassie blue staining. Molecular mass was estimated by comparison with molecular-mass markers (mid-range protein markers ; Promega). Coupled in vitro transcriptiodtranslation assays. These assays were carried out with an E. coZi-S30 extract system for coupled transcription/translation of circular DNA (Promega). Circular plasmid DNA from pBS-A,.,, pGex-Mbk or pGexMbk""" (anti-sense mbk gene with the GST gene) were tested in an E. coli S30 extract with an amino acid mixture containing ["SJmethionine (1200 Ci/mmol, 15 mCi/ml) to 50 pl, as described by the manufacturer. After incubating the reactions at 37°C for 1 h, a 5-1.11 aliquot was analyzed on an 0.1 % SDS/15% PAGE, and the labelled proteins were detected by autoradiograPhY. Phosphorylation assay. The phosphorylation assays were carried out with 1 yl of the GST-purification-module eluate in 20 yl 25 mM Hepes, pH 7.5, 60 mM KCl, 1 mM EDTA, 1 mM dithiothreitol and 5 pCi [y-3zP]ATP (3000 Ci/mmol). After 20 min at 37"C, 20 pl 0.125 M Tris/HCI, pH 6.8, 4% (masshol.) SDS, 0.005% bromophenol blue, 20% glycerol, 5% 2-mercaptoethanol was added and the reactions were boiled for 2 min. Phosphorylated proteins were separated by 0.1 % SDS/I 5 % PAGE and detected by autoradiography. Molecular mass was estimated by comparison with molecular-mass markers ('"Cmethylated protein molecular-mass markers ; Amersham). Phosphorylation of calf thymus histones (type-11-AS ; Sigma) and myelin basic protein from bovine brain (BRL) was examined by adding the substrate to the reaction mixture containing 2.5 mM MnZ+and 6 mM Mg". Assay of Mnz+-dependentkinase activity on histones was performed with 1 pg histones and different Mn2+concentrations. The manganese dependent autophosphorylation activity was assayed at various Mn'+ concentrations at 37°C in 20 pl. After 30 min, the mixtures were spotted onto phosphocellulose units (SpinZyme Format; Pierce) and the radioactivity remaining associated with Mbk was determinated by scintillation counting after washing the filters twice with 75 mM phosphoric acid. Inhibition of Mbk phosphorylation activity on myelin basic proteins by staurosporine (from Streptomyces species ; Boehringer Mannheim) or a bisindolylmaleimide derivative of staurosporine (GF 109 203X, synthetic; Boehringer Mannheim) was performed with 2.5 mM Mn2+and different inhibitor concentrations. Radiolabeled myelin basic proteins were 606 zyxwvuts zyxwvu zyxwvutsrqp zyxwvu zyxw zyxwvutsrqponm zyxwvutsrqpo Peirs et al. (Eur: J. Biochem. 244) ... ... _._ ... ... B t ORF P s t S - 2 CGT TCC AAG CAA AAT TGG CGG CCG CGG TGA atgctatttcttg R S K Q N W R P R * 1 a c c t a g t g a a g g w g a c g GTG AGC GAT GCC GTT CCG CAG GTA GGG TCG CAA T T T GGG CCG TAT EcoRI M S D A V P Q V G S Q F G P Y 1L zyxwvutsrqpon zyxw MbK O W 68 CAG CTA TTG CGG CTG CTG GGC CGA GGC GGG ATG GGC GAG GTT TAT GAG GCC GAG GAC ACC D T E A E Y G E V L L C R 0 G M L L R 1 6 0 I 1 2 8 C'GC RAG CAC CGG GTG GTG GCG CTG AAG TTG ATC TCG CCG CAG TAC TCC GAC AAT GCG GTG N A V S D K L I P Q Y V A L H R V S 36F: K I I 1 8 8 T T T CGA GCA CGG ATG CAA CGC GAG GCC GAC ACC GCG GGA CGG CTG ACC GAG CCA CAC ATC 56F R A R M Q R E A D T A G R L T E P H I 7n... 2 4 8 GTG CCG ATC CAT GAC TAC GGC GAG ATC AAC GGA CAG TTC TTT GTC GAA ATG CGC ATG ATC V F E M R M I G E I N Q F H D Y I 7 6 V P G 3 0 8 EAC GGC ACC TCT TTA CGC GCC CTA TTG AAA CAG TAT GGT CCG CTG ACC CCG GCC CGA GCT L T P A R A G P R A L L S L Q Y T K 96Li G 3 6 8 GTG GCC ATC GTG CGC CAG ATC GCC GCC GCT TTG GAT GCC GCG CAT GCC AAC GGC GTA ACG N G D A A H V T A A A L A V Q I A I 1 1 6 V R 4 2 8 CAC CGC GAC GTA AAA CCG GAP. AAC ATT CTG GTC ACC GCG AGC GAC TTC GCC TAT CTG GTC F A I L V T A S D P E N Y L L R D V K 1368: p - 4 8 8 GAT T T C GGT ATT GCC CGT GCC GCC TCC GAC CCG GGG CTG ACC CAG ACC GGG ACC GCC GTG V T A G L S D Q T G R A A P 1 5 6 2 & G I A T ,I, 548 GGA ACC TAC AAC TAC ATG GCC CCG GAG CGG TTC ACC GGC GAT GAG GTC ACC TAT CGC GCA T Y R A M A P E R F T G D E V Y N Y 176G T v l l .l ... - 6 0 8 GAT ATC TAT GCG TTG GCG TGC GTG TTG GGT GAG TGT TTG ACC GGT GCC CCA CCG TAT CGG Y R G A P P G E C L T A C V L A L Y 1 9 6 D I -Ix.~ 6 6 8 GCC GAC AGC GTT GAG CGG TTG ATC GCC GCG CAT CTA ATG GAC CCT GCC CCG CAG CCC AGC L M P A A H D R L I A S V E P Q P S 216A D 7 2 8 CAG CTA CGG CCC GGG CGC GTG CCG CCG GCC CTG GAT CAG GTG ATC GCC AAA GGC ATG GCC I A K G M A A D Q V R V P P R P G L 236Q L 788 AAA AAC ccc 256 K P 848 crc 2 7 6 L N GCG GAG CGC T T T ATG AGC GCT GGT GAT CTG GCC ATC GCC GCC CAT GAC GCA L A I A A H D A S A G D A R F M E XI ACC ACA TCC GAG CAA CAC CAG GCC ACG ACG ATT CTG CGG CGC GGT GAC AAC GCA ACC T T S E Q H Q A T T I L R R G D N A T 9 0 6 TTG CTG GCC ACT CCG GCC GAT ACG GGC TTG AGC CAG TCC GAG TCG GCA TTG CCG GGG GG 2 9 6 L L A T P A D T G L S Q S E S A L P G ( $ 966 GCA CCG GCC ACC GAC CCC GGG TGC TGC CCG ATG GTC GCC GG GGA CTC GC GAC GT GGC 316A P A T D P G C C P M V A 6 G L & l D & G 1 0 2 6 bG ACC CCT GGC AGC GGA CAG CCG GG GG GAA CTG GCC CAG CCA AAC GG ACA CTC CCC 3 3 6 6 T P G S G Q P b & E L A Q P N 6 T L P 1 0 8 6 TGC GT CCC GAA TGC GCT CCA GGC CTC CCT GGG ACA GC TGT GCC GCC GC CGG CAA CAA 3 5 6 C b P E C A P G L P G T 6 C A A & l R Q Q 1 1 4 6 ACG GAA GGT GTG G G C A G T A G T A G G 3 7 6 T E G V G & & faPEaA 6 1 2 0 6 ,GCL 3 9 6h ~ ~ = a I V L V A I A A , ~- V TCG TGG TCG CCG ACG CAG GCA TCC GGA CAG ACC GTG T W S Pc Q A ~S G Q T~ Y_ S zyxwvutsrqpo 1 2 6 6 T'PG CCG TTC ACC GGC ATC GAC TTC CGC CTC TCG CCG AGT GGG GTG GCA GTG GAC AGC GCC 4 1 6 k P F T G I D F R L S P S F V A V D S A 1 3 2 8 GGC AAC GTG TAC GTC ACC AGT GAG GGC ATG TAC GGC CGA GTG GTC AAG TTG GCC ACC GGG 436G N V Y V T S E G M Y E R V V X L L T G 1388 TCA ACC GGC ACG ACG GTG TTA CCG T T C AAC GGG CTG TAC CAG CCG CAA GGG TTG GCG GTG G T V F N G L Y P P Q G L A V T L P 4 5 6 s T 1448 GAC GGC GCT GGC ACC GTA TAC GTC ACC GAT TTC AAC AAC CGG GTG GTG ACG TTA G G A T D F N N R Y V T L T Y Y 476D V 1 5 0 8 GGG TCC AAC AAC CAG ACC GTG CTA CCG TTC GAC GGC CTC AAC TAC CCC GAA GGT CTC GCG 496G S N N Q T V L P F D G L N Y P E F L A 1 5 6 8 GTG GAT ACC CAG GGT GCG GTA TAC GTC GCC GAC CGG GGC AAC AAC AGG GTG GTG AAG TTG 5 1 6 E 9 T Q G A Y Y V h D R G N p1 R V V X L 1 6 2 8 GC'G GCC GGA TCC AAG ACC CAG ACC GTG CTC CGG TTC ACC GGC CTC AAC GAC CCC GAC GGG 5 3 6 L A G S K T Q T Y L R L T G L N D P D L 1788 GTG GCC GTC GAC AAC TCC GGC AAC GTC TAT GTC ACC GAC ACC GAC AAC AAC AGG GTT GTC 5 5 6 Y A V Ll N S G N Y Y V T D T D N N R V V 1 7 4 8 AAG CTA GAG GCC GAG TCG AAT AAC CAG GTC GTG CTG CCA TTC ACG GAT ATC ACC GCA CCG 5 7 6 E A k A E S N N Q V V L P P T D I T A P 1 8 0 8 TGG GGC ATC GCG GTG GAC GAA GCC GGA ACC GTC TAC GTC ACC GAG CAC AAC ACA AAC CAG 596W E I A V D E A G T Y Y V T E H N T N 0 1868 GTG GTC AAA CTCICTG GCC GGG TCG ACC ACC TCG ACA GTG CTA CCG TTC ACC GGC CTC AAC 6 1 6 V_ V K 1L L A G S T T S T V L P F T G L f"_l ' -~ ~ ~ GCG GTG GCA GTG GAC AGC GAC GG ACC GTC TAC GTC GCC GAC GC GGC AAC ~ ~ ~ ~ ~ V A V R S D ~ T CTC ACG TCA TAA CgggagtcacCgccgtcgggttgcgacgaaccggatcatcgcc L T S ' gcggccaggttgatcgtggcgaccacgatgatcagggtcagcgccgcgccccagacgc Fig. 1. (continued). Y Y V h D zyxwvu zyxw zyxwvutsrqp zyxwvutsrq zyxwvuts z zyxwvutsrqp zyxwv Peirs et al. (ELMJ. Biochem. 244) c 0, 200 400 607 800 600 1000 aa Mbk 97 kDa 70 kDa . I 4 I1 I11 b b Fig. 1. (continued) detected and quantified by electronic autoradiography (Instantlmager; Packard). Phosphoamino acid analysis. Mbk autophosphorylation and phosphorylation of histones on serine and threonine residues was determinated by 0.1% SDS/15% PAGE and western blot analysis with an anti-phosphoserine mAb (clone no. PSR-45 ; Sigma) and an anti-phosphothreonine mAb (clone no. PTR-8 ; Sigma) and the ProtoBlot Western Blot AP System (Promega) as described in the manufacturer's instructions. Molecular mass was estimated by comparison with molecular-mass markers (Rainbow protein molecular-mass markers ; Amersham). Southern blot analysis. Mycobacterium bovis BCG genomic DNA was digested with KpnI, Sphl or EcoRI, electrophoresed on a 1% agarose gel, transferred to nylon Hybond-N filters (Amersham) and hybridized with a 1200-bp SphI-BamHI M. tuberculosis Mbk probe in Rapid-hybridization buffer (Amersham) and washed in 150 mM NaCl, 7 mM NaH,PO,, 0.35 mM EDTA at 65 "C before autoradiography. Reverse transcriptionPCR. M . bovis BCG (GL2 strain) was grown in Dubos medium at 37°C under shaking. DNasetreated total RNA from M . bovis BCG [I71 was reverse transcribed with primer E51 and amplified by PCR with primers ES1 and 381 (Fig. 1A). The products were analyzed on 1% agarose gels stained with ethidium bromide. Phylogenetic tree. The phylogenetic tree was constructed with the help of the Genetics Computer Group software [16]. The sequences were aligned with Pileup. A Jukes-Cantor distance matrix [18] was computed with Distances. The tree was constructed with GrowTree by Neighbor-joining [ 191 and plotted with the PHYLIP [20] program Drawtree. RESULTS Identification of the mbk gene and analysis of its deduced amino acid sequence. The 4297-kb EcoRI fragment from the Agtll M. tuberculosis recombinant clone A1 containing the PstA-l gene [13], encoding a protein highly similar to the E. coli PstA subunit, was characterized by restriction analysis with several endonucleases (Fig. 1A). Two internal EcoRI sites were used to subclone an insert of 3039 kb in pBluescript I1 SK+. Sequencing downstream of the PstA-1 gene allowed us to identify an open reading frame that was predicted to be transcribed and translated in the opposite direction with respect to the PstA-1 gene (Fig. 1A). The open reading frame, ending with a TAA stop codon at position 2012, contains a potential initiation codon, GTG, at position 23. This ORF is predicted to encode a protein of 662 amino acid residues, with a calculated molecular mass of 70 kDa. In vitro transcription/translation of the 3039 bp DNA in an E. coli S30 coupled transcription/translation system, or its transcription by T7 RNA polymerase followed by translation of the transcribed mRNA in the rabbit reticulocyte translation system, gave proteins of about 70 kDa as expected. The deduced amino acid sequence of Mbk suggests that it contains three domains, the third (111) being surrounded by two putative membrane-spanning segments (as determined by a Kyte and Doolitle hydrophobicity analysis and TopPred I1 1211; Fig. 1 B and C). The N-terminal domain (amino acid residues 20-270) of the encoded protein contains 8 of the 11 subdomains constituting the consensus catalytic domain of eukaryotic serine/ threonine protein kinases (Fig. 1B). The sequence of subdomain VI of this protein is characteristic of serinekhreonine protein kinases in particular [l]. Therefore, the protein was called Mbk (mycobacterial serinehhreonine protein kinase). Its N-terminal catalytic domain is followed by a region (11) with a large number of basic residues mainly between amino acids 314 and 382, which suggests a cytoplasmic location [22]. The third, presumably extracytoplasmic, domain is constituted by six repeats of a module of about 40 amino acids with no similarity to any known protein. The highest nucleic acid similarity (61% identity in 1609nucleotide overlap) was obtained with a region of the Mycobacterium leprae cosmid B 1308 containing ORF fragments similar to Mbk, and located within a potential pst-like operon [9]. Recently, various Mycobacterium tuberculosis cosmids have been submitted to the nucleotide sequence database, and in these cosmids the nucleotide sequences of six serinekhreonine protein kinases have been found. This suggests that in M. tuberculosis a family of serinekhreonine protein kinases is present. Within these protein kinases, the highest amino acid similarities were obtained with pkn28 (MTCY04C12;28, cosmid SCYO4C12, 56% identity in 320-amino-acid overlap) and pkn50 (MTCY50.16, cosmid Y50, 53.6% identity in 377-amino-acid overlap). A high degree of similarity was found between Mbk and the deduced amino acid sequence from two protein kinases pknB and pknA from M . leprae (cosmid B1770). The functions of pknA and pknB and whether the respective genes are expressed are unknown. In addition, high levels of similarity were found with the catalytic domain from serinekhreonine protein kinases of known biological function in two bacterial species : the Pknl kinase from the fruiting-body-forming Myxococcus xanthus, expressed during the development at the onset of sporulation [6, 231; and AfsK, a membrane-associated protein kinase from Streptomyces coelicolor (a filamentous soil bacterium that can undergo complex morphological differentiation), which phosphorylates AfsR, a global regulatory protein required for the production of several antibiotics. Amino-acid-sequence alignments were used to construct a phylogenetic tree of the catalytic domains of the kinases closely related to that of Mbk (Fig. 2). This tree confirms that the most closely related proteins to Mbk are within the M. tuberculosis, M. leprae and M . xanthus cluster, while Anabaena, Streptomyces coelicolor and Thermomonospora curvutu protein kinases are more distant. Overproduction and purification of Mbk. We expressed the M. tuberculosis Mbk in E. coli as a fusion protein with GST at its N-terminus. Elution of the fusion protein from a gluthatione- zyxwvutsr zyxwvut zyxwvu zyxwvut 608 Peirs et al. ( E m J. Biochem. 244) Raf (rat) PRVKA (Pseudorabiesvirus) Saccharomyces cerevisiae zy zyxw CDC-2 T~ypanosomabmei DC-28Saccharomyces cerevkae MAPKSaccharomyces cerevisiae Myxocmus xanthus Mycobactenurn lepta KI I Drosophiamelanogaster Mekl Sacchammycescerevisiae Yersinia pseudotubemiosis Y!%?4 weel+(human) zyxwvutsrqponm zyxwvutsr Fig.2. Deduced phylogeny of the catalytic domains of Mbk and of 18 protein kinases found in bacterial species together with those of 20 protein kinases from eukaryotes representing different subfamilies [I, 81. The conditions used are described in Materials and Methods. Proteinkinase sequences shown in this figure can be found in data banks: pkn28 (56.6% identity to Mbk in 320-aa overlap; MTCY4C12-28), pkn50 (53.6% identity in 377-aa overlap; K08GPMYCTU), pkn30 (32.7% identity in 392-aa overlap, MTCY4C12-30), pkn4Y (3Y.4% identity in 274aa overlap; KY28__MYCTU), pknA (32.7% identity in 342-aa overlap; MTC10H4__16) and pknB (35.9% identity in 306-aa overlap; MTC10H4-15) from M. tuberculosis; pknA (35.7% identity in 255-aa overlap; MLB1770-11) and pknB (36.9% identity in 293-aa overlap; MLB1770-9) from M . leprue; Pknl (27.9% identity in 377-aa overlap; P33973), Pkn2 (27.9% identity in 351-aa overlap; S21533), PknS (31.4% identity in 188-aa overlap) and Pkn6 (38% identity in 129-aa overlap; U406.56) from M. xunfhus;pkwa (28% identity in 345-aa overlap; U23820) from Z cuwafa;PknA (U00484) from Anabuena sp. PCC 7120; PkaA (27.6% identity in 387-aa overlap), pkaB (26.3% identity in 373-aa overlap; D26539) and AfsK (22.6% identity in 443-aa overlap; D15062) from S. coelicolor; YpkA (X69439) from Y. pseudotuberculosis; STE7 (P06784), MAPK (FUS3, P16892), CDC-28 (P00546), Mekl (P24719), CMK2 (P22517), Ypk2 (P18961) and IPLl (P38991) from Succkaromyces cerevisiae; cAMPK (CAMP-dependent protein kinase, P34099) from Dictyosfeliumdiscoideurn; PRVKA (P17613) from Pseudorabies virus; CKII (casein kinase TI, P06493) from Drovophila melanogasrer; CDC-2 (S36619) from T~ypano~ollza brucei; CCDPK (P08414) from mouse; MLCK (myosin light chain protein, P20689) and Raf (P14056) from rat; weel + (P30291), S6 K (P23443), PKCg (protein kinase Cp, P05771), PKCI (protein kinase Cz, P41734), PKCZ (protein kinase C[ type, Q05513) and PIM-1 (P11309) from human. Prokaryotic kinases are underlined and protein kinases from M. fuberculosis are boxed. For the M. tuherculosis kinases, the names are tentative, since the data have not been published. Fig. 3. Expression of the mbk gene in E. coli as an fusion protein, phosphorylation activity of the GST-Mbk and identification of phosphoamino acids. (A) Purification of Mbk as a fusion protein with GST. Lysates of E. coli DHSu[pGex-Mbk](lane I), E. coli DHSa[pGex](lane 2) and E. coli DHSa (lane 3), purified by glutathione affinity chromatography. Eluates were analyzed by SDS/PAGE and visualized with Coomassie blue. (B) Phosphorylation activity of Mbk. Autoradiogram showing the phosphorylation of myelin basic protein (MBP) (lane I), calf thymus histones (lane 2) by Mbk and autophosphorylation of Mbk (lane 3). No phosphorylated proteins were detected when GST (lane 4) or an extract from E. coli DHSa purified by means of a GST-purification module (lane 5 ) was incubated with [y”P]ATP without Mbk. (C) Phosphoamino acid analysis of phosphorylated Mbk and calf thymus histones phosphorylated by Mbk by immunohlotting with anti-phosphoserine and anti-phosphothreonine mAb. zyxwv zyxwvu Peirs et al. (Eur J. Biochem. 244) 609 Since the Mbk-fusion protein contains a hydrophobic region, possibly inserted within the membrane, its C-terminal domain (30 kDa) is presumably extracytoplasmic and possibly cleaved off in E. coli. This cleavage is probably localized in the C-terminal region beyond the first transmembrane domain (Fig. 1 C), since the 97-kDa and 70-kDa fusion proteins are recognized by the anti-GST Ig. zyxwvutsrq zyxwvutsrqponm zyxwvut Fig. 4. in vifro coupled transcriptionr'translation of the mbk gene. 5 pl of each 5O-pl reaction was loaded in each lane. The autoradiogram shows the protein products synthesized from pGex-Mbk DNA (lane l), pGex-Mbk""" DNA (lane 2), pBS-A, DNA (lane 3) and H,O (lane 4). M, molecular-mass markers. Characterization of the enzymatic activity. The purified recombinant fusion protein (Fig. 3A) was used to evaluate the enzymatic activity of the Mbk protein. GST-Mbk was autophosphorylated and capable of phosphorylating calf thymus histones and myelin basic proteins (from bovine brain) but not protamine (Fig. 3 B). To demonstrate that Mbk is a serinelthreonine proteine kinase, specific anti-phosphothreonine and anti-phosphoserine mAb were used to detect the phosphorylated GST-Mbk and the phosphorylated histones in western blots. The phosphorylated recombinant GST-Mbk was phosphorylated mainly at threonine residues, whereas Mbk phosphorylates histones mainly at serine residues (Fig. 3 C). When purified GST-Mbk was incubated without bivalent cations or with Mg2+ or Caz+ (5 mM), no phosphorylation was detected. Phosphorylation of the GST-Mbk occured only in the presence of Mn2+.A sharp peak of Mbk activity was observed at 2.0 mM Mn2+ (Fig. 5 ) , implying that Mn2+ may act as a cofactor or activator of the enzyme. Furthermore, optimum Mbk autophosphorylation and phosphorylation of histones by Mbk occurred at the same MnZ+concentration. The range of Mn2+ concentrations required for Mbk activity was in the physiological concentration range of Mn2+,at least in E. coli [24]. Therefore, the requirement of Mn2+appears to be physiologically relevant and compatible with the proposed intracellular location of the catalytic domain. Caz+ could not stimulate Mbk but was found to strongly inhibit the enzyme activity, even in the presence of 2.5 mM Mn2+. A time-course of Mbk phosphorylation was carried out to investigate the initial Mbk-phosphorylation rate. Incorporation of y-phosphate into GST-Mbk occurred very rapidly, reaching about 70% of its maximum within 1.5 min (data not shown). Lowering the reaction temperature to 7°C did not slow down the reaction in a significant manner. Therefore, we were unable to measure the initial kinetics of Mbk phosphorylation. zyxw zyxwvu zy affinity column followed by SDSPAGE and staining with Coomassie blue revealed a protein at approximately 65 -70 kDa, whereas glutathione S-transferase purified from bacterial lysates of E. coli containing the vector plasmid without insert revealed a 27-kDa protein (Fig. 3A). These findings suggest that the purified 65 -70 kDa protein is the Mbk-fusion protein, although its molecular mass is about 30 kDa lower than expected. This could not be explained by a construction or gel-migration artefact, since in vitro transcriptiodtranslation of the pGex-Mbk DNA, encoding GST-Mbk, and the Mbk protein encoded by pBS-A, DNA, in an E. coli S30 coupled transcriptionltranslation system yielded proteins of about 97 kDa and 70 kDa, respectively, i.e. their expected molecular masses (Fig. 4). Western blot analysis of unfractionated isopropylthio-P-Dgalactoside-induced bacterial cells expressing the GST-Mbk fusion protein, followed by detection with anti-GST Ig, showed 97-kDa and 70-kDa fusion proteins in a 4 : 6 ratio, whereas the procedure used above yielded a ratio of less than 1: 8. Since variations in this procedure were found to strongly affect the ratio between the purified 97-kDa and 70-kDa fusion proteins recovered by gluthatione-Sepharose affinity chromatography, this could suggest that some cleavage of the 97-kDa protein occurs during the lysis of E. coli. A 0 " 0 2 4 8 [M?] (rnhl) 8 1 0 ~~ 0 ~ 2 4 6 8 1 0 [M?] (rnM) Fig.5. MnZ+dependency of Mbk activity. (A) Mbk autophosphorylation at various concentrations of Mn2+.The experiment was carried out in duplicate and values are the means for one set of determinations. (B) Quantification of histone phosphorylation by Mbk at various concentrations of Mnz+. Histones were incubated with [Y-~~P]ATP and Mbk in the presence of the indicated concentration of Mn2+, subjected to SDSPAGE and quantified by electronic autoradiography. zyxwvutsr zyxwvutsrq zyxwv Peirs et al. (Eul: J . Biochenz. 244) 610 zyxwvutsrqpon zyxwvutsrqpo zyxwvutsrqpon zyxwvutsrqp zyxw 0' ' 0 ' 20 ' ' 40 ' ' 60 ' 80 ' 100 ' 120 Fig. 8. Expression of the M. bovis rnbk gene revealed by reverse transcripton/PCR. Amplified products were analyzed on 1 % agarose gels stained with ethidium bromide, Lane 3, is the product of reverse transcription-PCR of 0.16 pg RNA from M . bovis BCG; lane 1, negative control without cDNA; lane 2, PCR of RNA from M. h i s BCG without reverse transcription omitted. M, DNA molecular-mass marker (2 DNA cleaved with EcoRI and HindIII; Boehringer Mannheim); m, Hue111 fragments of fX174 RF DNA (GibcoBRL). zyxwvuts [Inhibitor] (pM) Fig. 6. Effects of protein-kinaseinhibitors on the phosphorylation of myelin basic protein by Mbk. Myelin basic protein was incubated with [y-3zP]ATPand Mbk in the presence of the indicated concentration of staurosporine (0)and GF 109 203X (0). Mycobucterium smegmatis DNA did not hybridize to the same probe, even at low stringency (data not shown). In addition to the region within cosmid B1308 described above, the M. leprue genome contained two other genes, pknA and pknB, which encode a protein kinases similar to Mbk (Fig. 2). Expression of a mbk gene in M . bovis BCG. To define whether the M. bovis BCG mbk gene is expressed, we analyzed its RNA by reverse transcription/PCR with two primers surrounding the catalytic region (Fig. 1 A). Amplified DNA with the expected size could be detected (Fig. 8). DISCUSSION Fig. 7. Southern blot analysis of M. bovis BCG DNA after hybridization with a M. tuberculosis Mbk probe. To study the characteristics of this protein-kinase, we examined the effect of two protein-kinase inhibitors, staurosporine and GF 109203X (a synthetic bisindolylmaleimide derivative of staurosporine) on in vitro protein phosphorylation [25]. Staurosporine globally inhibits protein kinases because it appears to act at the ATP-binding site of the catalytic domain common to all eukaryotic protein kinases, whereas GF 109203X is known to be an inhibitor of type-C protein kinases. The phosphorylation activity of Mbk on myelin basic protein was reduced about 50% in the presence of 40 pM staurosporine or 10 pM GF 109203X (Fig. 6). This concentration was higher than the IC,, of protein kinase C for GF 109203X (0.01 pM) and therefore does not suggest an eukaryotic type C protein kinases behaviour. However, the sensitivity to staurosporine we observed is similar to that described for eukaryotic-like serine/threonine protein kinases from cellular extracts of Streptomjjces griseus assayed in the presence of Mnz+ [26]. In this study, we demonstrate that M. tuberculosis and M. bovis BCG code both for a serinehhreonine protein kinase, designated Mbk, whose expression was evaluated in M. bovis BCG. The mbk gene encodes a protein of 663 amino acids, which appears to consist of at least three major domains (Fig. 4B). The N-terminal region (residues 1-270) contains 8 of the 11 consensus subdomains characteristic of the catalytic domain of eukaryotic serine/threonine protein kinases (Fig. 1) [l, 111. Serinekhreonine and tyrosine kinases have long been considered to be confined to eukaryotes; it is only recently that genes encoding eukaryotic-type protein kinases have been found in several bacterial species. [3-6, 8, 23, 27-30] In addition to six unpublished sequences from M. tuberculosis and two sequences from M. leprue (Fig. 2), the catalytic domain of Mbk shows highest sequence similarities to the catalytic domain of a family of serinel threonine protein kinases from the developmental bacterium Myxococcus xanthus [4, 6, 231 and to protein kinases from Streptomyces species (AfsK, a membrane associated protein kinase [3], PkaA and PkaB [ 5 ] ) and to Pkwa, a Therrnomonosporu cuwutu protein, containing a serinekhreonine-protein-kinase and WD-repeat domains. All four bacterial species in which eukaryotic-type protein kinases have been found are able to undergo biological processes involving cell-cell interactions as in multicellular eukaryotes. In contrast, no such genes have been found in E. coli, Mycoplusma genitalium, or Haemophilus injluenzue, whose genomes have been largely or completely sequenced [8]. Since the mycobacterial kinase shows high similarity with protein kinases that interfere in the onset of cell differentiation, it could be of interest to study the role of the mbk gene in clump formation and cell- zyxwvutsrqpo Similar genes in other mycobacteria. Southern blot analysis of M. bovis BCG genomic DNA digested with EcoRI, SphI or KpnI, revealed single fragments to which the mbk probe bound at high stringency. Moreover the EcoRI and SphI fragments had the sizes expected, as derived from the M. tuberculosis sequence, suggesting that an analogue of this gene exists in this strain (Fig. 7). Sequencing results confirmed this suggestion. zyxwvut zyxwvuts zyxw Peirs et al. (EUKJ. Biochem. 244) cell interaction in mycobacterial cultures, even though no multicellular or differentiation events are described in these bacteria. Although these protein kinases have been described only recently, 0-phosphates formed by phosphorylation of the hydroxyamino acids serine, threonine and tyrosine have been identified in bacteria earlier [31]. Among the 0-phosphates labelled in vivo with '*P, in the cyanobacterial Synechococcus sp. PCC 7942 and PCC 6301, a protein highly similar to the PI1 protein from proteobacteria was identified. In proteobacteria, PI1 is the central signal transducer in nitrogen control [32]. Recently, it has been found that the PI1 protein from the cyanobacterium Synechococcus sp. strain PCC 7942, which was originally thought to be uridylylated as it is in proteobacteria, was phosphorylated at serine residues and in this respect resembles an eukaryotic signaltransduction protein [33-351. Another known system of bacterial signal transduction involving serine phosphorylation is the phosphorylation of HPr in gram-positive bacteria [36-391. This protein is one of the phosphate-carrier enzymes of the phosphoenolpyruvate-dependent phosphotransferase system. In contrast with gram-negative bacteria, in gram-positive bacteria HPr is phosphorylated at a serine residue in an ATP-dependent proteinkinase-catalysed reaction. The C-terminal region, surrounded by two predicted short transmembrane domains, consists of six tandem-repeated motifs of 40 amino acids (with no intervening sequences), suggesting a receptor function for a presently unknown ligand or the association with a specific protein subunit. Between the catalytic domain and the first transmembrane helix, the second region is very rich in positively charged amino acids (22% Arg). According to the suggestion of von Heijne [22], this suggests the following topology. The N-terminal catalytic domain and the second region would be intracytoplasmic, whereas the external C-terminal repeats would be within the mycobacterial periplasmic space. Mycobacteria are gram-positive and do not have a conventional periplasm. The lipid cell-wall layer does, however, act like an outer membrane. The proposed intracellular location of the kinase domain might explain the strict MnZ+requirement observed here for the Mbk enzymatic activity, and its strong inhibition by Ca2+ suggests that it is unlikely to function within the cytoplasm of eukaryotic cells. Pkn2, a member of the serine/ threonine-protein-kinase family from M. xanthus was the first transmembrane serinelthreonine protein kinase demonstrated in prokaryotes. The C-terminal domain was found to be translocated across the membrane, and probably serves as a receptor to sense an unidentified external signal [4]. In prokaryotes, a large number of transmembrane histidine protein kinases are known, which function as sensors for various external signals [40]. The C-terminal domain from the serinehhreonine protein kinase Pkwa from T. cuwata contains seven tandem-repeated motifs of about 40 amino acids [41], and althouth these WD repeats do not resemble those found in Mbk, their structured features could be similar. A number of recent studies have indicated that phosphorylation is a post-translation modification that plays a role in the exploitation of certain host functions by bacterial pathogens as part of their infective strategy. YpkA, a secreted serinekhreonine protein kinase encoded by a virulence plasmid from Yersinia pseudotuberculosis, appears to be an indispensable vimlence determinant whose role in virulence is assumed to involve the dephosphorylation and phosphorylation of host proteins 127, 28, 421. Mbk shows little similarity with YpkA from I:pseudotuberculosis, but since M. tuberculosis is a facultative intracellular pathogen and its entry into macrophages and subsequent ability to survive is believed to be a pivotal aspect in the course of its virulence, Mbk might be a virulence determinant of M. tubercu- 611 losis. In this respect, it could be of interest to study whether it is expressed within infected macrophages. The presence of the mbk gene within a putative pst operon encoding a phosphate permease [9, 131 raises the possibility that it may have a role in regulating phosphate transport in mycobacteria. In E. coli, the promoters of pst gene are regulated (like other genes of this regulon) by two proteins, PhoB and PhoR. PhoR is an histidine protein kinase induced by P, starvation. It phosphorylates the regulator protein PhoB, which is also P,starvation induced. The phosphorylated form of PhoB is the transcriptional activator of the pst genes [44]. When P, is in excess, PhoR acts as a repressor by dephosphorylating PhoB. Formation of the repressor form of PhoR probably results from the association of PhoR with PhoU and the Pst-permease components (PstA, PstB, pstC) upon full P, occupancy of the PstSbinding protein. In conclusion, we propose that Mbk could be a bacterial sensor that transduces signals from unknown ligand(s) through the bacterial membrane to an accessory protein, via its intracellular, membrane-associated protein kinase activity. Attempts to define its role in the regulation of the phosphate-permease genes and/ or to identify putative phosphorylated protein substrates or candidate ligands in vivo are in progress, and will necessitate the use of homologous recombination (allelic exchange), which has recently become possible in slowly growing mycobacteria 1451. zyxw zyxwvu We would like to thank Paul Vandenbussche, Oliver Denis and Michael Kalai for helpfull discussions. We thank Dr R. A. Young for the M . tuberculosis l g t l l library. Competent bio-computing support was provided by members of Belgian EMBnet Node. This work was supported by grants from De Belgische Nationale Bond tegen de Tuberculose, afdeling Oost-Vlaanderen, by Les Amis de l'lnstitut Pasteur de Bruxelles and by grant 3.4543.95 from the Fund for Medical Scientific Research (Belgium). zyxwv REFERENCES zyxw 1. Hanks, S. K., Quinn, A. M. & Hunter, T. (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains, Science 241, 42-52. 2. Parkinson, J. S . (1993) Signal transduction schemes of bacteria, Cell 73, 857-871. 3. Matsumoto, A,, Hong, S. K., Ishizuka, H., Horinouchi, S. & Beppu, T. (1994) Phosphorylation of the AfsR protein involved in secondary metabolism in Streptomyces species by a eukaryotic-type protein kinase, Gene (Amst.) 146, 47-56. 4. Udo, H., Munoz-Dorado, J., Inouye, M. & Inouye, S . (1995) Myxococcus xanthus, a gram-negative bacterium, contains a transmembrane protein serinekhreonine kinase that blocks the secretion of beta-lactamase by phosphorylation, Genes & Dev. 9, 972-983. 5. Urabe, H. & Ogawara, H. (1995) Cloning, sequencing and expression of serinekhreonine kinase-encoding genes from Streptomyces coelicolor A3(2), Gene (Amst.) 153, 99-104. 6. Munoz-Dorado, J., Inouye, S . & Inouye, M. (1993) Eukaryotic-like protein serine/threonine kinases in Myxococcus xanthus, a developniental bacterium exhibiting social behavior, J. Cell. Bioclzem. 51, 29-33. 7. Chow, K., Ng, D., Stokes, R. & Johnson, P. (1994) Protein tyrosine phosphorylation in Mycobacterium tuberculosis, FEMS Letf.124, 203-1. 8. Zhang, C.-C. (1996) Bacterial signalling involving eukaryotic-type protein kinases, Mol. Microbiol. 20, 9-15. 9. Braibant, M., Lefkvre, P,De Wit, L., Peirs, P., Ooms, J., Huygen, K., Andersen, A. B. & Content, J. (1996) A Mycobacterium tuberculosis gene cluster encoding proteins of a phosphate transporter homologous to the Escherichia coli Pst system, Gene (Amst.) 176, 171-176. 10. Braibant, M., Lefevre, P., De Wit, L., Ooms, J., Peirs, P., Huygen, K., Wattiez, R. & Content, J. (1996) Identification of a second zyxwvut 61 2 zyxwvuts zyxwvuts zyxwvutsrqpo zyxwvutsrqpo zyxwvu zyxwvutsr Peirs et al. (Eui: J. Biochem. 244) Mycobacterium tuberculosis gene cluster encoding proteins of an ABC phosphate transporter, FEBS Lett. 394, 206-212. 11. Hanks, S. K. & Hunter, T. (1995) Protein kinases 6. The eukaryotic protein kinase superfamily : kinase (catalytic) domain structure and classification, FASEB J. 9, 576-596. 12. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratory handbook, 2nd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY. 13. Braibant, M., De Wit, L., Peirs, P., Kalai, M., Ooms, J., Huygen, K. & Content, J. (1994) Structure of the Mycobacterium tuberculosis antigen 88: a protein related to the Escherichia coli PstA periplasmic phosphate permease subunit, Infect. Immun. 62,849854. 14. Barr, P. J., Thayer, R. M., Layboum, P., Najarian, R. C., Seela, D. & Tolan, D. R. (1986) 7-deaza-2’-deoxyguanosine-5’-triphosphate: enhanced resolution in M13 dideoxy sequencing, Biotechniques 4, 428-432. 15. Marck, C. (1988) ‘DNA Strider’: a ‘C’ program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers, Nucleic Acids Res. 16, 1829- 1836. 16. Devereux, J., Haeberli, P. & Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the VAX, Nucleic Acids Res. 12, 387-395. 17. Bashyam, M. D. & Tyagi, A. K. (1994) An efficient and high yielding method for isolation of RNA from Mycobacteria, Biotechniques 17, 834-836. 18. Jukes, T. H. & Cantor, C. R. (1969) Evolution of protein molecules, in Mammalian protein metabolism (Munro, H. N., ed.) pp. 21 132, Academic Press, New York. 19. Swofford, D. L. & Olsen, G. J. (1990) Phylogeny reconstruction, in Molecular systematics (Hillis, D. M. & Moritz, C., eds) pp. 411501, Sinauer Associates, Sunderland MA. 20. Felsenstein, J. (1 989) PHYLIP - phylogeny inference package (version 3.2), Cladistics 5, 164-166. 21. Claros, M. G. & von Heijne, G. (1994) TopPred 11: an improved software for membrane protein structure predictions, Comput. Appl. Biosci. 10, 685-686. 22. Anderson, H., Bakker, E. & von Heijne, G. (1992) Different positively charged amino acids have similar effects on the topology of a polytopic transmembrane protein in Escherichia coli, J. Biol. Chem. 267, 1491- 1495. 23. Munoz-Dorado, J., Inouye, S. & Inouye, M. (1991) A gene encoding a protein serinekhreonine kinase is required for normal development of M. xanthus, a gram-negative bacterium, Cell 67, 9951006. 24. Ingraham, J. L., Maaloe, 0. & Neidhardt, F. C. (1983) Growth oj the bacterial cell, Sinauer Associates Inc., Sunderland MA. 25. Toullec, D., Pianetti, P., Coste, H., Bellevergue, P., Grand-Perret, T., Ajakane, M., Baudet, V., Boissin, P., Boursier, E., Loriolle, F. & Duhamel, L., Charon, D. & Kirilovsky, J. (1991) The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C, J. Biol. Chem. 266, 15771-15781. 26. Hong, S. K., Matsumoto, A,, Horinouchi, S. & Beppu, T. (1993) Effects of protein kinase inhibitors on in v i m protein phosphorylation and cellular differentiation of Streptomyces griseus, Mol. & Gen. Genet. 236, 347-354. 27. Galyov, E. E., Hakansson, S., Forsherg, A. & Wolf-Watz, H. (1993) A secreted protein kinase of Yersinia pseudotuberculosis is an indispensable virulence determinant, Nature 361, 730-732. 28. Galyov, E. E., Hakansson, S. & Wolf-Watz, H. (1994) Characterization of the operon encoding the YpkA Ser/Thr protein kinase and the YopJ protein of Yersiniu pseudotuberculosis, J. Bacteriol. 176, 4543-4548. 29. Zhang, W., Munoz-Dorado, J., Inouye, M. & Inouye, S. (1992) Identification of a putative eukaryotic-like protein kinase family in the developmental bacterium Myxococcus xanthus, J. Bacteriol. 174, 5450-5453. 30. Zhang, C.-C. (1993) A gene encoding a protein related to eukaryotic protein kinases from the filamentous herterocystous cyanobacterium Anabaena PCC 7120, Proc. Nut1 Acad. Sci. USA 90, 11 840- 11 844. 31. Cozzone, A. J. (1988) Protein phosphorylation in prokaryotes, Annu. Rev. Microbiol. 42, 97-125. 32. Adler, S. P., Purich, D. & Stadtman, E. R. (1975) Cascade control of Escherichia coli glutamine synthetase. Properties of the PI1 regulatory protein and the uridylyltransferase-uridylyl-removing enzyme, J. Biol. Chem. 250, 6264-6272. 33. Forchhammer, K. & Tandeau de Marsac, N. (1994) The PI1 protein in the cyanobacterium S.ynechococcus sp. strain PCC 7942 is modified by serine phosphorylation and signals the cellular Nstatus, J. Bacteriol. 176, 84-91. 34. Forchhammer, K. & Tandeau de Marsac, N. (1995) Phosphorylation of the PI1 protein (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942: analysis of in vitro kmase activity, J . Bacteriol. 177, 5812-5817. 35. Forchhammer, K. & Tandeau de Marsac, N. (1995) Functional analysis of the phosphoprotein PI1 (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942, J. Bacteriol. 177, 2033 -2040. 36. Ye, J. J., Reizer, J., Cui, X. & Saier, M. Jr (1994) Inhibition of the phosphoenolpyruvate :lactose phosphotransferase system and activation of a cytoplasmic sugar-phosphate phosphatase in Lactococcus lactis by ATP-dependent metabolite-activated phosphorylation of serine 46 in the phosphocanier protein HPr, J. Biol. Chem. 269, 11 837-11 844. 37. Ye, J. J., Reizer, J. & Saier, M. Jr (1994) Regulation of 2-deoxyglucose phosphate accumulation in Lactococcus lactis vesicles by metabolite-activated, ATP-dependent phosphorylation of serine46 in HPr of the phosphotransferase system, Microbiology (N. )!I 140, 3421-3429. 38. Ye, J. J. & Saier, M. Jr (1995) Cooperative binding of lactose and the phosphorylated phosphocarrier protein HPr(Ser-P) to the lactose/H+ symport permease of Lactobacillus brevis, Proc. Nut1 Acad. Sci. USA 92, 417-421. 39. Jayanthi Bai, N., Ramachandra Pai, M., Suryanarayana Murthy, P. & Venkitasubramanian, T. A. (1975) Fructose diphosphate aldolase from Mycobacterium smegmatis. Functional similarities with rabbit muscle aldolase, Arch. Biochem. Biophys. 168, 235-239. 40. Stock, J. B., Ninfa, A. J. & Stock, A. M. (1989) Protein phosphorylation and regulation of adaptive response in bacteria, Microbiol. Rev. 53,450-490. 41. Janda, L., Tichy, P., Spizek, J. & Petrickek, M. (1996) A deduced Thermomonospora curvata protein containing serinekhreonine protein kinase and WD-repeat domains, J. Bacteriol. 178, 14871489. 42. Hakansson, S., Galyov, E. E., Rosqvist, R. & Wolf-Watz, H. (1996) The Yersinia YpkA Ser/Thr kinase is translocated and suhsequently targeted to the inner surface of the Hela cell plasma membrane, Mol. Microbiol. 20, 593-603. 43. Reference deleted. 44. Wanner, B. L. (1996) Signal transduction in the control of phosphate-regulated genes of Escherichia coli, Kidney Int. 49, 964967. 45. Balasubramanian, V., Pavelka, M. S. J.: Bardarov, S. S., Martin, J., Weisbrod, T. R., McAdam, R., Bloom, B. R. & Jacobs, W. R. J. (1996) Allelic exchange in Mycobacterium tuberculosis with long linear recombinant substrate, J. Bacteriol. 178, 273 -279. 46. Philipp, W. J., Poulet, S., Eiglmeier, K., Pascopella, L., Balasubramanian, V., Heym, B., Bergh, S . , Bloom, B. R., Jacobs, W. R. & Cole, S. T. (1996) An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis H37Rv, and comparison with Mycobucterium leprae, Proc. Nail Acad. Sci. USA 93, 3132-3137. zyxwvutsrqp zyxwvu