Botanical Journal of the Linnean Society, 2008, 157, 223–238. With 21 figures New taxa of Chlorophytum (Anthericaceae) from southern tropical Africa with notes on their sister group relationships 1 Natural History Museum, University of Oslo, PO Box 1172, Blindern, N-0318 Oslo, Norway Department of Biosciences, University of Zimbabwe, PO Box MP167, Mount Pleasant, Harare, Zimbabwe 3 Department of Biology, University of Oslo, PO Box 1066, Blindern, N-0316 Oslo, Norway 2 Received 28 November 2006; accepted for publication 28 November 2007 Six new taxa of Chlorophytum (five from Zambia and one from Malawi) are described, namely C. bulbinifolium Hoell & Nordal, C. zambiense Bjorå & Nordal, C. chelindaensis Kativu & Nordal, C. clarae Bjorå & Nordal, C. blepharophyllum Schweinf. ex Baker ssp. rubropygmaeum Bjorå & Nordal, and C. blepharophyllum Schweinf. ex Baker ssp. pendulum Hoell & Nordal. The sister group relationships of the new taxa were studied by cladistic analyses of nuclear and chloroplast DNA sequences. Chlorophytum bulbinifolium has an isolated position in the cladogram. It is morphologically closest to C. subpetiolatum (Baker) Kativu, but differs by its narrow succulent leaves and smaller flowers. Chlorophytum zambiense is nested with C. andongense Baker, C. macrosporum Baker, and C. viridescens Engl., but differs by being more slender and by having ebracteate peduncles and smaller flowers. Chlorophytum chelindaensis belongs in the C. colubrinum Engl. complex, differing from C. colubrinum by its small habit and hairy leaves. Chlorophytum clarae is in a clade with C. pusillum Schweinf. ex Baker and C. pauper Poelln. It is morphologically closest to C. macrophyllum Asch., but has globose capsules and smaller irregularly folded seeds. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238. ADDITIONAL KEYWORDS: Malawi – new species – phylogeny – species delimitation – Zambia. INTRODUCTION The genus Chlorophytum was revised for the Flora Zambesiaca area by Kativu (1994). This work is now being updated and extended to conform with the format of Flora Zambesiaca (Kativu et al., 2008). So far, the description and delimitation of Flora Zambesiaca taxa from Malawi and Zambia (and also from Botswana and Mozambique) have been based mainly on earlier descriptions and herbarium material. It became obvious that fieldwork was necessary to obtain a sound taxonomic delimitation and better biological information on the taxa. From this background, the authors undertook substantial fieldwork *Corresponding author. E-mail: charlotte.bjora@nhm.uio.no in Malawi and Zambia during the period 2002–2005. The fieldwork resulted in about 120 Chlorophytum collections representing 32 taxa, with several representing new records of the taxa concerned and six neither fitting with the type material studied nor with the taxa reported in the relevant literature: Obermeyer (1962) on South African plants, Hepper (1968) on West African plants, Nordal & Thulin (1993) on plants from the Horn of Africa, Kativu (1994) on plants from the Flora Zambesiaca area, Nordal (1997) on Ethiopian/Eritrean plants, Nordal, Kativu & Poulsen (1997) on East African plants, and Poulsen & Nordal (2005) on Guineo-Congolean rainforest plants. In parallel with the field studies, material of Chlorophytum taxa from the whole of tropical Africa was analysed using molecular data (nuclear DNA (ITS1) and chloroplast DNA (trnL–F spacer)). © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 223 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 CHARLOTTE S. BJORÅ1*, GRY HOELL1, SHAKKIE KATIVU2 and INGER NORDAL3 224 C. S. BJORÅ ET AL. MATERIAL AND METHODS During previous work on Chlorophytum of Flora Zambesiaca and Flora of Tropical East Africa, two of us (S. Kativu and I. Nordal) examined all available material (including types) of Chlorophytum from B, BM, BR, C, EA, ETH, FT, K, O, P, PRE, SRGH, TO, UPS, WAG, and Z. Notes taken during these studies are the basis for comparison with six putative undescribed taxa from Malawi and Zambia. The DNA analyses were carried out on plants representing more than 50 populations that included the six unmatched taxa. The plants were described in the field, photographed and pressed. Leaf material was preserved in silica gel for DNA extractions. Further material was collected from greenhouse and herbarium material at the University of Oslo (Table 1). Total genomic DNA was extracted from leaf samples using Qiagen’s DNeasy Kit, following the manufacturer’s instructions. PCR amplification of the chloroplast trnL–F spacer was carried out using primers ‘E’ and ‘F’ of Taberlet et al. (1991), and the nuclear ITS1 region was amplified using ‘ITS5mod (GGAAGGAGAAGTCGTAACAAGG)’ and ‘ITS2mod (GCTACGTTCTTCATCGATGC)’, modified from White et al. (1990). Cycle sequencing of the amplified products was conducted with the BigDye Terminator Sequencing Kit (PE Applied Biosystems) using 2.5 ng of primer in a 5 mL reaction volume. Sequencing reaction products were purified using Princeton Separations Centri Sep Spin Columns, according to the manufacturer’s manual. Finally, the samples were applied to a microamp reaction plate with 10 mL HiDi per sample, and run on an ABI PRISM 3100 automated sequencer. Electropherograms were edited and complementary strands were compared using Sequencher™ (Version 4.0.5, Gene Code Corporation). The sequences were manually aligned using the BioEdit Sequence Alignment Editor. GenBank accession numbers for the sequences are given in Table 1. Further details on the techniques can be found in Bjorå, Kwembeya & Nordal (2006). The cladistic analysis was performed using parsimony in Nona (Version 2.0, P.A. Goloboff, http:// www.cladistics.com), via Winclada (Nixon, 1999). Agave attenuata Salm-Dyck was selected as outgroup. Studies by Givnish et al. (2006) have shown that the genus Agave is a suitable outgroup. The maximum parsimony analyses were conducted using the following Winclada settings: heuristic search algorithm with branch swapping holding a maximum of 10 000 trees, with 1000 replications; one starting tree per replication; a repeated unconstrained search strategy through tree searching using the multiple TBR + TBR (mult* max*) search strategy. All molecular characters were assessed as independent, unordered, and equally weighted (Fitch parsimony; Fitch, 1971). To estimate support for internal branches, parsimony jackknifing was performed using 1000 replicates and the number of search replications to 5000 max trees. RESULTS PHYLOGENY The maximum parsimony analysis based on the trnL–F data set resulted in 12 most-parsimonious trees (MPTs) of 94 steps each, with a consistency index (CI) of 0.91 and a retention index (RI) of 0.90. Of the 305 characters, 25 were parsimony informative. The analysis based on the ITS data set resulted in 24 MPTs of 475 steps each (CI = 0.61, RI = 0.67). Of the 320 characters, 118 were parsimony informative. There was no strong incongruence between the strict consensus trees based on the two regions. The tree based on trnL–F was slightly less resolved than the tree based on the ITS region. In the combined analysis of the two data sets, the 614 characters (143 of which were parsimony informative) resulted in ten MPTs of 573 steps (CI = 0.66, RI = 0.70). In the strict consensus tree of the combined analysis (Fig. 1), the putative undescribed species, Chlorophytum sp. A, resolves as sister to the rest of the ingroup. The sister clade of Chlorophytum sp. A is, however, not strongly supported [jackknife support (JK) = 57]. Morphologically, Chlorophytum sp. A shares traits with C. subpetiolatum in having a prominent moniliform © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 These results have so far only been communicated in an MSc Thesis from the University of Oslo (Hoell, 2005; work that will be expounded through both taxonomic and molecular studies by C. S. Bjorå, G. Hoell, A. K. Bysting, S. Kativu, B. Stedje & I. Nordal, unpubl. data). A relevant subset of taxa based on the work of Hoell (2005) is used here as a basis for comparison, and as a means to indicate the sister species relationships of the putative undescribed taxa. The taxonomic concept follows Flora Nordica (Jonsell, 2000): ‘Taxa are treated as species if they differ in at least two presumably independent morphological characters and are more or less completely separated by a barrier – geographical and/or ecological, phenological or genetical. Subspecies is used for geographical variants within a species. Subspecies differ in at least two presumably independent morphological characters.’ Accordingly, the aim of this article is to justify the description of six new taxa (preliminarily referred to here as taxa A–F), and to discuss their taxonomic status and sister group relationships. GenBank accession no. Taxon Specimen voucher (Herb) Locality Coordinates and altitude (m) ITS1 trnL–F Agave attenuata Salm-Dyck C. affine Baker C. africanum Engl. Nordal & Bjorå 4552 (O) A.Bjørnstad 2054 (O) 09°51′10″S, 28°56′40″E, 1160 07°45′S, 34°12′E U23998 EF999985 EF999986 DQ500932 EU000019 EU000020 Hoell & Nordal 30 (O) Hoell & Nordal 22 (O) Zambia, N: Ntumbachusi Falls Tanzania, T7: Mbeya D., Magangwe Zambia, B: Kabompo District Zambia, B: Lukulu road 13°35′49″S, 24°13′34″E, 1083 14°38′35″S, 24°27′31″E, 1140 EF999987 EF999988 EU000021 EU000022 Hoell & Nordal 24 (O) Zambia, B: Lukulu road 14°38′08″S, 24°26′09″E, 1140 EF999989 EU000023 Mitchel 35 (O) Nordal & Bjorå 4535 (O) Nordal 3803 (O) Zambia: Sientambo, Kalome Zambia, C: Kasanka South Africa: Cape, Grootvatersbosch Zimbabwe, Cult. in Harare 12°41′32″S, 30°24′01″E EF999990 EF999991 EF999992 EU000024 EU000025 EU000026 EF999993 EU000027 C. andongense Baker C. blepharophyllum Schweinf. ex Baker 1 C. blepharophyllum Schweinf. ex Baker 2 C. colubrinum Engl. 2 C. colubrinum Engl. 1 C. comosum (Thunb.) Jacques 1 C. comosum (Thunb.) Jacques 2 C. filipendulum Baker C. floribundum Baker C. gallabatense Schweinf. ex Baker C. galpinii (Baker) Kativu C. geophilum Peter ex Poelln. C. leptoneurum (C.H. Wright) Poelln. C. longifolium Schweinf. Poulsen 956 (AAU) 01°56′S, 31°44′E, 950 m EF999994 EU000028 Hoell & Nordal 14 (O) Hoell & Nordal 25 (O) Uganda, U2: Masindi District, Budongo Forest Reserve Zambia, B: Sesheke Zambia, B: Lukulu road 17°21′53″S, 24°09′04″E, 980 14°38′08″S, 24°26′09″E, 1140 EF999995 EF999996 EU000029 EU000030 Hoell & Nordal 17 (O) Hoell & Nordal 26 (O) Nordal & Bjorå 4568 (O) Zambia, B: Liyoyelo to Mongu Zambia, B: Lukulu road Zambia, N: Kundabwika Falls 15°10′48″S, 22°52′09″E, 1033 14°31′07″S, 24°15′43″E, 1090 09°13′04″S, 29°18′16″E, 1040 EF999997 EF999998 EF999999 EU000031 EU000032 EU000033 Nordal 1507 (O) Zimbabwe, S: Maswingo, near Great Zimbabwe Ethiopia: 51 km E of Nekemte 20°05′S, 30°50′E EU000001 EU000034 EU000002 EU000035 Nordal 1033 (O) 225 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 C. macrophyllum Asch. Nordal 3162 (O) NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Table 1. Species included in morphological and molecular analyses of Chlorophytum, with voucher information and GenBank sequence accession numbers indicated. Geographical divisions following the regional African Floras are indicated after country. 226 GenBank accession no. Specimen voucher (Herb) Locality Coordinates and altitude (m) ITS1 trnL–F C. macrorrhizum Poelln. Nordal & Bjorå 4521 (O) 10°23′02″S, 33°47′20″E EU000003 EU000036 C. macrosporum Baker C. pauper Poelln. C. polystachys Baker Kativu 255 (O) Hoell & Nordal 13 (O) Hoell & Nordal 7 (O) 18°08′S, 30°08′E 17°21′53″S, 24°09′04″E, 980 17°25′37″S, 26°05′60″E EU000004 EU000005 EU000006 EU000037 EU000038 EU000039 C. pusillum Schweinf. ex Baker C. silvaticum Dammer C. sphachelatum (Baker) Kativu C. subpetiolatum (Baker) Kativu C. suffruticosum Baker Nordal & Bjorå 4567 (O) Malawi: Nyika, near Zambian border Zimbabwe, C: Chegutu Zambia, B: Sesheke Zambia, S: S of Zimba, Monachongwe farm Zambia, N: E of Mununga Bridge Kenya, K3: Near Gilgil Zambia S: S of Zimba, Monachongwe farm Zambia, B: Road to Mouyo 09°05′34″S, 29°11′00″E, 1000 EU000007 EU000040 00°31′31″S, 36°20′19″E 17°25′37″S, 26°05′60″E EU000008 EU000009 EU000041 EU000042 15°33′40″S, 23°16′25″E, 1072 EU000011 EU000044 A.Bjørnstad 2804 (O) EU000010 EU000043 C. viridescens Engl. Nordal & Bjorå 5012 (O) 03°03′37″S, 37°02′31″E EU000012 EU000045 Chlorophytum sp. A Hoell & Nordal 62 (O, K, SRGH) Nordal & Bjorå 4538 (O) Nordal & Kativu 4506 (O, MAL, SRGH) Nordal & Bjorå 4542 (O) Nordal & Bjorå 4578 (O) Hoell & Nordal 19 (O, K) 09°51′14″S, 28°56′50″E, 1190 EU000013 EU000046 12°03′00″S, 29°39′25″E, 1180 10°40′S, 33°52″E EU000014 EU000015 EU000047 EU000048 12°03′00″S, 29°39′25″E, 1185 09°15′41″S, 29°23′52″E, 1130 15°01′29″S, 24°06′43″E, 1138 EU000016 EU000017 EU000018 EU000049 EU000050 EU000051 Chlorophytum sp. B Chlorophytum sp. C Chlorophytum sp. D Chlorophytum sp. E Chlorophytum sp. F Nordal & Bjorå 4621 (O) Hoell & Nordal 2 (O) Hoell & Nordal 15 (O) Kenya, K7: Teita D., 51 km NW of Voi Tanzania, T2: Moshi–Arusha road Zambia, N: Ntumbachusi Falls Zambia, N: E of Mununga Malawi, N: Nyika Plateau, Chelinda Hill Zambia, N: Mansa Zambia, N: W of Mporokoso Zambia, B: Mongu to Mufwaya, Loyi Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Taxon C. S. BJORÅ ET AL. Table 1. Continued NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) 227 Agave attenuata Chlorophytum sp. A C. affine 97 100 I C. polystachys C. suffruticosum 96 57 II C. subpetiolatum C. galpinii 100 C. sphacelatum C. viridescens C. macrosporum 93 IV 66 C. andongense Chlorophytum sp. B C. leptoneurum C. longifolium 99 C. africanum 63 V 95 C. silvaticum 68 C. colubrinum 1 98 Chlorophytum sp. C 85 C. colubrinum 2 C. macrorrhizum 93 C. geophilum 92 C. comosum 1 C. comosum 2 59 C. gallabatense C. floribundum 93 57 C. filipendulum C. macrophyllum VI C. pauper 55 C. pusillum Chlorophytum sp. D C. blepharophyllum 1 99 C. blepharophyllum 2 Chlorophytum sp. E Chlorophytum sp. F Figure 1. Strict consensus of ten most-parsimonious trees found by phylogenetic analysis of combined plastid trnL–F spacer and nuclear ITS 1 rDNA. Consistency index, 0.66. Retention index, 0.70. Length, 573. Jackknife values are shown above the branches. rhizome, fat fusiform roots, star-shaped flowers, and capsules with transverse ridges. Clade I (JK = 97) comprises two species, both characterized by having distichous leaves. The next two clades (II, JK = 96; III, JK = 100) include species that were previously referred to the genus Anthericum sensu Marais & Reilly (1978) (see Kativu & Nordal, 1993). Clade IV includes the species C. viridescens, C. macrosporum, and C. andongense. These are characterized by having thick roots without tubers, leaves borne on the entire peduncle, and a conspicuously branched inflorescence. Taxon B is nested within this © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 III 58 228 C. S. BJORÅ ET AL. UNDESCRIBED TAXA Taxon A These plants were collected close to Ntumbachushi Falls in the Northern Region of Zambia (Hoell & Nordal 62). They differ from C. subpetiolatum in having narrow succulent leaves, about 1 mm wide, resembling those of Bulbine abyssinica A. Rich. This trait has not previously been found in Chlorophytum. In addition, the lower internode in the inflorescence is 2.5–5 cm in Taxon A and less than 2 cm in C. subpetiolatum. The tepals are 5–7 mm in Taxon A and 7.5– 15 mm in C. subpetiolatum. We believe that these plants deserve recognition at the species rank. Chlorophytum bulbinifolium Hoell & Nordal, sp. nov. Diagnosis: Plantae C. subpetiolato affine, sed foliis succulentis et angustioribus, latitudione 0.5–1 mm, non 5–20 mm; inflorescentia laxiore et floribus minoribus, tepalis 5–8 mm, non 8–15 mm. Type: Zambia, Northern Region, Ntumbachushi Falls, 9°51′14″S, 28°56′50″E, 1190 m, 6.xii.2005, Hoell & Nordal 62 (O, holotype; K, SRGH, isotypes) (Figs 2, 14, 15). Description: Perennial herbs, 25–35(-55) cm high, with rhizomes to c. 10 cm, crowned with fibres from old leaf bases, with 5–7 mm thick fusiform roots. Leaves glabrous, in basal rosette, to 12 cm ¥ 0.5– 1 mm, semiterete, filiform, succulent, canaliculate. Peduncle without leaves, to 20 cm. Raceme lax, to 15 cm with 1–2(-4) flowers per node. Floral bracts green, c. 5 ¥ 1 mm. Pedicels c. 6 mm, articulation near the middle, light green above and light brown below the articulation point. Tepals white, 5–7 mm long, outer whorl c. 2 mm wide with three to five veins, inner whorl 4–5 mm wide, with one to three brownish veins, persistent and covering the ovary after anthesis. Filaments c. 5 mm, anthers 2–3 mm. Capsule trigonous in cross-section, transversely ridged, to c. 4 ¥ 5 mm, covered by the persistent perianth. Seeds black, irregularly folded, c. 2 mm in diameter. The species is so far only known from the type locality. It was found on sandy soils in open patches in Brachystegia woodland. Taxon B Material belonging to this taxon has previously been confused with C. polystachys Baker (as in Kativu, 1994); the differences are sometimes difficult to assess on herbarium material. Taxon B has thick roots without tubers (like the other taxa in the C. andongense clade, where it is nested; see Fig. 1). Chlorophytum polystachys, however, has wiry roots with distal tubers. The leaf arrangement in the new species is rosulate, but distichous in C. polystachys, and the leaf margin is glabrous in the new species, but ciliate in C. polystachys. The pedicel is articulated at or above the mid-point in Taxon B, and below the mid-point in C. polystachys. Taxon B is found in a clade consisting of C. andongense, C. macrosporum, and C. viridescens; only the first two occur in Zambia. Taxon B is less robust than C. andongense and C. macrosporum. Taxon B is 40–60 cm high, with a leaf width of 0.5–1 cm and a peduncle width to 2 mm. The other two taxa are more than 65 cm high, with a leaf width of 3–9 cm and a peduncle width of more than 4 mm. The new species lacks the bracteate peduncle that is otherwise found in the species of the C. andongense clade. Taxon B has 1–3-nate flowers, with tepals to 5 mm. Chlorophytum andongense and C. macrosporum have 4–9-nate flowers, with tepals of (9–)12–20 mm. The capsules are 3–4 mm in Taxon B, and more than 10 mm in C. andongense and C. macrosporum. Taxon B grows in waterlogged areas; thus, it differs from most Chlorophytum species in its habitat. There is no doubt that Taxon B deserves recognition at the species rank. Chlorophytum zambiense Bjorå & Nordal, sp. nov. Diagnosis: Plantae C. andongensi affine sed gracilioribus usque ad 60 cm, non 65–200 cm, foliis angustioribus, latitudione 0.5–1 cm, non 3–9 cm; pedunculis nonbracteato; floribus 1–3-nateribus; tepalis breviori- © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 clade, which is referred to here as the C. andongense clade. Clade V (JK = 99) includes taxa formerly (until Marais & Reilly, 1978) referred to the genus Dasystachys. These are characterized by more or less bellshaped flowers, triangular to triquetrous capsules, and flat or saucer-shaped seeds. Clade V includes the species C. leptoneurum (C.H. Wright) Poelln., C. longifolium Schweinf., C. silvaticum Dammer, C. africanum Engl., C. colubrinum, and C. macrorrhizum Poelln. Taxon C is nested within this clade, hereafter referred to as the Dasystachys clade. Clade VI (JK = 93) includes Chlorophytum species with a basic chromosome number of x = 7 (taxa mentioned above generally have x = 8). This clade is hereafter referred to as the x = 7 clade. Most rainforest taxa, including several forest margin/woodland taxa, belong to this clade. The x = 7 clade includes widespread taxa, such as C. comosum (Thunb.) Jacques, C. filipendulum Baker, C. macrophyllum, C. gallabatense Schweinf. ex Baker, and C. blepharophyllum. Taxon D is found within this clade, together with species such as C. pusillum and C. pauper. Taxon E and Taxon F are included in the same subclade with C. blepharophyllum. NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) 229 A B C D 6 cm Figure 2. Chlorophytum bulbinifolium Hoell & Nordal. Drawing based on Hoell & Nordal 62 (O, holotype). A, Habit; B, detail of flower; C, capsule covered by persistent perianth; D, capsule with persistent perianth removed. Drawing by Svetlana Voronkova. bus, usque ad 5 mm, non 12–20 mm, capsulis brevioribus, usque ad 4 mm, non 5–9 mm. Type: Zambia, Northern Region, Bangweulu Floodplain, north of Mukuku Bridge, 1180 m, 12°03′00″S, 29°39′25″E, floodplain with Crinum verdoorniae Lehmiller., Kniphofia sp., and Bulbine sp., 4.xii.2002, Nordal & Bjorå 4538 (O, holotype) (Fig. 3). Description: Plants from a short to c. 12 cm rhizome with 2–5 mm thick roots without tubers. Leaves glabrous, in basal rosettes, lanceolate, 12–30 ¥ c. 1 cm wide. Peduncle without leaves, 25–45 cm and c. 2 mm wide. Inflorescence 10–15 cm long, branched, with short bracts, 3–10 mm. Pedicels c. 5 mm long, articulated at or above the middle, 2–3(-4) flowers per node. Flowers urceolate, greenish to brownish, tepals © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 1 cm 230 C. S. BJORÅ ET AL. A B 1 cm 0.5 cm 5 cm Figure 3. Chlorophytum zambiense Bjorå & Nordal. Drawing based on Nordal & Bjorå 4538 (O, holotype). A, Habit; B, detail of flower; C, capsule. Drawing by Svetlana Voronkova. reflexed, c. 5 ¥ 1 mm, each with three veins. Filaments c. 4 mm, anthers 1 mm. Capsules three-lobed in cross-section, transversely ridged, 3–4 ¥ 4–5 mm. Seeds flat and folded, c. 3 mm in diameter. The species is found scattered in waterlogged habitats; so far only known from Zambia. with sedges, Rensburg 2684 (K); north of Lusaka, Concord Ranch, 2 miles south of Chisamba Stn., dambo, 6.i.1958, Benson 217 (K); Kasama Distr., path to Chambeshi flats via Mbwayalola village, 10.xii.1964, in marsh, on dried mud, Richards 19343 (K). Specimens examined: Zambia, Machili Distr, Machili, 24.xii.1960, Fanshawe 6010 (K) and 21.i.1961, moist dambo, Fanshawe 6240 (K); edge of Kafue floodplain Taxon C This population (Nordal & Kativu 4506), collected at the Nyika Plateau in Malawi, is found on a branch © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 C NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) 231 A B 1 cm Figure 4. Chlorophytum chelindaensis Kativu & Nordal. Drawing based on Nordal & Kativu 4506. (O, holotype). A, Habit; B, detail of flower. Drawing by Svetlana Voronkova. nested within a clade that includes C. colubrinum and C. macrorrhizum (Dasystachys clade). Taxon C is a slender plant, 6–12 cm high, and in that respect similar to C. macrorrhizum and C. leptoneurum, whereas C. colubrinum is 16–145 cm. Chlorophytum leptoneurum differs from the other species through its stoloniferous habit, and lack of purple coloration. Furthermore, it has a hairy peduncle, a trait shared with C. macrorrhizum. Depauparate specimens of C. africanum might further be confused with the three dwarf taxa mentioned above. Chlorophytum africanum is, however, distinguished by its fusiform, dilated filaments, the declinate style, totally glabrous leaves, and the larger capsules. Except for the slender habit, Taxon C appears to be most closely related to C. colubrinum, with which it shares traits such as leaves produced along the entire peduncle, and a characteristic pattern of red stripes at the outer leaf bases. Apart from its reduced size, it differs from the glabrously leaved C. colubrinum through leaves which bear stiff hairs on the abaxial leaf veins. Questions might arise about whether Taxon C deserves species or subspecies rank (within the otherwise widespread and heterogeneous C. colubrinum complex). Taxon C is easily recognizable and distinct, just as C. macrorrhizum, for example. This justifies its recognition at the species level. Chlorophytum chelindaensis Kativu & Nordal, sp. nov. Diagnosis: Plantae C. colobrino affine, sed gracilioribus usque ad 12 cm, non 16–145 cm; foliis pilosis; C. macrorrhizo affine sed pedunculo glabro; staminibus tepalis excedentibus. Type: Malawi, Nyika Plt., on slopes of Mt. Chelinda, in montane grassland, 10°40′S, 33°52′E, flowering 26.xi.2002, Nordal & Kativu 4506 (O, holotype; SRGH isotype) (Figs 4, 16). Description: Plants small, 6–12 cm high, from a moniliform rhizome. Roots 1–2 mm thick. Leaves rosulate, erect, linear, setose on the nerves below, glabrous above, 6–12 cm ¥ c. 2 mm, acute; cataphylls with reddish stripes or spots. Peduncle 3–8 cm, terete, glabrous, smooth, with ± bract-like leaves with red ciliate margin along its entire length. Inflorescence dense, subspicate, 3–4 cm. Floral bracts lanceolate, ciliate on the margins, 5–6 mm, purple, with a white central nerve, or appearing white and with purple margins. Pedicels solitary on the node, c. 2 mm, apparently without articulation. Perianth campanulate, tepals c. 5 ¥ 1 mm, one-nerved. Stamens exerted; anthers small, shorter than one-quarter of the length of the filament. Capsule and seeds not seen. The species is found in montane grassland on shallow soils overlying rock. It is so far only known from the Nyika Plateau in Malawi. It is named after Chelinda Hill, where it appears to be fairly common in suitable habitats. Taxon D This taxon is found within the x = 7 clade, in a not highly supported clade (JK = 59) also including © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 5 cm 232 C. S. BJORÅ ET AL. A 10 cm 3 cm Figure 5. Chlorophytum clarae Bjorå & Nordal. Drawing based on Nordal & Bjorå 4542 (O, holotype). A, Habit. B, detail of flower. Drawing by Svetlana Voronkova. C. pusillum and C. pauper. Morphologically, it resembles C. macrophyllum, being broad-leaved, with a dense large-flowered inflorescence, pedicels white above the articulation, white flowers, and anthers longer than the filaments. The differences are found in the capsules and seeds. Taxon D has almost globose capsules, whereas those of C. macrophyllum are trigonous in cross-section. The seeds of Taxon D are irregularly folded and 1.6–2 mm in diameter, whereas those of C. macrophyllum are flat to saucer-shaped and 1.7–2.8 mm in diameter. Chlorophytum pusillum consists of small plants with prostrate leaves, and cannot be confused with Taxon D. Compared with C. pauper, Taxon D has more leaves to a plant (three to six and seven to ten, respectively), is glabrous on the leaf margins, and has longer pedicels (to 7 mm and 12–15 mm, respectively). The taxon might be difficult to distinguish from C. macrophyllum in the absence of capsules and seeds. The sequence data used in this study do not seem to support any particular close relationship. It is accordingly justified to recognize Taxon D at the species level. The species is named in memory of Clara Chisongo, a herbarium technician from the Mt. Makulu Herbarium in Lusaka, who accompanied us on the trip, when the type of this species was collected. Clara was dedicated and very eager to learn. She passed away a few weeks after our return from the field in January 2002. Chlorophytum clarae Bjorå & Nordal, sp. nov. Diagnosis: Plantae C. macrophyllo affine sed capsulis globosis et semenibus minoribus irregulatim plicatis. Type: Zambia: Northern Region, Mansa District, Mansa, 12°03′00″S, 29°39′25″E, altitude 1185 m, 4.xii.2002, Nordal & Bjorå 4542 (O, holotype) (Figs 5, 20, 21). Description: Herbs 25–50 cm high, from a short rhizome bearing 1–2.5 mm thick roots with lateral tubers. Leaves 7–10 to a plant, lanceolate, with a © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 B NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) 6 233 7 8 9 10 11 Figures 8–11. Figs 8, 9. Chlorophytum clarae Bjorå & Nordal. Fig. 8. From Zambia, Northern Region, Mansa District, Nordal & Bjorå 4542 (O, holotype). Fig. 9. From Tanzania, T4/7, Iringa/Ufipa District, Norbury G 28 (K). Figs 10, 11. Chlorophytum macrophyllum Asch. Fig. 10. From Ethiopia, Sebsebe D., & Ensermu, K. 2896 (ETH). Fig. 11. From Malawi, North Vipya, Pawek 4634 (K). distinct midrib, slightly glaucous below, green above, nerves prominent, particularly on lower surface. In a basal rosette, 10–55 ¥ 3.5–8.5 cm. Peduncle glabrous, 10–25 cm, inflorescence densely spicate, 16–25 cm, with two to five flowers per node. Floral bracts dominant, whitish, 2–2.5 cm, 1 cm wide at anthesis. Pedicels 12–15 mm with articulation above the middle, whitish above the articulation, greenish below or whitish all along, just a little green at the articulation. Tepals white, 9–10 mm, c. 2 mm wide. Filaments short, 2–3 mm; anthers, 5–6.5 mm. Capsule globose; seeds black, slightly folded, 1.6– 2 mm in diameter (Figs 7–9). Usually growing in shade, sometimes on termite mounds. Specimens examined: Zambia: Northern Region, Mansa District, Mansa, 12°03′0″S, 29°39′25″E, 1185 m, 4.xii.2002, Nordal & Bjorå 4542 (O); Mporokoso District, Lumangwe Falls, 09°32′37″S, 29°23′20″E, c. 1170 m, 8.xii.2005, Hoell & Nordal 90 (O). Tanzania: T4/7, Iringa/Ufipa District, Norbury G 28 (K). Taxa E and F These two taxa are found within the x = 7 clade, together with C. blepharophyllum, a species characterized by short cataphylls with ciliate margins, surrounding erect, linear to lanceolate leaves, and an erect inflorescence, unbranched or with a few lateral © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 Figures 6–7. Fig. 6. Chlorophytum macrophyllum Asch.: capsules from Ethiopia, Nordal 1033 (O). Fig. 7. Chlorophytum clarae Bjorå & Nordal: capsules from Zambia, Nordal & Bjorå 4542 (O holotype). 234 C. S. BJORÅ ET AL. B C 1 cm 1 cm Figure 12. Chlorophytum blepharophyllum Baker ssp. rubropygmaeum Bjorå & Nordal. Based on Nordal & Bjorå 4578 (O, holotype). A, Habit; B, detail of flower; C, capsule. Drawing by Svetlana Voronkova. branches. The infructescence is erect and the loculicidal opening only partial, thus giving ballistic seed dispersal. Taxon E differs from typical C. blepharophyllum through its well-developed, more or less reddish, prostrate cataphylls, with the true leaves not developed. As the cataphylls are the first leaves to develop, it is reasonable to assume that the relationship between the two taxa might be a result of neoteny. Typical Taxon E has been found in three populations in the Mporokoso area in northern Zambia, always growing together with typical C. blepharophyllum. In two of the populations, no intermediates were found, whereas, in the third, plants that are referred to Taxon E tended to develop a few more erect true leaves. Because of these intermediates, we have chosen to describe this taxon at the subspecies level, as C. blepharophyllum ssp. rubropygmaeum. Taxon F differs from typical C. blepharophyllum through its red leaf margins and hanging inflorescences/infructescences, which are interpreted as signifying non-ballistic seed dispersal. These plants have been collected in western Zambia. We have chosen to recognize them at the subspecies level. Chlorophytum blepharophyllum Baker ssp. rubropygmaeum Bjorå & Nordal, ssp. nov. Diagnosis: Plantae ssp. blepharophyllo dissimili foliis rubellis et prostratis. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 5 cm A NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) 235 10 cm Type: Zambia, Northern Region, west of Mporokoso, 09°15′41″S, 29°23′52″E, 1130 m, 10.xii.2002, Nordal & Bjorå 4578 (O, holotype) (Figs 12, 18, 19). Description: Plants small, 6–18 cm high, with roots 5–25 cm, crowned with fibres from older leaf bases. Roots 1–2 mm thick, bearing distal tubers. Leaves strongly sheathing, 3–5, ±prostrate, reddish below particularly on the veins, greenish or reddish above, broadly lanceolate to almost orbicular, often apiculate, with reddish, ciliate margins, 4–6(-15) ¥ 4– 6.5 cm. Peduncle 3.5–13 cm long, without leaves. Inflorescence dense, 2.5–5 cm, with two to three flowers per node. Pedicels 2–3 mm with articulation in upper half. Flowers brownish green, urceolate, tepals c. 8 mm long, outer tepals c. 1.5 mm wide and inner 2.5 mm wide. Capsules, 7–11 ¥ 6–9 mm, triquetrous with grooves along the fissures between the carpels. Known from three populations in Northern Zambia, in Brachystegia woodland often close to termite mounds. Specimens examined: Zambia, Northern Region, west of Mporokoso, 09°15′41″S, 29°23′52″E, 1130 m, 10.xii.2002, Nordal & Bjorå 4578 (O, holotype); Kapinta, 09°38′47.3″S, 29°23′39″E, 1230 m, 7.xii.2005, Hoell & Nordal 83 (O); 40 km west of Mporokoso, 09°25′50″S, 29°45′20″E, 1440 m, 8.xii.2005, Hoell & Nordal 97 (O). © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 Figure 13. Chlorophytum blepharophyllum Baker ssp. pendulum Hoell & Nordal. Based on Hoell & Nordal 19 (O, holotype). Drawing by Svetlana Voronkova. 236 C. S. BJORÅ ET AL. 15 16 17 19 18 20 21 Figures 14–21. Figs 14, 15. Chlorophytum bulbinifolium Hoell & Nordal (Hoell & Nordal 62). Photographs by G. Hoell. Fig. 16. Chlorophytum chelindaensis Kativu & Nordal (Nordal & Kativu 4506). Photograph by I. Nordal. Figs 17–19. Chlorophytum blepharophyllum Schweinf. ex Baker. Fig. 17. ssp. pendulum Hoell & Nordal (Hoell & Nordal 19). Photograph by G. Hoell. Figs 18, 19. ssp. rubropygmaeum Bjorå & Nordal (Nordal & Bjorå 4578, photograph by B. Stedje; Hoell & Nordal 97, photograph by G. Hoell). Figs 20, 21. Chlorophytum clarae Bjorå & Nordal (Nordal & Bjorå 4542). Photographs by C. S. Bjorå. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 14 NEW TAXA OF CHLOROPHYTUM (ANTHERICACEAE) Chlorophytum blepharophyllum Baker ssp. pendulum Hoell & Nordal, ssp. nov. Diagnosis: Plantae ssp. blepharophyllo dissimili foliis ad marginem rubellis; inflorescentia et infrutecentia pendulis. Description: Plants clumped, 30–40 cm high, from a short rhizome, crowned with fibrous remains of old leaf bases, with roots 1–2 mm thick carrying distal tubers. Leaves 3–7, erect, 17–40 ¥ 2–4 cm, linearlanceolate to broadly lanceolate, sheathing below, glabrous except for red cilia along margins; cataphylls short and brownish, with ciliate margin. Peduncle 14–18 cm, erect, terete, leafless, smooth. Inflorescence 4–12 cm, pendant, unbranched or with one to two branches at the base, two to three flowers per node. Floral bracts brownish, 4–11 ¥ 3 mm. Pedicels c. 2 mm long, with articulation in upper half. Flowers urceolate, brownish; tepals c. 9 mm long, outer whorl 2 mm wide with five to seven veins, inner whorl 3 mm wide with three to five veins. Stamens shorter than the perianth: anthers c. 2 mm, filaments 4 mm. Infructescence pendant; capsules triquetrous, 13–16 ¥ 8–11 mm. The species is only known from Barotseland, where it is found in woodland. DISTRIBUTION AND CONSERVATION The six new taxa are justified as outlined above. Of the 56 species of Chlorophytum in the Flora Zambesiaca area, 44 occur in Zambia and 32 in Malawi. Until now, the countries were not known to house any endemic species. Some 14 species are, however, near-endemic, occurring in northern Zambia, and often also in northern Malawi and south-western Tanzania, sometimes extending into the Katanga region of the Democratic Republic of Congo. In this article, we note the existence of two endemic species in Zambia (C. bulbinifolium and C. zambiense) and one in Malawi (C. chelindaensis), with one nearendemic (C. clarae) extending into south-western Tanzania. Of the endemic species, C. bulbinifolium and C. zambiense are particularly rare, only known from their type localities, where the number of individuals is less than 50. According to the Red List criteria (World Conservation Union, IUCN), these taxa must be classified as ‘Critically Endangered’. Chlorophytum chelindaensis was found in several subpopulations within the Nyika Plateau National Park, and does not seem to be threatened. Chloro- phytum clarae has a rather wide distribution from northern Zambia to south-western Tanzania, and is probably not endangered. The two subspecies of C. blepharophyllum have a restricted distribution and should be monitored. ACKNOWLEDGEMENTS We thank Mike Bingham and Jason Alfonsi for excellent company and knowledge shared with us during our many field trips. Svetlana Voronkova is acknowledged for the illustrations. Economic support was granted by the Norwegian Research Council (CSB, project 151050) and The Norwegian Program for Development, Research and Education (NUFU) (IN, PRO 53/2003; SK, PRO 39/2002). Thanks are due to Anne K. Brysting and an anonymous referee whose comments on earlier drafts of the manuscript led to considerable improvement. REFERENCES Bjorå CS, Kwembeya EG, Nordal I. 2006. Crinum jasonii – a new endemic pan species of the Luangwa Valley in Zambia – with notes on different seed structures in the genus. Kew Bulletin 61: 569–577. Fitch WM. 1971. Toward defining the course of evolution: minimum change for a specific tree topology. Systematic Zoology 20: 406–416. Givnish TJ, Pires JC, Graham SW, McPherson MA, Prince LM, Patterson TB, Rai HS, Roalson EH, Evans TM, Hahn WJ, Millam KC, Meerow AW, Molvray M, Kores PJ, O’Brien HE, Hall JC, Kress WJ, Sytsma KJ. 2006. Phylogeny of the monocots based on the highly informative plastid gene ndhF: Evidence for widespread concerted convergence. In: Columbus JT, Friar EA, Porter JM, Prince LM, Simpson MG, eds. Monocots: Comparative Biology and Evolution. Excluding Poales. Rancho Santa Ana Botanical Garden, Claremont, Ca. Aliso 22: 28–51. Hepper CM. 1968. Liliaceae. In: Hepper FN, ed. Flora of tropical West Africa, Vol. 3 (1). London: Crown Agents for Overseas Governments and Administrations, 90–107. Hoell G. 2005. The genera Anthericum and Chlorophytum (Anthericaceae), evolution and delimitation. Cand. Scient. Thesis, University of Oslo. Jonsell B, ed. 2000. Flora Nordica, Vol. 1. Stockholm: The Bergenius Foundation. Kativu S. 1994. Synopsis of Chlorophytum (Anthericaceae) in the Flora Zambesiaca area. Kirkia 15: 43–111. Kativu S, Nordal I. 1993. New combinations of African species in the genus Chlorophytum. Nordic Journal of Botany 13: 59–65. Kativu S, Hoell G, Bjorå CS, Nordal I. 2008. Anthericaceae. In: Timberlake JF, ed. Flora Zambesiaca, 13 (1) (In press). Royal Botanic Gardens, Kew. Marais W, Reilly J. 1978. Chlorophytum and its related genera (Liliaceae). Kew Bulletin 32: 653–663. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 Type: Zambia, Barotseland, Loyi, between Mongu and Mufwaya, 15°01′29″S, 24°06′43″E, 1140 m, 2.xii.2003, Hoell & Nordal 19 (O, holotype) (Figs 13, 17). 237 238 C. S. BJORÅ ET AL. Poulsen AD, Nordal I. 2005. A phenetic analysis and revision of Guineo-Congolean rain forest taxa of Chlorophytum (Anthericaceae). Botanical Journal of the Linnean Society 148: 1–20. Stevens PF. 2001. Angiosperm phylogeny website, Version 7. URL http://www.mobot.org/MOBOT/research/APweb/ welcome.html [accessed May 2006]. Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Shinsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press, 315–322. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157, 223–238 Downloaded from https://academic.oup.com/botlinnean/article-abstract/157/2/223/2418454 by guest on 07 June 2020 Nixon KC. 1999. Winclada (BETA). Published by author. New York. Nordal I. 1997. Anthericaceae. In: Edwards S, Sebsebe D, Hedberg I, eds. Flora of Ethiopia and Eritrea, Vol. 6. Addis Ababa: National Herbarium, Addis Ababa University and Uppsala University, 90–105. Nordal I, Kativu S, Poulsen AD. 1997. Anthericaceae. Flora of tropical East Africa. Rotterdam: A.A. Balkema. Nordal I, Thulin M. 1993. Synopsis of Anthericum and Chlorophytum (Anthericaceae) in the Horn of Africa, including the description of nine new species. Nordic Journal of Botany 13: 257–280. Obermeyer AA. 1962. A revision of the South African species of Anthericum, Chlorophytum and Trachyandra. Bothalia 7: 669–767.