Annals of Botany 109: 1317– 1329, 2012 doi:10.1093/aob/mcs077, available online at www.aob.oxfordjournals.org A molecular phylogeny and classification of Leptochloa (Poaceae: Chloridoideae: Chlorideae) sensu lato and related genera Paul M. Peterson 1,*, Konstantin Romaschenko 1,2, Neil Snow 3 and Gabriel Johnson 4 1 Received: 23 September 2011 Returned for revision: 14 December 2011 Accepted: 24 February 2012 † Background and Aims Leptochloa (including Diplachne) sensu lato (s.l.) comprises a diverse assemblage of C4 (NAD-ME and PCK) grasses with approx. 32 annual or perennial species. Evolutionary relationships and a modern classification of Leptochloa spp. based on the study of molecular characters have only been superficially investigated in four species. The goals of this study were to reconstruct the evolutionary history of Leptochloa s.l. with molecular data and broad taxon sampling. † Methods A phylogenetic analysis was conducted of 130 species (mostly Chloridoideae), of which 22 are placed in Leptochloa, using five plastid (rpL32-trn-L, ndhA intron, rps16 intron, rps16-trnK and ccsA) and the nuclear ITS 1 and 2 (ribosomal internal transcribed spacer regions) to infer evolutionary relationships and revise the classification. † Key results Leptochloa s.l. is polyphyletic and strong support was found for five lineages. Embedded within the Leptochloa sensu stricto (s.s.) clade are two Trichloris spp. and embedded in Dinebra are Drake-brockmania and 19 Leptochloa spp. † Conclusions The molecular results support the dissolution of Leptochloa s.l. into the following five genera: Dinebra with 23 species, Diplachne with two species, Disakisperma with three species, Leptochloa s.s. with five species and a new genus, Trigonochloa, with two species. Key words: Classification, Dinebra, Diplachne, Disakisperma, Drake-brockmania, ITS, Leptochloa, phylogeny, plastid DNA sequences, Poaceae, Trichloris, Trigonochloa. IN T RO DU C T IO N Leptochloa P.Beauv. sensu lato (s.l.) (including Diplachne P.Beauv.) comprises a diverse assemblage of C4 [nicotinamide adenine dinucleotide co-factor malic enzyme (NAD-ME) and phosphoenolpyruvate carboxykinase (PCK)] grasses with approx. 32 annual or perennial species (Snow, 1997, 2003). The native range of the genus is pantropical into warmer temperate regions, with several species being weedy and widely distributed. The diversity of taxa in Leptochloa increases towards the tropics on all continents. The richest areas include: Louisiana, Texas and western Mexico in North America; Ethiopia through Tanzania in Africa; the Chacó in South America; and eastern Queensland in Australia (Snow, 1997). Asia has relatively few taxa and there are only three wide-ranging species reported for China (Chen and Phillips, 2006). Evolutionary relationships and a modern classification of Leptochloa spp. based on the study of molecular characters have been investigated only superficially. The range of morphological variation within many Leptochloa spp. is significant, but they can be characterized as having membranous ligules, flat leaf blades, a paniculate inflorescence of spicate racemes with the branches inserted alternately to sub-whorled (sub-digitate), appressed pedicels, secund spikelets that are generally in two distinct rows, disarticulation above the single-nerved glumes and membranous lemmas that are three- (rarely four- or five-) nerved with various pubescence patterns. The presence or absence of a prominent sulcus and adnation of the pericarp in the caryopsis may possibly be of phylogenetic utility in Leptochloa spp. (Snow, 1998a), whereas micromorphological features of the lemma apparently vary little among these species (Snow, 1996). Considerable controversy has surrounded the generic placement of Leptochloa spp. since Palisot de Beauvois (1812) described it and Diplachne in the same publication. There was even confusion regarding the use of Leptochloa until Niles and Chase (1925) designated a lectotype [based on L. virgata (L.) P.Beauv.] that effectively stabilized the nomenclature. Many genera have been erected to accommodate the species that now reside in Leptochloa, most notably including: Diplachne [based on L. fusca subsp. fascicularis (Lam.) N.Snow], Oxydenia Nutt. [based on L. panicea subsp. brachiata (Steud.) N.Snow] and Disakisperma Steud. [based on L. dubia (Kunth) Nees]. The lack of monophyly of Leptochloa s.l. has been demonstrated in multiple studies, including some based on morphological and anatomical data (Snow, 1997). Based on a numerical analysis of morphological characters, Phillips (1982) found that species placed in Diplachne and Leptochloa overlapped with one another in a principal coordinates scatter plot. Published by Oxford University Press on behalf of the Annals of Botany Company 2012. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Smithsonian Institution, Department of Botany MRC-166, National Museum of Natural History, Washington, DC 20013-7012, USA, 2Laboratory of Molecular Systematics, Botanic Institute of Barcelona (CSIC – ICUB), Passeig del Migdia, s.n. 08038, Barcelona, Spain, 3Montana Natural Heritage Program, 1515 East Sixth Avenue, Helena, MT 59620-1800, USA and 4 Smithsonian Institution, Department of Botany and Laboratories of Analytical Biology, Suitland, MD 20746, USA * For correspondence. E-mail peterson@si.edu 1318 Peterson et al. — Phylogeny and classification of Leptochloa (314 new sequences), which is a significant advance over Peterson et al. (2010a). We compare the ITS and plastid-based phylogenetic trees with previous classifications by Clayton and Renvoize (1986), Watson and Dallwitz (1992), Snow (1997), Hilu and Alice (2001), Columbus et al. (2007) and Peterson et al. (2010a) (see Table 1 for a comparison). In addition, we seek morphological and anatomical characters supporting relationships in the molecular trees and propose changes to the classification. M AT E R I A L S A N D M E T H O D S Taxon sampling The taxon sampling consists of 130 species of grasses, of which 126 are included in subfamily Chloridoideae; these are partitioned to represent the following five tribes: Centropodieae with one species, Triraphideae with two species, Eragrostideae with nine species, Zoysieae with five species and Chlorideae with 109 species. Within Chloridoideae all tribes and subtribes are evenly represented. Our sampling was primarily focused on genera that are morphologically similar and possibly phylogenetically related to Leptochloa; therefore, we have a large sample within the subtribe Eleusininae where the genus has been recently aligned (Peterson et al., 2010a). The data set for Leptochloa includes 69 % (22 of 32) of the species currently placed in the genus and four infraspecific taxa (Snow, 1997, 1998b, 2000; Snow and Simon, 1997). A complete list of taxa, voucher information, and GenBank numbers can be found in Supplementary Data Table S1. Outside Chloridoideae, two species of Danthonioideae, one species of Aristidoideae and one species of Panicoideae [Chasmanthium latifolium (Michx.) H.O.Yates, phylogenetic root] were chosen as outgroups. Two representatives of subfamily Danthonioideae [Danthonia compressa Austin and Rytidosperma penicellatum (Labill.) Connor & Edgar] were included as this subfamily was shown to be sister to Chloridoideae (Peterson et al., 2010a, 2011). The following regions were chosen to emphasize the native distribution of Leptochloa spp.: North America, South America, Central Africa (Tanzania, Kenya), South Africa, Australia and the Marquesas Islands. DNA extraction, amplification and sequencing All procedures were performed in the Laboratory of Analytical Biology (LAB) at the Smithsonian Institution. DNA isolation, amplification and sequencing of rpL32-trnL spacer and ndhA intron (small single copy region), rps16-trnK spacer and rps16 intron (large single copy region), ccsA (encoding region), and ITS were accomplished following procedures outlined in Peterson et al. (2010a, b). We specifically targeted four of the plastid regions which proved to be most informative in our previous studies on chloridoid grasses (Peterson et al., 2010a, b, 2011). Forty per cent (314) of the sequences used in our study are newly reported here and in GenBank, and only 9 % (70) are missing. The ccsA marker in our study is nearly a complete sequence of the gene encoding biogenesis of c-type cytochromes, located on the positive DNA strand in the small single copy Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 The monophyly of Leptochloa has not been tested in breadth using molecular data, and the relationship between Leptochloa and other genera is far from certain (Columbus et al., 2007; Peterson et al., 1997, 2007, 2010a). For example, in a restriction fragment analysis of plastid DNA using a few New World representatives, Leptochloa (L. dubia) did not form a particularly strong clade with the other genera, and instead shared a common ancestor in a clade that included the Muhlenbergiinae, Dasyochloa Willd. ex Rydb, Munroa Torr., Erioneuron Nash, Scleropogon, Sporobolus R.Br, Eleusine Gaertn., Tridens Roem. & Schult., Tripogon Roem. & Schult. and Eustachys Desv. (Duvall et al., 1994). In a phylogenetic study of Chloridoideae based on matK sequences, Leptochloa (L. dubia) formed a clade with Coelachyrum Hochst. & Nees, and Astrebla F.Muell. emerged as sister to these (Hilu and Alice, 2001). Other genera in Hilu and Alice’s (2001) C1 clade included Brachyachne (Benth.) Stapf, Chloris Sw., Cynodon Rich., Dinebra Jacq., Eleusine, Enteropogon Nees, Eustachys, Lepturus R.Br., Lintonia Stapf, Microchloa R.Br., Oxychloris Lazarides, Tetrapogon Desf. and Trichloris E.Fourn. & Benth. In another phylogenetic study of Chloridoideae, based on analysis of combined trnL-F and internal transcribed spacer (ITS) sequences, Leptochloa spp. [L. dubia, L. fusca (L.) Kunth and L. panicea (Retz.) Ohwi] appear in separate clades, suggesting a polyphyletic origin (Columbus et al., 2007). In a phylogenetic analysis of rps16 sequences Leptochloa (L. dubia) forms a clade with Eleusine [E. coracana (L.) Gaertn.], whereas in a tree based on analysis of waxy sequences, Leptochloa forms a clade with Eleusine (E. coracana) and Dactyloctenium Willd. [D. aegyptium (L.) Willd. and D. radulans (R.Br.) P.Beauv.] (Ingram and Doyle, 2007). In a large phylogenetic study of Chloridoideae based on seven DNA sequence markers (ITS, ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3 and rpl32-trnL) Leptochloa was clearly polyphyletic, representing three separate lineages (Peterson et al., 2010a). Leptochloa viscida (Scribn.) Beal was sister to L. filiformis (Pers.) P.Beauv. (¼ L. panicea subsp. brachiata) and Dinebra retroflexa (Vahl) Panz. in one strongly supported clade [bootstrap support (BS) ¼ 90, posterior probability (PP) ¼ 1.00]; L. dubia was sister to Sclerodactylon mascrostachyum (Benth.) A.Camus. in another clade (PP ¼ 0.59); and L. uninervia (J.Presl) Hitchc. & Chase was sister (PP ¼ 0.81) to all remaining members of subtribe Eleusininae (Peterson et al., 2010a, fig. 3). In summary, the monophyly of Leptochloa has not been corroborated with molecular data, and phylogenetic relationships of Leptochloa with other genera remain obscure (Columbus et al., 2007; Peterson et al., 2007, 2010a). Using an analysis of plastid and nuclear DNA sequences, we present a new phylogenetic analysis for 28 of the 32 species that occur in Leptochloa. We estimate the phylogeny among the members of Leptochloa based on the analysis of six molecular markers (nuclear ITS and plastid rpL32-trn-L, ndhA intron, rps16 intron, rps16-trnK and ccsA DNA sequences). Peterson et al. (2010a) considered four species of Leptochloa in their large study investigating 246 species of Chloridoideae using seven molecular markers. We include an expanded survey of the subtribe Eleusininae by sampling an additional 18 species of Leptochloa for these six markers Peterson et al. — Phylogeny and classification of Leptochloa 1319 TA B L E 1. Comparison of recent classifications of the genera indicating tribe and subtribe placement Taxon Clayton and Renvoize (1986) Watson and Dallwitz (1992) Hilu and Alice (2001) Snow (1997) Columbus et al. (2007) Peterson et al. (2010a) This paper Eragostideae, Eleusininae; 3 spp. Chlorideae; 3 spp. not treated Eragrostideae, Eleusininae Cynodonteae Cynodonteae, Eleusininae Diplachne P. Beauv. – – – Eragrostideae, Eleusininae – – Disakisperma Steud. – Chlorideae; 18 spp. – Cynodonteae, Eleusininae – Drake-brockmania Stapf Chlorideae; 2 spp. not treated not treated not treated unplaced in subfamily Cynodonteae, Eleusininae; 32 spp. (incl. Diplachne) placed in Chloris not treated Eragrostideae, Eleusininae Cynodonteae (incl. Diplachne) Cynodonteae, Eleusininae Chlorideae, Eleusininae; 5 spp. (incl. Trichloris) not treated Cynodonteae Cynodonteae, Eleusininae placed in Leptochloa – – – – Chlorideae; 2 spp. Leptochloa P. Beauv. Trichloris E. Fourn. ex Benth. Trigonochloa P.M. Peterson & N. Snow Eragrostideae, Eleusininae; 2 spp. Eragrostideae, Eleusininae; 40 spp. (incl. Diplachne) Cynodonteae, Chloridinae; 2 spp. – Chlorideae; 27 spp. – – Chlorideae, Eleusininae; 23 spp. (incl. Drake-brockmania) Chlorideae, Eleusininae; 2 spp. Chlorideae, Eleusininae; 3 spp. placed in Dinebra The number of species of each genus is included if known. A dash indicates a taxon was not recognized. unit of the plastid genome (Xie and Merchant, 1996). To the best of our knowledge, this is the first application of this region as a marker in molecular phylogenetic analysis of grasses. The length of the sequenced region for Chloridoideae varies from approx. 850 to 950 bp. The region was amplified and sequenced with a newly designed set of primers: ccsA1F (5′ - ATGCTATTTGCAACTTTAGAACA3′ ) used for forward and ccsA930R (5′ -TAAACGAACCAT AACTATGTAA-3′ ) for reverse. The amplification parameters were as follows: initial denaturation phase of 4 min at 94 8C, followed by 35 cycles of denaturation at 94 8C for 40 s, annealing at 51 8C for 40 s and extension at 72 8C for 90 s, and a final extension at 72 8C for 10 min. Phylogenetic analyses We used Geneious 5.3.4 (Drummond et al., 2011) for contig assembly of bidirectional sequences of rpL32-trnL, ndhA intron, rps16 intron, rps16-trnK, ccsA and ITS regions, and we used MUSCLE (Edgar, 2004) to align consensus sequences and adjust the final alignment. We identified models of molecular evolution for the plastid DNA and nrDNA regions using jModelTest (Posada, 2008). We applied maximumlikelihood (ML) and Bayesian searches to infer overall phylogeny. The combined data sets were partitioned in accordance with the number of the markers in use. Nucleotide substitution models selected based on Akaike’s information criterion (AIC), as implemented in jModelTest v.0.1.1, were specified for each partition (Table 2). The ML analysis was conducted with GARLI 0.951 (Zwickl, 2006). The ML bootstrap analysis was performed with 1000 replicates, with ten random addition sequences per replicate. The output file containing trees of ML found for each bootstrap data set was then read into PAUP* 4.0b10 (Swofford, 2000) where the majority-rule consensus tree was constructed. BS values of 90– 100 % were interpreted as strong support, 70– 89 % as moderate and 50– 69 % as weak. Bayesian PP values were estimated using a parallel version of MrBayes v3.1.2 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003) where the run of eight Markov chain Monte Carlo iterations was split between an equal number of processors. Bayesian analysis was initiated with random starting trees and was initially run for four million generations, sampling once per 100 generations. The analysis was run until the value of standard deviation of split sequences dropped below 0.01 and the potential scale reduction factor was close to or equal to 1.0. The fraction of the sampled values discarded as burn-in was set at 0.25. PPs of 0.95– 1.00 were considered as strong support. The incongruence length difference (ILD) test (Farris et al., 1994) was conducted to assess the homogeneity of the data sets and to detect possible incongruence among six partitions of the plastid and nrDNA ITS sequence data. The pairwise tests were performed using the program WinClada v.1.00.08 (Nixon, 2002) with 1000 replications. The significance level was adjusted to P ≤ 0.01. R E S ULT S Phylogenetic analyses A total of 323 sequences representing 40 species are newly reported in GenBank (Supplementary Data Table S1). Total aligned characters for individual regions are noted in Table 2. Plastid rpL32-trnL had the highest sequencing success of 97.7 % of taxa recovered across the entire data set. Recovery in other regions ranged from 79.2 to 95.4 %. An average of 9 % of data (70/780) was missing across the entire data set. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Dinebra Jacq. 1320 Peterson et al. — Phylogeny and classification of Leptochloa TA B L E 2. Summary of the five plastid and nrDNA ITS regions used in the maximum-likelihood and Bayesian searches indicated by Akaike’s Information Criterion (AIC) Characteristic Character state frequencies Proportion of invariable sites Substitution model Gamma shape parameter (a) ndhA intron rps16 intron rps16-trnK ccsA 1233 97.7 12 261.1– 11 209.8 11 136.1355 1323 79.2 11 062.4– 9923.4 9874.0937 1074 90.0 8369.5– 7634.5 7634.4594 1040 94.6 10 152.0– 9313.0 9313.9542 6667.1345 832 95.4 26 404.4– 22 821.9 22 937.3535 6 Gamma 6 Gamma 6 Gamma 6 Gamma 6 Gamma 6 Gamma 0.8439 1.8504 0.4460 1.2388 1.4202 1.0000 0.3822 0.1428 0.1271 0.3479 0.0 GTR + I + G 0.7030 1.3761 2.9593 0.5922 2.4171 2.9593 1.0000 0.3647 0.1252 0.1445 0.3655 0.0 TVM + G 0.5850 2.0082 2.3904 1.0000 2.0082 3.6308 1.0000 0.3644 0.1045 0.1800 0.3511 0.0 TIM3 + I + G 0.5550 1.7449 3.6185 1.0000 1.7449 3.2233 1.0000 0.2843 0.1424 0.1586 0.4146 0.0 TIM3 + G 0.8680 1.0000 3.5360 0.6972 0.6972 3.5360 1.0000 0.3060 0.1657 0.1641 0.3642 0.0 TPM1uf + I + G 0.2980 1.3687 3.0126 1.5695 0.9582 5.1859 1.0000 0.2433 0.1869 0.2513 0.3185 0.2289 GTR + I + G 0.9944 The pairwise ILD tests among the six partitions indicated acceptable levels of congruence between a majority of the data sets (P ¼ 0.0779– 0.9750), with the exception of ndhA – rps16 – trnK (P ¼ 0.0040) and rpl32 – trnL – ITS (P ¼ 0.0070) pairs. As each region in the detected ‘incongruent’ pairs was congruent with all other partitions in the data set, we attribute these outcomes as a limitation of the method, which is prone to type I error (erroneously rejecting the hypothesis of congruence) when there was a high level of heterogeneity in the data (Barker and Lutzoni, 2002; Darlu and Lecointre, 2002). Therefore, we combined the plastid sequences and plastid – ITS sequences in our analysis. Analysis of plastid sequences The ML tree from the combined analysis of the five plastid regions (rpL32-trnL, ndhA intron, rps16 intron, rps16-trnK and ccsA) is well resolved with strong to moderate support for each of the tribes and most of the subtribes of Chloridoideae (Fig. 1). The species currently placed in Leptochloa do not align in a single clade and are found in seven principal clades (Fig. 1, I– VI). The principal lineages of Leptochloa are depicted as follows: clade I (BS ¼ 97, PP ¼ 1.00) includes two accessions of L. uniflora Hochst. ex A.Rich. that are sister to Mosdenia – Toliara – Lopholepis – Perotis (BS ¼ 98, PP ¼ 1.00); clade II (BS ¼ 100, PP ¼ 1.00) includes Dinebra retroflexa, L. chinensis (L.) Nees, L. marquisensis (F.Br.) P.M.Peterson & Judz., a monophyletic L. panicea with three accessions (BS ¼ 99, PP ¼ 1.00), L. squarrosa Pilg. and L. xerophila P.M. Peterson & Judz.; clade IIIA (PP ¼ 0.93) includes L. caudata (K.Schum.) N.Snow, a monophyletic L. decipiens (R.Br.) Stapf ex Maiden (BS ¼ 93, PP ¼ 1.00), 916 89.2 7615.5 –6667.1 5586 ITS Overall combined data set 6418 91.0 L. ligulata Lazarides, L. nealleyi Vasey, L. neesii (Thwaites) Benth., L. panicoides (J.Presl) Hitchc., L. scabra Nees, L. southwoodii N.Snow & B.K.Simon and two accession of L. viscida that are sister; clade IIIB (PP ¼ 0.81) includes L. coerulescens Steud. that is sister to Coelachyrum – Eleusine; clade IV (BS ¼ 100, PP ¼ 1.00) includes a monophyletic L. fusca with L. fusca subsp. muelleri (Benth.) N.Snow and two accessions of L. fusca subsp. uninervia (J.Presl) N.Snow that is sister to all other Eleusininae; clade V (BS ¼ 86, PP ¼ 1.00) includes L. digitata (R.Br.) Domin, and three accessions of L. virgata in a grade (BS ¼ 100, PP ¼ 1.00), and two Trichloris spp. (BS ¼ 100, PP ¼ 1.00); and clade VI (BS ¼ 100, PP ¼ 1.00) includes two sister accessions of L. dubia with L. eleusine (Nees) Cope & N.Snow and L. obtusiflora Trin. ex Steud. The Eleusininae clade is weakly supported (BS ¼ 65, PP ¼ 1.00). Analysis of ITS sequences The ML tree based on data from the nrITS region is not as well resolved and the species are found in six principal clades (Fig. 2, I – VI): (I) is a single accession of L. uniflora sister to Mosdenia – Perotis – Toliara (BS ¼ 100, PP ¼ 1.00); (II) is similar to the plastid tree but lacks L. chinensis which is sister (BS ¼ 52, PP ¼ 0.77) to both clades II and III (BS ¼ 96, PP ¼ 1.00); (III) is similar to the plastid tree, but the subspecies of L. decipiens appear as a grade and L. coerulescens is sister to L. caudata (BS ¼ 64, PP ¼ 0.56); (IV) depicts a monophyletic L. fusca (BS ¼ 100, PP ¼ 1.00) that is a member of a grade between the Coelachyrum poiflorum – Eleusine indica and L. digitata– Trichloris – L. virgata clades Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Total aligned characters Sequencing success (%) Range of likelihood scores across 88 models from (–lnL) Maximum-likelihood scores (– lnL) Number of substitution types Model for among-site rate variation Substitution rates rpL32-trnL Combined plastid data Peterson et al. — Phylogeny and classification of Leptochloa 1321 Chasmanthium latifolium 55 1·00 99 1·00 Aristida gypsophila Danthonia compressa Rytidosperma penicellatum 100 1·00 Centropodieae 88 1·00 Ellisochloa rangei Neyraudia reynaudiana 100 1·00 Triraphis mollis Cottea pappophoroides 100 Triraphideae 100 1·00 1·00 100 1·00 Uniola condensata Enneapogon scaber Eragrostideae 84 1·00 84 1·00 100 59 1·00 1·00 UNIOLINAE ERAGROSTIDINAE ZOYSIINAE SPOROBOLINAE PAPPOPHORINAE AELUROPODINAE TRIODIINAE ORCUTTIINAE TRIDENTINAE TRIPOGONINAE TRAGINAE HILARIINAE MUHLENBERGIINAE BOUTELOUINAE MONANTHOCHLOINAE SCLEROPOGONINAE ELEUSININAE F I G . 1. Phylogram of maximum-likelihood tree from analysis of combined plastid sequences. Numbers above branches represent bootstrap values; numbers below branches represent posterior probabilities; colour indicates native distribution (see legend); roman numerals and letters indicate clades discussed in the text. Scale bar ¼ 10 % sequence divergence. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Entoplocamia aristulata Psammagrostis wiseana Ectrosia scabrida Harpachne harpachnoides Eragrostis kennedyae Eragrostis nigricans Zoysia macrantha ssp. walshii 99 Sporobolus virginicus 100 1·00 100 Crypsis aculeata 1·00 100 1·00 100 Calamovilfa longifolia 1·00 Zoysieae 1·00 Spartina densiflora Neesiochola barbata 80 Pappophorum pappiferum 1·00 Aeluropus littoralis 94 Orinus kokonorica 100 Triodia intermedia 1·00 Neobouteloua lophostachya 1·00 70 Brachychloa schiemanniana 90 0·95 Dactyloctenium australe 97 1·00 Dactyloctenium aegyptium 1·00 89 Dactyloctenium bogdanii 1·00 Dactyloctenium giganteum 1·00 97 Orcuttia tenuis 1·00 Tuctoria greenei Gouinia paraguayensis 100 100 1·00 Vaseyochloa multinervosa 1·00 1·00 65 Sclerodactylon macrostachyum 0·82 Triplasis purpurea Chlorideae 65 71 Dignathia hirtella 1·00 1·00 90 Bewsia biflora Gymnopogon grandiflorus 1·00 52 88 0·90 Lophacme digitata 0·68 51 0·61 Trichoneura eleusinoides Ctenium brevispicatum 97 Leptochloa uniflora Greenway 14075 0·95 1·00 Leptochloa uniflora Snow 6978 98 Mosdenia phleoides 1·00 98 Toliara arenacea 1·00 69 54 Lopholepis ornithocephala 0·96 0·73 Perotis hordeiformis 94 Desmostachya bipinnata Melanocenchris abyssinica 100 0·97 1·00 100 Eragrostiella leioptera 1·00 Tripogon multiflorus Willkommia sarmentosa 100 0·95 Monelytrum luederitzianum 1·00 88 0·99 Tragus racemosus 81 Jouvea pilosa 1·00 Sohnsia filifolia 61 80 100 Hilaria cenchroides 1·00 1·00 Pleuraphis rigida 100 Muhlenbergia japonica 1·00 Muhlenbergia schreberi 0·96 0·83 Bouteloua simplex 83 Distichlis humilis 99 1·00 99 Distichlis littoralis 1·00 1·00 Distichlis eludens Allolepis texana 64 Scleropogon brevifolius 94 0·99 Swallenia alexandrae 1·00 99 Blepharidachne benthamiana 1·00 Leptochloa fusca ssp. uninervia Peterson 21305 100 1·00 53 Leptochloa fusca ssp. muelleri Leptochloa fusca ssp. uninervia Peterson 20786 Leptochloa chinensis 100 97 Dinebra retroflexa 1·00 1·00 Leptochloa squarrosa 83 99 Leptochloa marquisensis 0·68 67 1·00 Leptochloa xerophila 0·83 99 Leptochloa panicea ssp. mucronata Leptochloa panicea ssp. brachiata Peterson 22185 1·00 93 65 0·94 1·00 Leptochloa panicea ssp. brachiata Peterson 22086 1·00 Drake-brockmania somalensis Leptochloa caudata 99 Leptochloa panicoides 100 1·00 0·93 1·00 93 Leptochloa viscida Peterson 22184 1·00 Leptochloa viscida Snow 6528a 100 Leptochloa nealleyi 1·00 Leptochloa scabra 91 Leptochloa neesii 1·00 93 A 100 Leptochloa ligulata 86 1·00 83 1·00 Leptochloa southwoodii 1·00 Leptochloa decipiens ssp. asthenes Snow 7327 0·98 93 Leptochloa decipiens ssp. peacockii 1·00 72 0·85 Leptochloa decipiens ssp. asthenes Snow 7355 67 Leptochloa decipiens ssp. asthenes Snow 7328 0·54 Leptochloa decipiens ssp. asthenes Waterhouse 5948 94 Coelachyrum poiflorum 1·00 Eleusine indica B 0·81 Leptochloa coerulescens 91 Leptochloa dubia Peterson 22334 100 1·00 Leptochloa dubia Peterson 8105 100 1·00 Leptochloa eleusine 1·00 Leptochloa obtusiflora 90 Astrebla pectinata 1·00 Austrochloris dichanthioides Schoenefeldia transiens Leptochloa digitata 0·86 86 Leptochloa virgata Rimachi 8359 1·00 0·64 100 100 Leptochloa virgata Peterson 15088 1·00 1·00 Leptochloa virgata Vargas 2710 North America 0·95 100 Trichloris crinita 1·00 Trichloris pluriflora Enteropogon macrostachys South America 100 Lintonia nutans 1·00 Chloris barbata Central Africa (Kenya, Tanzania) 0·94 88 Saugetia fasciculata 0·86 81 1·00 Tetrapogon villosus South Africa Lepturus gasparricensis 1·00 93 Microchloa caffra Australia 1·00 93 Brachyachne fibrosa 100 100 Brachyachne chrysolepis 1·00 1·00 1·00 Brachyachne patentiflora Marquesas Islands 100 Eustachys paspaloides 0·87 Eustachys petraea 100 1·00 Chrysochloa hindsii 1·00 90 Cynodon maritimus 0·99 100 Cynodon hirsutus 1·00 71 Brachyachne convergens 0·71 81 0·1 0·99 Brachyachne tenella 100 1·00 COTTEINAE 1322 Peterson et al. — Phylogeny and classification of Leptochloa Chasmanthium latifolium Ellisochloa rangeilatifolium 100 Danthonia compressa 1·00 Rytidosperma penicellatum Aristida gypsophila 100 Neyraudia reynaudiana 1·00 Triraphis mollis 94 1·00 94 1·00 Triraphideae 99 1·00 84 1·00 Eragrostideae 92 1·00 72 0·96 1·00 0·93 59 0·99 0·85 74 0·93 77 1·00 COTTEINAE Cottea pappophoroides Enneapogon scaber Uniola condensata Entoplocamia aristulata Eragrostis kennedyae Psammagrostis wiseana Ectrosia scabrida Harpachne harpachnoides Eragrostis nigricans 96 1·00 82 1·00 79 93 1·00 Zoysieae 55 1·00 ERAGROSTIDINAE 99 1·00 82 1·00 0·93 51 1·00 72 0·92 94 1·00 83 0·99 0·91 0·89 86 1·00 51 1·00 90 1·00 Swallenia alexandrae 67 Blepharidachne benthamiana 0·90 Scleropogon brevifolius Triplasis purpurea Gouinia paraguayensis Vaseyochloa multinervosa 0·87 100 1·00 61 1·00 Dignathia hirtella 0·1 Hilaria cenchroides Pleuraphis rigida BOUTELOUINAE HILARIINAE SCLEROPOGONINAE TRIDENTINAE Ctenium brevispicatum Trichoneura eleusinoides Leptochloa uniflora Snow 6978 Mosdenia phleoides 100 100 Perotis hordeiformis 1·00 1·00 Toliara arenacea Bewsia biflora Gymnopogon grandiflorus Lophacme digitata Orcuttia tenuis 1·00 Tuctoria greenei 74 Desmostachya bipinnata 0·75 0·90 93 Melanocenchris abyssinica 100 1·00 Eragrostiella leioptera 1·00 Tripogon multiflorus 0·94 Triodia intermedia Orinus kokonorica 0·84 Aeluropus littoralis 0·85 Leptochloa chinensis 56 69 Leptochloa marquisensis 0·92 0·99 Leptochloa xerophila 100 52 68 Dinebra retroflexa 1·00 0·95 0·77 Leptochloa squarrosa 98 Leptochloa panicea ssp. brachiata Peterson 22185 1·00 Leptochloa panicea ssp. mucronata 96 1·00 Leptochloa viscida Peterson 22184 98 Leptochloa caudata 1·00 64 0·56 Leptochloa coerulescens 55 Leptochloa nealleyi 100 0·76 1·00 Leptochloa scabra 50 Drake-brockmania somalensis 0·76 50 Leptochloa neesii 0·76 93 99 Leptochloa decipiens ssp. asthenes Snow 7327 1·00 78 1·00 Leptochloa decipiens ssp. asthenes Snow 7355 89 Leptochloa decipiens ssp. decipiens Snow 7328 1·00 1·00 Leptochloa decipiens ssp. decipiens Waterhouse 5948 Leptochloa decipiens ssp. peacockii 0·51 100 Leptochloa ligulata 1·00 Leptochloa southwoodii Coelachyrum poiflorum 1·00 Eleusine indica 100 Leptochloa fusca ssp. uninervia Peterson 20786 84 1·00 54 Leptochloa fusca ssp. muelleri 1·00 0·55 Leptochloa fusca ssp. uninervia Peterson 21305 Leptochloa digitata 73 94 100 Trichloris crinita 1·00 1·00 98 1·00 Trichloris pluriflora 1·00 Leptochloa virgata Rimachi 8359 0·65 100 Leptochloa virgata Peterson 15088 1·00 Leptochloa virgata Vargas 2710 0·71 87 Astrebla pectinata 1·00 Austrochloris dichanthioides Enteropogon macrostachys 61 100 Leptochloa dubia Peterson 22334 75 0·80 98 1·00 Leptochloa dubia Peterson 8105 1·00 1·00 100 Leptochloa eleusine 1·00 Leptochloa obtusiflora 79 Schoenefeldia transiens 0·99 Saugetia fasciculata 100 1·00 Tetrapogon villosus 75 Lepturus gasparricensis 0·74 0·94 100 Chloris barbata 0·94 1·00 Lintonia nutans 96 98 Eustachys paspaloides 1·00 1·00 Eustachys petraea 0·99 Microchloa caffra 72 100 Brachyachne fibrosa 1·00 100 Brachyachne chrysolepis 1·00 79 1·00 Brachyachne patentiflora 1·00 Chrysochloa hindsii 82 Brachyachne tenella 100 0·93 Cynodon maritimus 1·00 Brachyachne convergens 0·70 0·63 Cynodon hirsutus 0·90 0·90 Marquesas Islands PAPPOPHORINAE MONANTHOCHLOINAE 100 1·00 51 1·00 Australia MUHLENBERGIINAE Bouteloua simplex Distichlis humilis Distichlis littoralis Distichlis eludens Sohnsia fililolia 0·53 South Africa TRAGINAE Jouvea pilosa 92 1·00 Central Africa (Kenya, Tanzania) 84 1·00 81 1·00 ORCUTTIINAE TRIPOGONINAE TRIODIINAE AELUROPODINAE ELEUSININAE F I G . 2. Phylogram of maximum-likelihood tree from analysis of ITS sequences. Numbers above branches represent bootstrap values; numbers below branches represent posterior probabilities; colour indicates native distribution (see legend); roman numerals indicate clades discussed in the text. Scale bar ¼ 10 % sequence divergence. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 0·54 South America SPOROBOLINAE Dactyloctenium aegyptium Dactyloctenium australe Dactyloctenium bagdanii Dactyloctenium giganteum Tragus racemosus 99 Monelytrum luederitzianum 1·00 65 0·96 Willkommia sarmentosa 100 Muhlenbergia japonica 1·00 Muhlenbergia schreberi Neesiochloa barbata Pappophorum pappiferum Allolepis texana 97 1·00 89 1·00 North America ZOYSIINAE Zoysia macrantha ssp. walshii Crypsis aculeata Sporobolus virginicus Calamovilfa longifolia Spartina densiflora Neobouteloua lophostachya Brachychloa schiemanniana 72 0·86 Chlorideae 88 1·00 UNIOLINAE Peterson et al. — Phylogeny and classification of Leptochloa 1323 Chasmanthium latifolium 67 0·99 93 1·00 Aristida gypsophila Danthonia compressa Rytidosperma penicellatum 100 1·00 Ellisochloa rangei Neyraudia reynaudiana 100 1·00 Triraphis mollis Centropodieae Triraphideae 82 1·00 Cottea pappophoroides Enneapogon scaber 100 1·00 100 1·00 100 1·00 Uniola condensata Eragrostideae 100 1·00 100 1·00 92 100 1·00 98 1·00 0·97 UNIOLINAE ERAGROSTIDINAE ZOYSIINAE SPOROBOLINAE PAPPOPHORINAE TRAGINAE MUHLENBERGIINAE BOUTELOUINAE MONANTHOCHLOINAE HILARIINAE SCLEROPOGONINAE TRIPOGONINAE AELUROPODINAE TRIODIINAE ORCUTTIINAE TRIDENTINAE Trigonochloa Dinebra Diplachne Leptochloa Disakisperma F I G . 3. Phylogram of maximum-likelihood tree from analysis of combined plastid and ITS sequences. Numbers above branches represent bootstrap values; numbers below branches represent posterior probabilities; colour indicates native distribution (see legend); roman numerals indicate clades discussed in the text and correspond to recognized genera: I ¼ Trigonochloa, II and III ¼ Dinebra, IV ¼ Diplachne, V ¼ Leptochloa and VI ¼ Disakisperma. Scale bar ¼ 10 % sequence divergence. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Entoplocamia aristulata Psammagrostis wiseana Eragrostis kennedyae Ectrosia scabrida Harpachne harpachnoides Eragrostis nigricans Zoysia macrantha ssp. walshii 100 100 Sporobolus virginicus 1·00 100 1·00 Crypsis aculeata 85 1·00 Zoysieae 100 Calamovilfa longifolia 1·00 1·00 Spartina densiflora 98 Neesiochola barbata 1·00 Pappophorum pappiferum 84 Tragus racemosus 100 1·00 Monelytrum luederitzianum 1·00 100 Willkommia sarmentosa 0·87 93 100 Muhlenbergia japonica 1·00 1·00 1·00 Muhlenbergia schreberi Allolepis texana 81 Jouvea pilosa 1·00 Bouteloua simplex 85 Distichlis humilis 100 0·73 1·00 Distichlis littoralis 1·00 100 1·00 Distichlis eludens Sohnsia filifolia 62 0·70 100 100 Hilaria cenchroides 0·97 1·00 1·00 Pleuraphis rigida 0·75 Swallenia alexandrae Chlorideae 100 Blepharidachne benthamiana 56 1·00 0·96 Scleropogon brevifolius 98 Desmostachya bipinnata Melanocenchris abyssinica 99 1·00 Eragrostiella leioptera 1·00 100 1·00 Tripogon multiflorus Aeluropus littoralis 0·95 53 Orinus kokonorica 1·00 Triodia intermedia Neobouteloua lophostachya 98 Brachychloa schiemanniana 1·00 90 Dactyloctenium australe 97 1·00 Dactyloctenium aegyptium 1·00 89 Dactyloctenium bogdanii 1·00 84 1·00 Dactyloctenium giganteum 98 Orcuttia tenuis 1·00 Tuctoria greenei 0·99 82 Sclerodactylon macrostachyum 0·93 Triplasis purpurea 87 0·68 Gouinia paraguayensis 0·94 100 1·00 Vaseyochloa multinervosa 70 Ctenium brevispicatum 67 0·84 Trichoneura eleusinoides 0·68 Dignathia hirtella 83 83 Gymnopogon grandiflorus 99 0·85 1·00 Bewsia biflora 1·00 54 0·53 56 0·80 Lophacme digitata 0·88 97 Leptochloa uniflora Greenway 14075 1·00 Leptochloa uniflora Snow 6978 100 Mosdenia phleoides 1·00 100 Lopholepis ornithocephala 72 1·00 Perotis hordeiformis 0·97 52 0·53 Toliara arenacea Leptochloa chinensis 100 88 Dinebra retroflexa 1·00 1·00 Leptochloa squarrosa 100 100 Leptochloa marquisensis 1·00 Leptochloa xerophila 65 1·00 0·96 Leptochloa panicea ssp. mucronata 98 95 97 Leptochloa panicea ssp. brachiata Peterson 22185 1·00 1·00 1·00 Leptochloa panicea ssp. brachiata Peterson 22086 Drake-brockmania somalensis 65 Leptochloa caudata 98 0·66 88 Leptochloa coerulescens Leptochloa panicoides 1·00 1·00 98 1·00 72 Leptochloa viscida Peterson 22184 57 1·00 Leptochloa viscida Snow 6528a 1·00 100 Leptochloa nealleyi 1·00 Leptochloa scabra 63 79 Leptochloa neesii 1·00 1·00 98 100 Leptochloa ligulata 1·00 1·00 Leptochloa southwoodii 95 78 Leptochloa decipiens ssp. asthenes Snow 7327 1·00 100 1·00 Leptochloa decipiens ssp. asthenes Snow 7355 Leptochloa decipiens ssp. peacockii 1·00 100 Leptochloa decipiens ssp. asthenes Snow 7328 1·00 Leptochloa decipiens ssp. asthenes Waterhouse 5948 ELEUSININAE 100 Coelachyrum poiflorum 1·00 Eleusine indica Leptochloa fusca ssp. uninervia Peterson 21305 100 65 Leptochloa fusca ssp. muelleri 1·00 65 0·99 Leptochloa fusca ssp. uninervia Peterson 20786 1·00 Leptochloa digitata 100 Leptochloa virgata Rimachi 8359 1·00 52 100 100 Leptochloa virgata Peterson 15088 1·00 1·00 1·00 Leptochloa virgata Vargas 2710 0·61 100 Trichloris crinita 1·00 Trichloris pluriflora 78 100 Astrebla pectinata 0·95 1·00 Austrochloris dichanthioides 100 North America Leptochloa dubia Peterson 22334 68 100 1·00 Leptochloa dubia Peterson 8105 0·97 1·00 100 Leptochloa eleusine South America 1·00 Leptochloa obtusiflora 65 Schoenefeldia transiens 1·00 Central Africa (Kenya, Tanzania) 88 Enteropogon macrostachys 1·00 58 Lintonia nutans 100 South Africa 1·00 0·97 Chloris barbata 100 Saugetia fasciculata 100 1·00 1·00 Australia Tetrapogon villosus 84 Lepturus gasparricensis 1·00 94 Microchloa caffra Marquesas Islands 1·00 100 Brachyachne fibrosa 100 100 Brachyachne chrysolepis 1·00 1·00 1·00 Brachyachne patentiflora 62 100 Eustachys paspaloides 0·92 1·00 Eustachys petraea 93 0·1 Chrysochloa hindsii 1·00 95 Cynodon maritimus 100 1·00 Cynodon hirsutus 1·00 68 Brachyachne convergens 0·70 68 1·00 Brachyachne tenella 100 1·00 COTTEINAE 1324 Peterson et al. — Phylogeny and classification of Leptochloa (V); and (V) and (VI) are similar to the plastid tree. Branch support for Eleusininae is lacking. Analysis of combined plastid and ITS sequences Other novelties Our trees portray the evolutionary relationships for non-Leptochloa s.l. and related taxa that were previously found in Peterson et al. (2010a), except for the following. In this study, Desmostachya bipinnata (L.) Stapf is aligned within Tripogoninae (BS ¼ 99, PP ¼ 1.00) but was earlier reported as incertae sedis (Peterson et al., 2010a). The new monotypic genus, Toliara arenacea Judz., is aligned with Perotis and will need to be investigated further (Judziewicz, 2009). Sclerodactylon macrostachyum (Benth.) A.Camus, although based on only two markers (rpL32-trnL and ccsA), is aligned within Tridentinae as sister to Triplasis purpurea (Walter) Chapm. and is not a member of Eleusininae as earlier reported (Peterson et al., 2010a). DISCUSSION Our results indicate that Leptochloa, as currently circumscribed, is polyphyletic and our phylograms show that at least five major clades are necessary to portray the evolutionary relationships among the species (Columbus et al., 2007; Peterson et al., 2010a). Monophyly of Eleusininae is moderately supported (BS ¼ 79, PP ¼ 1.00) by the combined plastid – ITS tree, whereas earlier support for this subtribe was based entirely on posterior probabilities (Peterson et al., 2010a). We attribute the slightly higher support value for Eleusininae to increased taxon sampling and more polymorphic markers that we selected from different regions (spacers, introns and coding regions). Clade I Leptochloa uniflora (clade I, Figs 1 – 3) and L. rupestris C.E.Hubb. share a unique character of a deep, vertically walled (or nearly so) sulcus on the hilar side of the trigonous caryopsis (Phillips, 1974b; Snow, 1997, 1998a). This was suggested by Snow (1998a) to be one of two useful phylogenetic characters of the caryopsis within Leptochloa spp. (the other being loose pericarps). Leptochloa uniflora does not align Clades II and III The majority of the species of Leptochloa s.l. (Fig. 3) occur in two moderately supported clades (II and III, each with BS ¼ 88, PP ¼ 1.00). The first clade includes Dinebra retroflexa, the Marquesas Island endemics L. marquisensis and L. xerophila, L. panicea, L. chinensis and L. squarrosa; the second clade comprises Drake-brockmania somalensis on a long branch sister to L. caudata, L. coerulescens, L. decipiens, L. ligulata, L. nealleyi, L. neesii, L. panicoides, L. scabra and L. southwoodii. Morphologically, Dinebra is similar to Leptochloa and the two genera have long been linked (Phillips, 1973; Clayton and Renvoize, 1986). Phillips (1973) indicated that Dinebra is closely related to the larger and more widespread Leptochloa and shares a racemose inflorescence of one- to several-flowered spikelets which disarticulate between the florets, three-nerved and keeled lemmas with pilose nerves, and lemmas with entire or toothed apices. Our molecular data clearly place Dinebra retroflexa (type species of the genus) within these core species of Leptochloa, despite its spikelet morphology being atypical compared with most others. A similar result was obtained by Columbus et al. (2007) where Dinebra retroflexa formed a clade in the combined trnL-F–ITS tree with L. panicea (BS ¼ 100). Drake-brockmania somalensis is unusual in having subcapitate inflorescences with two to six ovate spikes, 11- to 17-nerved upper glumes (mostly one- but occasionally two- or threenerved in Leptochloa) half as long to longer than the spikelet, and five- to seven-nerved lemmas (mostly three- but occasionally five-nerved in Leptochloa) (Phillips, 1995). The only other species placed in Drake-brockmania, D. haareri (Stapf & C.E.Hubb.) S.M.Phillips, was originally placed in a separate genus, Heterocarpha Stapf & C.E.Hubb., based on possessing three-nerved lemmas, but otherwise these two species are probably closely related (Phillips, 1974a). Even though we have not sampled L. aquatica Scribn. & Merr., L. simoniana N.Snow and L. srilankensis N.Snow, based on their morphological characteristics we believe they share a common ancestor with other species in clades II and III. Leptochloa simoniana, known only from Papua New Guinea, most closely resembles L. coerulescens in having narrow panicles with flexuous branches, leaf blades that are densely scabrous and upper glumes with margins that are densely scabrous (Snow, 2000). Leptochloa srilankensis is morphologically similar to L. decipiens subsp. asthenes, as both species have sparsely to moderately pilose leaf sheaths (the hairs usually tuberculate at base), rather short (1– 11 cm long) narrowly to ovate leaf blades that are 1 – 3 mm wide, Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 The ML tree based on data from the combined plastid and ITS regions is well resolved and is remarkably similar to the plastid tree and has six principal clades (Fig. 3, I– VI). Differences between the combined plastid – ITS tree and the plastid tree are: (1) overall support for Eleusininae is slightly higher (BS ¼ 79, PP ¼ 1.00) in the former tree; (2) clade IV (L. fusca) is not sister to remaining genera in Eleusininae but is placed in a grade with clades V and VI; (3) clades II and III are strongly supported (BS ¼ 95, PP ¼ 1.00) and, as in the ITS tree, L. coerulescens is included in clade III; and (4) clade V is strongly supported (BS ¼ 100, PP ¼ 1.00) in the former tree. In the following sections we will refer to the combined plastid – ITS tree when discussing evolutionary scenarios. with other species of Eleusininae but is sister to the Mosdenia – Toliara –Lopholepis – Perotis clade, providing further evidence for an independent origin. The latter four genera have an inflorescence of a single raceme whereas L. uniflora and L. rupestris have numerous racemose branches inserted along the main axis (Clayton et al., 2006; Snow, 1997). Apparently, the inflorescence structure is environmentally plastic and easy to alter in the evolutionary history of these African genera, a situation that recurs in other chloridoid genera such as Muhlenbergia, which also displays a wide range of branching types (Peterson et al., 2010b). Peterson et al. — Phylogeny and classification of Leptochloa Clade IV The controversy surrounding the use of Diplachne or Leptochloa was summarized by McNeill (1979), who discussed the diagnostic characters used to separate these taxa and provided a key to those that occur in North America. Our study does not support this division. Preliminary data using plastid restriction site banding patterns (N. Snow, unpubl. res.) of several North American Leptochloa spp. segregated the single North American species (L. fusca) from several others of the genus. However, there is strong support for recognizing the widely distributed L. fusca (Fig. 3, clade IV) in Diplachne as the type is included in this complex. Leptochloa fusca subsp. fusca is a polymorphic palaeotropical taxon that is adventive in a few areas of the New World (Nicora, 1995); L. fusca subsp. muelleri is known from much of the interior portions of eastern Australia, particularly the Northern Territory; L. fusca subsp. uninervia is native to the Neotropics but adventive elsewhere; and L. fusca subsp. fascicularis is native to the temperate and tropical regions of the New World (Snow, 1997). Also included in our interpretation of Diplachne is Leptochloa gigantea (Launert) Cope & N.Snow (not sampled), an obligate wetland species restricted to parts of eastern and southern Africa, given its possession, with L. fusca, of distinguishing characters such as long spikelets, apically attenuate ligules (before mechanical laceration) mostly 5 – 12 mm long and long (6 – 12 mm) florets (Snow, 1997). Clade V The inclusion of the American Trichloris crinita and T. pluriflora in clade V (Figs 1 – 3) has not been previously documented in molecular studies. Previous molecular results indicated that the two Trichloris spp. were sister and not closely related to Chloris where they often have been placed (Anderson, 1974; Watson and Dallwitz et al., 1992; Peterson et al., 2010a). Likewise, the inclusion of Enteropogon chlorideus (J.Presl) Clayton in Leptochloa sensu stricto (s.s.) has not been definitively documented using molecular studies. However, Columbus et al. (2007) did show strong support for a clade containing T. crinita and E. chlorideus. To test these relationships we included E. chlorideus (EF153044) and E. mollis (Nees) Clayton (EF153045) ITS sequences in our analysis (results not shown). Enteropogon chlorideus formed a clade with Saugetia fasciculata Hitchc. & Chase and Tetrapogon villosus Desf., whereas E. mollis was aligned with Leptochloa s.s. As we have a single ITS marker supporting the inclusion of E. mollis within Leptochloa s.s. and no plastid sequences, it is premature to transfer this species to Leptochloa. We hope to sample many species of Chloris, Enteropogon and Eustachys to clarify generic boundaries. The wide ranging neotropical Leptochloa virgata, the southern South American L. chloridiformis (Hack.) Parodi (not sampled), the Australian endemic L. digitata and the two Trichloris spp. possess an inflorescence with digitate or subdigitately inserted racemes usually with two or more branches per node. Historically, agrostologists have placed great importance on whether the lemma is awned, and, if so, how many times. A distinguishing feature of T. crinita and T. pluriflora is that the lemmas are three-awned. Apparently this trait is not important when determining phylogenetic relationships as L. digitata has unawned lemmas, L. virgata has singleawned or mucronate lemmas, and L. chloridiformis is at most mucronate (Snow, 1997). Additional characters shared by L. digitata, L. chloridiformis and L. virgata include a perennial habit, solid culms and short, apically truncate (but slightly fimbriate) ligules. Clade VI Many taxonomists have recognized Leptochloa dubia as a unique, polymorphic, widespread taxon as it has deeply bifid or notched lemmas with short, glabrous lateral nerves (Steudel, 1854; Philippi, 1870; Valls, 1978; McNeill, 1979). Clade VI (Figs 1 – 3) of our study includes L. dubia distributed in temperate North and South America, L. eleusine from South Africa, and L. obtusiflora from central Africa. Leptochloa eleusine and L. obtusiflora are atypical within Leptochloa s.l. by possessing clavicorniculate macrohairs on the lemmas (Snow, 1996, 1997). Hairs having a clavicorniculate apex have been reported to function as salt glands in the panicoid genus Eriochloa (Arriaga, 1992). Along with a few other species in Leptochloa, L. eleusine and L. obtusiflora have a weakly adnate pericarp on the caryopses (Snow, 1997). The adhesion of the pericarp has been shown to be an important character defining natural groups in Chloridoideae (Sporobolinae; Peterson et al., 2010a). Future workers should sample additional Coelachyrum spp. as they have clavicorniculate microhairs (Snow, 1996) and a spikelet structure that closely resembles those of L. eleusine and L. obtusiflora (Snow, 1997). TAX ON O M Y Because our molecular analysis renders Leptochloa s.l. polyphyletic, we propose recognizing five genera (Dinebra, Diplachne, Disakisperma, Leptochloa and Trigonchloa), each of which was found in a separate, strongly supported clade (Fig. 3, BS values ≥95). Given their overall similarities to other species, Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 panicles 6 – 40 cm long with glabrous branch axils, and spikelets that are two- to four- (five-)flowered (Snow, 1997). Leptochloa aquatica most closely resembles L. panicoides by having an annual habit, long (4 – 20 cm) leaf blades that are 4.0 – 8.3 mm wide, long (20 – 36 cm) panicles that are relatively narrow (2 –12 cm wide), four- to six-flowered spikelets, lemmas that are 2.4 – 3.5 mm long, and caryopses that are 1.1 – 1.5 mm long (McVaugh, 1983; Snow, 1997). The placement of L. coerulescens is not congruent between the plastid and ITS trees (Figs 1 and 2). In the plastid tree (Fig. 1, IIIB) L. coerulescens is in a separate clade sister to Coelachyrum – Eleusine whereas in the ITS tree (Fig. 2, III) it is sister to L. caudata. We attribute the uncertain position to possible DNA shuffling (introgression) and the mixing of phylogenetic signals from two or more distant progenitors. We hope to address this question by applying low copy nuclear markers to taxa of Chlorideae. 1325 1326 Peterson et al. — Phylogeny and classification of Leptochloa TA B L E 3. Key to the genera 1 1′ 2 2′ 3′ 4 4′ Trigonochloa 2 Diplachne 3 Disakisperma 4 Leptochloa Dinebra Dinebra perrieri (A.Camus) Bosser, Dinebra polycarpha S.M.Phillips, Drake-brockmania haareri (Stapf & C.E.Hubb.) S.M.Phillips, Leptochloa aquatica, L. chloridiformis, L. gigantea, L. rupestris, L. simoniana and L. srilankensis can be confidently placed among the identified clades. Leptochloa divaricatissima S.T.Blake probably belongs in Dinebra, but we are withholding transfer pending additional work. The placement of L. longa Griseb., L. malayana (C.E.Hubb.) Jansen ex Veldkamp and L. tectoneticola (Backer) Jansen ex Veldkamp also will require additional sequencing studies, because morphologically they are at odds with other species of Leptochloa s.l. (Snow, 1997). We provide a preliminary key to the newly circumscribed genera and list of accepted species in Table 3. The species are listed below: new combinations appear in bold and species not included in our DNA analysis are preceded by an asterisk (*). Dinebra Jacq., Fragm. Bot. 77. 1809. (Fig. 3, clades II & III) Type: D. arabica Jacq. [;D. retroflexa (Vahl) Panz.]. ¼ Drake-brockmania Stapf, Bull. Misc. Inform. Kew 1912: 197. 1912. Type: D. somalensis Stapf. 1. *Dinebra aquatica (Scribn. & Merr.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa aquatica Scrinb. & Merr., Bull. Div. Agrostol., U.S.D.A. 24: 26. 1901. 2. Dinebra caudata (K.Schum.) P.M.Peterson & N.Snow, comb. nov. Basionym: Diplachne caudata K.Schum., Pflanzenw. Ost-Afrikas 113. 1895. ;Leptochloa caudata (K.Schum.) N.Snow. 3. Dinebra chinensis (L.) P.M.Peterson & N.Snow, comb. nov. Basionym: Poa chinensis L., Sp. Pl. 1: 69. 1753. ;Leptochloa chinensis (L.) Nees. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 3 Leaf blades thin, membranous, broader than linear; caryopses trigonal in transverse section; sulcus present, deep with nearly vertical walls; one or two lateral bundle sheath cells on each side significantly enlarged Leaf blades thicker, more or less linear; caryopses lenticular to terete in cross section, sulcus absent or if present then shallow; enlarged lateral bundle sheath cells lacking Ligules 4– 8 (– 15) mm long, apex acute to attenuate, lacerate only by tearing Ligules 0.2 –8.0 (– 15.0) mm long, apex usually truncate to obtuse and somewhat erose Apex of the lemmatal hairs clavicorniculate, ovate to broadly ovate; base of lemma often indurate and sometimes five-veined; plants perennial; ligules 0.8 – 2.2 mm long, apex erose Apex of the lemmatal hairs ovate to acute, never clavicorniculate; base of lemma soft and always three-veined; plants annual or perennial; ligules (0.2 –) 0.5 –5.5 (– 7.0) mm long, apex usually entire Panicle branches digitate to sub-digitate inserted along the rachis usually with two or more branches per node; lemmas one- or three-awned or unawned; plants perennial; culms solid; ligules 0.5–3.0 mm long, apex ciliate Panicle branches racemosely inserted along the rachis, rarely digitate to sub-digitate, usually with a single branch per node; lemmas unawned; plants annual or perennial; culms solid or hollow; ligules (0.2–) 0.5 –5.5 (–7.0) mm long, apex erose or entire but never ciliate 4. Dinebra coerulescens (Steud.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa coerulescens Steud., Syn. Pl. Glumac. 1: 209. 1854. 5. Dinebra decipiens (R.Br.) P.M.Peterson & N.Snow, comb. nov. Basionym: Poa decipiens R.Br., Prodr. 181. 1810. ;Leptochloa decipiens (R.Br.) Stapf ex Maiden. 5a. Dinebra decipiens subsp. asthenes (Roem. & Schult.) P.M.Peterson & N.Snow, comb. nov. Basionym: Poa asthenes Roem. & Schult., Syst.Veg. 2: 574. 1817. 5b. Dinebra decipiens subsp. peacockii (Maiden & Betche) P.M.Peterson & N.Snow, comb. nov. Basionym: Diplachne peacockii Maiden & Betche, Agric. Gaz. New South Wales 15: 925. 1904. 6. *Dinebra haareri (Stapf & C.E.Hubb) P.M.Peterson & N.Snow, comb. nov. Basionym: Heterocarpha haareri Stapf & C.E.Hubb., Bull. Misc. Inform. Kew 1929: 263. 1929. ;Drake-brockmania haareri (Stapf & C.E.Hubb.) S.M.Phillips. 7. Dinebra ligulata (Lazarides) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa ligulata Lazarides, Brunonia 3(2): 259. 1980. 8. Dinebra marquisensis (F.Br.) P.M.Peterson & N.Snow, comb. nov. Basionym: Eragrostis marquisensis F.Br., Bernice P. Bishop Mus. Bull. 84: 81. 1931. ;Leptochloa marquisensis (F.Br.) P.M.Peterson & Judz. 9. Dinebra nealleyi (Vasey) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa nealleyi Vasey, Bull. Torrey Bot. Club 12: 7. 1885. 10. Dinebra neesii (Thwaites) P.M.Peterson & N.Snow, comb. nov. Basionym: Cynodon neesii Thwaites, Enum. Pl. Zeyl. 371. 1864. ;Leptochloa neesii (Thwaites) Benth. 11. Dinebra panicea (Retz.) P.M.Peterson & N.Snow, comb. nov. Basionym: Poa panicea Retz., Observ. Bot. 3: 11. 1783. ;Leptochloa panicea (Retz.) Ohwi. 11a. Dinebra panicea subsp. brachiata (Steud.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa brachiata Steud., Syn. Pl. Glumac. 1: 209. 1854. 11b. Dinebra panicea subsp. mucronata (Michx.) P.M.Peterson & N.Snow, comb. nov. Basionym: Eleusine mucronata Michx., Fl. Bor.-Amer. 1: 65. 1803. 12. Dinebra panicoides (J.Presl) P.M.Peterson & N.Snow, comb nov. Basionym: Megastachya panicoides J.Presl, Reliq. Haenk. 1(4 – 5): 283. 1830. ;Leptochloa panicoides (J.Presl) Hitchc. 13. *Dinebra perrieri (A.Camus) Bosser. 14. *Dinebra polycarpha S.M.Phillips. 15. Dinebra retroflexa (Vahl) Panz. 16. Dinebra scabra (Nees) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa scabra Nees, Agrostogr. Bras. 2: 435. 1829. 17. *Dinebra simoniana (N.Snow) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa simoniana N.Snow, Novon 10: 328. 2000. 18. Dinebra somalensis (Stapf ) P.M.Peterson & N.Snow, comb. nov. Basionym: Drake-brockmania somalensis Stapf, Bull. Misc. Inform. Kew 1912: 197. 1912. 19. Dinebra southwoodii (N.Snow & B.K.Simon) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa southwoodii N.Snow & B.K.Simon, Austrobaileya 5(1): 138. 1997. Peterson et al. — Phylogeny and classification of Leptochloa Diagnosis Trigonochloa differs from Perotis Aiton by having an inflorescence with several to numerous unilateral, secund racemes scattered along a central axis, a three-veined lemma and a trigonous caryopsis with a deep sulcus on the hilar surface. Description Plants annual to short-lived perennial, sprawling or clambering, often stoloniferous. Culms 30 –150 cm long, mostly decumbent. Leaf sheaths 12 to almost as long as the internodes above, glabrous; ligule membranous, irregularly lacerate with age; leaf blades 3 – 12 cm long, 2 – 18 mm wide, broad, lanceolate– oblong to narrowly oblong or narrowly lanceolate, glabrous and smooth, often thin and flaccid, apex acute. Inflorescence 6 – 45 cm long, open oblong to narrowly oblong to narrowly elliptic, composed of several to numerous unilateral, secund racemes scattered along a central axis, each spikelet oriented laterally to the axis; rachis semiterete; racemes 2 –9 cm long, ascending, straight or slightly arching. Spikelets 1.6 – 2.8 mm long, one-flowered, laterally compressed, sub-sessile, overlapping; disarticulation above the glumes; glumes 1.6– 2.4 mm long, as long or longer than the floret, sub-equal, linear to linear lanceolate, one-nerved, apex acute to acuminate; lemmas 1.5– 2.1 mm long, narrowly elliptic to elliptic oblong, three-nerved, minutely hairy along the nerves, apex acute, entire; paleas keels ciliolate, two-nerved. Caryopsis 1.0 – 1.2 mm long, narrowly elliptic, trigonous in cross section, deeply sulcate on the hilar side; pericarp adherent. 2n ¼ 36 (for T. uniflora). Leaf anatomy A probable synapomorphy for Trigonochloa is the presence of greatly enlarged lateral cells in the primary vascular bundles, i.e. the presence of one or two cells on each side of the wreath that are significantly larger than the others. We include a summary of the anatomical characteristics for the two species presented in Snow (1997). Leaf blades generally thinly membranous. Keels present but lacking lacunae. Outer sheath of primary bundles continuous adaxially, continuous or interrupted abaxially. Extension cells above primary bundles present or absent. Rib size of primary bundles of normal size. Secondary outer bundle continuous abaxially. Primary bundle adaxial sclerenchyma absent, or present as a girder. Primary bundle abaxial sclerenchyma present as a girder. Secondary bundle adaxial sclerenchyma absent. Secondary bundle abaxial sclerenchyma present as girders. Adaxial cells of primary bundle sheath cells not enlarged. Abaxial cells of primary bundle sheath cells not enlarged. Primary bundles not projecting adaxially. Primary bundles not projecting abaxially. Secondary bundles not projecting adaxially. Secondary bundles not projecting abaxially. Primary and secondary bundles height nearly equal. Colourless cells absent between primary and secondary bundles. Chlorenchyma continuous between adjacent bundles. Continuous abaxial band of sclerenchyma below epidermis absent. Phloem not interrupted by abaxial sclerenchyma. Vascular bundles with greatly enlarged lateral cells. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 20. Dinebra squarrosa (Pilg.) P.M.Peterson & N.Snow, comb. nov. Basionyn: Leptochloa squarrosa Pilg., Bot. Jahrb. Syst. 45: 210. 1910. 21. *Dinebra srilankensis (N.Snow) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa srilankensis N.Snow, Novon 8: 183. 1998. 22. Dinebra viscida (Scribn.) P.M.Peterson & N.Snow, comb. nov. Basionym: Diplachne viscida Scribn., Bull. Torrey Bot. Club 10(1): 30. 1883. ;Leptochloa viscida (Scribn.) Beal. 23. Dinebra xerophila (P.M.Peterson & Judz.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa xerophila P.M.Peterson & Judz., Taxon 39: 659. 1990. Diplachne P.Beauv., Ess. Agrostogr. 80. 1812. (Fig. 3, clade IV) Type: D. fascicularis (Lam.) P.Beauv. [;Leptochloa fusca subsp. fascicularis (Lam.) N.Snow] 1. Diplachne fusca (L.) P.Beauv. ex Roem. & Schult. ;Leptochloa fusca (L.) Kunth. 1a. Diplachne fusca subsp. fasciculata (Lam.) P.M.Peterson & N.Snow, comb. nov. Basionym: Festuca fascicularis Lam., Tabl. Encycl. 1: 189. 1791. 1b. Diplachne fusca subsp. muelleri (Benth.) P.M.Peterson & N.Snow, comb. nov. Basionym: Diplachne muelleri Benth., Fl. Austral. 7: 619. 1878. 1c. Diplachnea fusca subsp. uninervia (J.Presl) P.M.Peterson & N.Snow, comb. nov. Basionym: Megastachya uninervia J.Presl, Reliq. Haenk 1(4 – 5): 283. 1830. 2. *Diplachne gigantea Launert. Disakisperma Steud., Syn., Pl. Glumac. 1: 287. 1854. (Fig. 3, clade VI) Type: D. mexicana Steud. (; D. dubia). 1. Disakisperma dubia (Kunth) P.M.Peterson & N.Snow, comb. nov. Basionym: Chloris dubia Kunth, Nov. Gen. Sp. 1: 169. 1816. ;Leptochloa dubia (Kunth) Nees. 2. Disakisperma eleusine (Nees) P.M.Peterson & N.Snow, comb. nov. Basionym: Diplachne eleusine Nees, Fl. Afr. Austral. Ill. 255. 1841. ;Leptochloa eleusine (Nees) Cope & N.Snow. 3. Disakisperma obtusiflora (Hochst.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa obtusiflora Hochst., Flora 38: 203. 1855. Leptochloa P.Beauv., Ess. Agrostogr. 71. 1812. (Fig. 3, clade V) Type: L. virgata (L.) Benth. ¼ Trichloris E.Fourn. ex Benth., J. Linn. Soc., Bot. 19: 102. 1881. Lectotype: Trichloris pluriflora E.Fourn. 1. *Leptochloa chloridiformis (Hack.) Parodi. 2. Leptochloa digitata (R.Br.) Domin. 3. Leptochloa virgata (L.) Benth. 4. Leptochloa crinata (Lag.) P.M.Peterson & N.Snow, comb. nov. Basionym: Chloris crinata Lag., Varied. Ci. 2(4): 143. 1805. 5. Leptochloa pluriflora (E.Fourn.) P.M.Peterson & N.Snow, comb. nov. Basionym: Trichloris pluriflora E.Fourn., Mexic. Pl. 2: 142. 1886. Trigonochloa P.M.Peterson & N.Snow, gen. nov. (Fig. 3, clade I) Type: Leptochloa uniflora Hochst. ex A.Rich. 1327 1328 Peterson et al. — Phylogeny and classification of Leptochloa [Vouchers, all South Africa: Snow et al. 6978 (MO), Davidse & Ellis 5925 (MO); Ellis 3635 (PRE); Ellis 4534 (PRE)]. Distribution and habitat The generic name emphasizes the unique, trigonous caryopses with a deep sulcus on the hilar (ventral) surface. 1. *Trigonochloa rupestris (C.E.Hubb.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa rupestris C.E.Hubb., Kew Bull. 1941: 195. 1941. 2. Trigonochloa uniflora (Hochst. ex A.Rich.) P.M.Peterson & N.Snow, comb. nov. Basionym: Leptochloa uniflora Hochst. ex A.Rich., Tent. Fl. Abyss. Tent. 2: 409–410. 1851. Currently unplaced species Leptochloa Leptochloa Leptochloa Leptochloa Supplementary data are available on line at www.aob.oxfordjournals.org and consist of Table S1: list of specimens sampled, voucher (collector, number and where the specimen is housed), country of origin and GenBank accessions for DNA sequences; and a sequence alignment for each of the six DNA markers ( provided as an Excel file). ACK N OW L E DG E M E N T S Notes 1. 2. 3. 4. S U P P L E M E N TARY D ATA divaricatissima S.T.Blake longa Griseb. malayana (C.E.Hubb.) Jansen ex Veldkamp tectoneticola (Backer) Jansen ex Veldkamp We thank the National Geographic Society Committee for Research and Exploration (Grant No. 8087-06) for field and laboratory support, the Smithsonian Institution’s Restricted Endowments Fund, the Scholarly Studies Program, Research Opportunities, Atherton Seidell Foundation, Biodiversity Surveys and Inventories Program, Small Grants Program, and the Laboratory of Analytical Biology, all for financial support. We would also like to acknowledge Lee Weigt, Jeffery Hunt and David Erickson for help in the laboratory; Robert J. Soreng, Jeffery M. Saarela, Gene Rosenberg, Emmet J. Judziewicz, Carol R. Annable and Nancy Refulio Rodriguez for accompanying the first author on numerous field expeditions; Robert J. Soreng for many extended discussions pertinent to the manuscript; and Jeffery M. Saarela and an anonymous reviewer for providing helpful comments on the manuscript. CO NCL USI ON S We have performed a multi-gene phylogenetic analysis based on six molecular markers (nuclear ITS and plastid rpL32-trn-L, ndhA intron, rps16 intron, rps16-trnK and ccsA DNA sequences) of 22 Leptochloa spp. Previously, only four Leptochloa spp. had been included in a molecular analysis and they appeared polyphyletic (Peterson et al., 2010a). Our results indicate that Leptochloa is polyphyletic and our phylograms show that at least five major clades are necessary to portray the evolutionary relationships among the species. Our molecular results support the dissolution of Leptochloa s.l. into five genera: Dinebra, Diplachne, Disakisperma, Leptochloa s.s. and Trigonochloa. Based on the interpretation of our phylogenetic trees and for consistency in rank we provide the necessary changes in the classification of these species. We recognize an expanded Dinebra that includes 23 species, two of which were formerly placed in Drake-brockmania and 19 species in Leptochloa; Diplachne includes two species; Disakisperma includes three species; Leptochloa includes five species, two of which were formerly placed in Trichloris; and a new genus, Trigonochloa, includes two species. There are still 13 species of Leptochloa s.l. (including Dinebra) that need to be surveyed with molecular markers, although nine can be classified with a high degree of confidence given previous studies of morphology (Phillips, 1973; Anderson, 1974; Snow, 1997), stem and leaf L I T E R AT U R E C I T E D Anderson DE. 1974. Taxonomy of the genus Chloris (Gramineae). Brigham Young University Science Bulletin: Biological Series 29: 1 –133. Arriaga MO. 1992. Salt glands in the flowering culms of Eriochloa species (Poaceae). Bothalia 22: 111– 117. Barker FK, Lutzoni FM. 2002. The utility of the incongruence length difference test. Systematic Biology 51: 625– 637. Chen S, Phillips SM. 2006. 129. Leptochloa. In: Wu ZY, Raven PH, Hong DY. eds. Flora of China: Poaceae, vol. 22. Beijing: Science Press; and St. Louis: Missouri Botanical Garden Press, 469–470. Clayton WD, Renvoize SA. 1986. Genera graminum: grasses of the World. Kew Bulletin Additional Series 13: 1 –389. Clayton WD, Vorontsova MS, Harman KT, Williamson H. (2006 onwards). GrassBase - the online World grass flora. Kew: The Board of Trustees, Royal Botanic Gardens. http://www.kew.org/data/grassesdb.html (accessed 6 September 2011). Columbus JT, Cerros-Tlatilpa R, Kinney MS, et al. 2007. Phylogenetics of Chloridoideae (Gramineae): a preliminary study based on nuclear ribosomal internal transcribed spacer and chloroplast trnL-F sequences. Aliso 23: 565 –579. Darlu P, Lecointre G. 2002. When does the incongruence length difference test fail? Molecular Biology and Evolution 19: 432–437. Drummond AJ, Ashton B, Buxton S, et al. 2011. Geneious, v5.3. Available from: http://www.geneious.com Duvall MR, Peterson PM, Christensen AH. 1994. Alliances of Muhlenbergia (Poaceae) within New World Eragrostideae are identified by phylogenetic analysis of mapped restriction cites from plastid DNAs. American Journal of Botany 81: 622– 629. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792– 1797. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 The two species are distributed in Africa: west tropical, west-central tropical, north-east tropical, east tropical, southern tropical, and south and Asia-temperate: Arabia. Asia-tropical: India. Plants occur in forests and shady areas on hillsides, bushlands, on well-drained and often sandy soils and damp rocks along streams in disturbed Yemen and Eritrea south to Kenya; woodlands, hillsides, bushland and on damp rocks along streams and riverine areas in disturbed habitats at 0 – 1800 m. anatomy (Snow, 1997; N. Snow, unpubl. data) and lemma micromorphology (Snow, 1996). A much larger molecular sample of species now included in Chloris, Enteropogon and Eustachys is needed to clarify affinities. Peterson et al. — Phylogeny and classification of Leptochloa Phillips SM. 1974b. 66. Leptochloa. In: Polhill RM. ed. Flora of tropical east Africa, Gramineae, part 2. London: Crown Agents for Oversea Governments and Administrations, 276–281. Phillips SM. 1982. A numerical analysis of the Eragrostideae (Gramineae). Kew Bulletin 37: 133– 162. Phillips SM. 1995. Poaceae (Gramineae). In: Hedberg I, Edwards S. eds. Flora of Ethiopia and Eritrea, vol. 7. Addis Ababa: Addis Ababa University; and Uppsala: Uppsala University, 1 –420. Posada D. 2008. jModelTest model averaging. Molecular Biology and Evolution 25: 1253– 1256. Ronquist F, Huelsenbeck JP. 2003. Mr Bayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. Snow N. 1996. The phylogenetic utility of lemmatal micromorphology in Leptochloa s.l. and related genera in subtribe Eleusininae (Poaceae, Chloridoideae). Annals of the Missouri Botanical Garden 83: 504–529. Snow N. 1997. Phylogeny and systematics of Leptochloa P. Beauv. sensu lato (Poaceae: Chloridoideae). PhD thesis, Washington University, St. Louis, Missouri, USA. Snow N. 1998a. Caryopsis morphology of Leptochloa sensu lato (Poaceae, Chloridoideae). Sida 18: 271–282. Snow N. 1998b. A new species of Leptochloa (Poaceae, Chloridoideae) from Sri Lanka. Novon 8: 183– 186. Snow N. 2000. A new Leptochloa (Poaceae: Chloridoideae) from Papua New Guinea and the Torres Strait Islands of Australia. Novon 10: 238–241. Snow N. 2003. 17.19 Leptochloa P. Beauv. In: Barkworth ME, Capels KM, Long S, Piep MB. eds. Magnoliophyta: Commelinidae (in part): Poaceae, part 2. Flora of North America North of Mexico. New York: Oxford University Press, 51–60. Snow N, Simon BK. 1997. Leptochloa southwoodii (Poaceae: Chloridoideae), a new species from south-east Queensland. Austrobaileya 5: 137 –143. Steudel EG. 1854. Synopsis Plantarum Graminearum, pars 1 Gramineae. Stuttgart: J.B. Metzler, 1 –474. Swofford DL. 2000. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4. Sunderland, MA: Sinauer Associates. Valls JFM. 1978. A biosystematic study of Leptochloa with special emphasis on Leptochloa dubia (Gramineae: Chloridoideae). PhD thesis, Texas A&M University, College Station, USA. Watson L, Dallwitz MJ. 1992. The grass genera of the World. Wallingford, UK: CAB International. Xie Z, Merchant S. 1996. The plastid-encoded ccsA gene is required for heme attachment to chloroplast c-type cytochromes. Journal of Biological Chemistry 271: 4632–4639. Zwickl DJ. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD thesis, University of Texas, USA. Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 Farris JS, Källersjö M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10: 315 –319. Hilu KW, Alice LA. 2001. A phylogeny of Chloridoideae (Poaceae) based on matK sequences. Systematic Botany 26: 386–405. Huelsenbeck JP, Ronquist F.R. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754 –755. Ingram AL, Doyle JJ. 2007. Eragrostis (Poaceae): monophyly and infrageneric classification. Aliso 23: 595 –604. Judziewicz EJ. 2009. Toliara (Poaceae, Chloridoideae, Cynodonteae), a new grass genus endemic to southern Madagascar. Adansonia 31: 274 –276. McNeill J. 1979. Diplachne and Leptochloa (Poaceae) in North America. Brittonia 31: 399 –404. McVaugh R. 1983. Gramineae. In: Anderson WR. ed. Flora Novo-Galiciana: a descriptive account of the vascular plants of western Mexico. Ann Arbor, MI: University of Michigan Press, 1 –436. Nicora EG. 1995. Los generos Diplachne y Leptochloa (Gramineae: Eragrosteae) de la Argentina y paises limitrofes. Darwiniana 33: 233– 256. Niles CD, Chase A. 1925. A bibliographic study of Beauvois’ Agrostographie. Contributions from the U.S. National Herbarium 24: 135– 214. Nixon KC. 2002. WinClada, ver. 1.00.08. Ithaca, NY: published by the author. Palisot de Beavois AMFJ. 1812. Essai d’une nouvelle Agrostographie; ou nouveaux genres des Graminées; avec figures représentant les caractères de tous les genres. Paris: Imprimerie de Fain, 1 –182. Peterson PM, Webster RD, Valdes-Reyna J. 1997. Genera of New World Eragrostideae (Poaceae: Chloridoideae). Smithsonian Contributions to Botany 87: 1–50. Peterson PM, Columbus JT, Pennington SJ. 2007. Classification and biogeography of New World grasses: Chloridoideae. Aliso 23: 580–594. Peterson PM, Romaschenko K, Johnson G. 2010a. A classification of the Chloridoideae (Poaceae) based on multi-gene phylogenetics trees. Molecular Phylogenetics and Evolution 55: 580 –598. Peterson PM, Romaschenko K, Johnson G. 2010b. A phylogeny and classification of the Muhlenbergiinae (Poaceae: Chloridoideae: Cynodonteae) based on plastid and nuclear DNA sequences. American Journal of Botany 97: 1532–1554. Peterson PM, Romaschenko K, Barker NP, Linder HP. 2011. Centropodieae and Ellisochloa, a new tribe and genus in the Chloridoideae (Poaceae). Taxon 60: 1113–1122. Philippi RA. 1870. Sertum mendocinum alterum; ó sea, catálogo de las plantas recojidas cerca de Mendoza in en los caminos que conducen de Chile a esa ciudad. Anales de la Universidad de Chile 36: 159–212. Phillips SM. 1973. The genus Dinebra Jacq. (Gramineae). Kew Bulletin 28: 411– 418. Phillips SM. 1974a. Studies in the Gramineae: XXXV. Kew Bulletin 29: 267– 270. 1329 Downloaded from http://aob.oxfordjournals.org/ at Universidade Federal do Rio Grande do Norte on June 14, 2012 View publication stats