PRIMER NOTE Development of novel microsatellite markers for Alkanna tinctoria by comparative transcriptomics Muhammad Ahmad1,2, Desanka Lazic1, Karin Hansel-Hohl1, Christian Lexer Manuscript received 22 July 2019; revision accepted 9 September 2019. 1 Center for Health and Bioresources, AIT Austrian Institute of Technology GmbH, 3430, Tulln, Austria 2 Department of Botany and Biodiversity Research, Faculty of Life Sciences, University of Vienna, 1030, Vienna, Austria 3 Author for correspondence: eva-maria.sehr@ait.ac.at Citation: Ahmad, M., D. Lazic, K. Hansel-Hohl, C. Lexer, and E. M. Sehr. 2019. Development of novel microsatellite markers for Alkanna tinctoria by comparative transcriptomics. Applications in Plant Sciences 7(10): e11296. doi:10.1002/aps3.11296 2 , and Eva Maria Sehr1,3 PREMISE: Alkanna tinctoria (Boraginaceae) is an important medicinal herb with its main distribution across the Mediterranean region. To reveal its genetic variation and population structure, microsatellite markers were developed and validated in four Greek populations. METHODS AND RESULTS: RNA-Seq data of the related species Arnebia euchroma and Echium plantagineum were assembled and mined to identify conserved ortholog sets containing simple sequence repeat motifs. Fifty potential loci were identified and then tested on A. tinctoria, of which 17 loci were polymorphic. The number of alleles ranged from one to nine, and the levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and 0.000 to 0.820, respectively. Most of these loci could be successfully amplified in eight other species of Boraginaceae (Alkanna graeca, A. hellenica, A. sfikasiana, Echium vulgare, E. plantagineum, Lithospermum officinale, Borago officinalis, and Anchusa officinalis). CONCLUSIONS: This study provides the first set of microsatellite loci for studying the genetic variation and population structure of A. tinctoria and shows their potential usefulness in other Boraginaceae species. KEY WORDS Alkanna tinctoria; Boraginaceae; conserved ortholog set; microsatellites; population structure. Alkanna tinctoria Tausch (Boraginaceae) is a perennial herbaceous plant that is found across southern Europe, northern Africa, and southwestern Asia, with a central distribution across the Mediterranean region (Valdés, 2011). In Greece, its occurrence has been reported from all floristic regions including the islands (Dimopoulos et al., 2013). The use of A. tinctoria red root extracts as a coloring agent and in traditional medicine to treat wounds can be traced back to the period of Hippocrates and Theophrastus (Papageorgiou et al., 1999). Recently, several studies have confirmed the wound-healing, antimicrobial, anticancer, and antioxidant properties of root extracts from A. tinctoria, which are attributed to alkannin or shikonin produced in roots (Deng et al., 2018; Yan et al., 2019; Zhang et al., 2019). Because of these properties, these active ingredients have received increasing attention from the pharmaceutical, cosmetic, and food industries in recent years (Malik et al., 2016). However, most of the research on A. tinctoria until now has focused either on its chemical composition or on deciphering the function of active ingredients. The extent of genetic variation and the population structure of A. tinctoria in Greece or elsewhere have never been studied, which may restrict the management and planned utilization of this valuable resource. This is also evident from the National Center for Biotechnology Information (NCBI) databases where, except for barcoding sequences, no other information could be found. Because limited sequence information is available for this species, we employed a comparative transcriptomics approach using RNA-Seq data sets of the closely related species Echium plantagineum L. and Arnebia euchroma (Royle) I. M. Johnst., both in the Boraginaceae, to identify a conserved ortholog set (COS) containing simple sequence repeat (SSR) motifs, a method that has previously been used to develop markers for different species in Fabaceae (Chapman, 2015). By employing this strategy, we have successfully developed a first set of SSR markers for A. tinctoria, which will facilitate future genetic diversity and gene flow studies. Additionally, we tested the cross-species transferability of these markers in eight other species of Boraginaceae. METHODS AND RESULTS Raw RNA-Seq reads of E. plantagineum (SRR4034890) and A. euchroma (SRR4034892) obtained from the NCBI Sequence Read Archive (SRA) were uploaded to Galaxy public server (https://usegalaxy.eu). Applications in Plant Sciences 2019 7(10): e11296; http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Ahmad et al. Applications in Plant Sciences is published by Wiley Periodicals, Inc. on behalf of the Botanical Society of America. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. 1 of 5 Applications in Plant Sciences 2019 7(10): e11296 Ahmad et al.—Alkanna tinctoria microsatellites After filtering of reads for low-quality (Q < 30), poly-N, and adapter sequences using Trimmomatic Galaxy version 0.36.0 (Bolger et al., 2014), species-specific de novo assemblies were generated using Trinity Galaxy version 2.2.0 (Grabherr et al., 2011). The assembled contigs were then clustered (90% identity threshold) to generate 91,002 and 106,240 unigenes in E. plantagineum and A. euchroma, respectively, using CD-HIT-EST software Galaxy version 1.3 (Li and Godzik, 2006). Mining for SSR regions (≥6 di-, ≥5 tri-, ≥5 tetra-, and ≥5 pentanucleotide repeats) in each of the transcriptomes by MISA (Beier et al., 2017) resulted in 4999 (E. plantagineum) and 4821 (A. euchroma) SSR-harboring transcripts. Thirty-two to forty-five percent of SSR motifs were located in the first or last 50 bp of the transcripts and were discarded because they were not suitable for primer design. To identify the COS containing SSRs, transcripts predicted to contain SSR motifs were BLASTed against each other by running the BLAST Reciprocal Best Hits (RBH) Galaxy version 0.1.11 (Cock et al., 2015). A successful BLAST-RBH was considered as a potential COS-SSR locus. By using this strategy, 89 loci were identified. After pairwise alignments, we discarded 49 loci, either because there was no variation between aligned sequences or regions flanking SSR motifs were not suitable for primer design. Primers were designed from the remaining 50 COS-SSRs. • 2 of 5 Fresh leaves of A. tinctoria (n = 67) were collected from four different locations in Greece (Appendix 1). Genomic DNA was isolated using an in-house optimized protocol based on a cetyltrimethylammonium bromide (CTAB) method described in van der Beek et al. (1992). Briefly, 50 mg of powdered leaf tissues were homogenized in 400 μL of grinding buffer (0.35 M sorbitol, 0.1 M Tris-HCl, 5 mM EDTA, 20 mM NaHSO3, and 4% PVP 40; pH 8.9) followed by addition of 400 μL of lysis buffer (0.2 M Tris-HCL, 50 mM EDTA, 2 M NaCl, 2% CTAB; pH 8.6), 100 μL of sodium dodecyl sulfate (SDS; 10%), and 4 μL of Proteinase K. The mixture was incubated at 60°C for 1 h and centrifuged at 15,000 rpm and 4°C for 10 min. The supernatant was transferred to new 2-mL Eppendorf tubes containing 450 μL of buffer III (3 M CH3COOK and 5 M CH3COOH) and incubated on ice for 10 min, followed by centrifugation as described previously. The supernatant was precipitated with 560 μL of isopropanol by centrifugation at 15,000 rpm and 4°C for 25 min. The DNA pellet was washed with chilled 70% ethanol and was dissolved in 100 μL of double-autoclaved water containing 5 μL of RNase (10 mg/ mL). For initial amplification, primers were tested on two individuals of A. tinctoria. For 30 primer pairs that showed bands of expected size, 16 individuals from four populations were then TABLE 1. Characteristics of 17 polymorphic conserved ortholog set–simple sequence repeat markers developed for Alkanna tinctoria.a Locus C2 C3 C5 C9 C12 C13 C14 C16 C20 C24 C29 C30b C32 C35 C41 C42 C45 Primer sequences (5′–3′) F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: GAAGCCATTTTGGAGAGAAG CGAGTGTSACCTCTCTGTAC AGTTGGTCTSTAGCATTTCC TCTTTGCTGWCCACTCACTC TCATCATCAGAATATTCATCATCG CAAATGAAGGGACTAAACATGC CAATTTCCCAATTCTACCCC GAGGAACTTYTGGGAATCAGG TCCAAATAAAGAAATCTACCTACG TGTAGAACAGACTACTATGAATGG TTAGGTGGTGGTGGTAGTGG CTGACCGTGCTCCTGATCC AACTGAAGAAGAAAACAAAGGTGAC TTGTTGGAGCATTTGAGTC TCACCACCCAAAAMACYACC TCTTCACCATAYGGYCCTCCTG TCTTCCCTGTTCTTGTTTCC CTTTCCTCACATGCAGCAC GCTATTCAAATTCAACATCACTGAAG CACCAAGAGGCTCTTCTGGTGA TGGCATACCATGAAGCATTG GTAATGCTGCCTATGAGAGG CGATGATCGATTGAAGCGCKTCC GTCAACCACCCCCAAYTRATCG CAAACCCATCTTCGTATTTCRCC CCCACTGAACTCAACWAKGTCC CATTGCTGAAGATCTCCAATCC CATTACATGCCGTACTACCACC GTAATAGCTCTAACTCAAATCAGCAG ACAAACTTTCCAAGCGTCTTGATAAG GCCAAGCATTCGTCRGGGAG CACACTACTCTCCCTACACCC AGWMTGATGAGCAAACACAATA GTGGTTTTGGCTTGTTCTTG Repeat motif Allele size range (bp) E-value Ta (°C) (TCA)6 148–167 None 3e-164 57 (ACC)8 151–181 tRNA ligase-like (Manihot esculenta) 0 57 (ATC)6 197–239 HM-associated protein (Olea europea) 3e-5 55 (CAA)7 166–227 NP complex protein (Solanum tuberosum) 2e-144 58 (CAT)7 204–213 Glucosylceramidase (Coffea arabica) 0 50 (TGG)6 258–269 Glycine-rich cell wall structural protein 1 (Latuca sativa) 0.093 58 (TAG)7 142–161 None 2e-132 57 (CCA)6 137–145 Polyamine transporter (Nicotiana tomentosiformis) 0 58 (TCA)6 108–151 Reticulata-related 4 (Hevea brasiliensis) 3e-165 57 (ATT)8 233–242 B2 protein (Sesamum indicum) 2e-163 58 (ACC)6 149–195 DNA-binding protein (Nicotiana sylvestris) 3e-95 56 (GAG)7 132–148 Hypothetical protein F511 (Dorcoceras hygrometricum) 4e-21 56 (GAG)5 157–178 None 1e-139 53 (CTG)6 124–153 3e-172 56 (AGC)6 127–142 Polyadenylate-binding protein RBP47 (Nicotiana sylvestris) None 7e-119 53 (TGG)8 230–260 F-box protein (Nicotiana tabacum) 0 56 (TCA)7 235–238 DNA-binding transcription factor (Durio zibethinus) 2e-80 56 Putative function (Organism) Note: Ta = annealing temperature. a Nucleotide sequences of each locus are provided in Appendix S1. http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Ahmad et al. Applications in Plant Sciences 2019 7(10): e11296 Ahmad et al.—Alkanna tinctoria microsatellites • 3 of 5 TABLE 2. Genetic diversity indices of 17 polymorphic conserved ortholog set–simple sequence repeat markers in four Greek populations of Alkanna tinctoria.a AT3 (n = 17) AT4 (n = 18) AT9 (n = 16) AT10 (n = 16) Locus A Ho He He(ad) A Ho He He(ad) A Ho He He(ad) A Ho He He(ad) C2b C3 C5b C9b C12 C13b C14b C16b C20 C24 C29b C30b C32 C35b C41b C42 C45 5 6 5 5 1 4 5 5 5 3 7 3 2 5 5 2 2 0.471 0.588 0.294 0.471 0.000 0.353 0.912 0.824 0.471 0.688 1.000 0.471 0.176 1.000 1.000 0.176 0.059 0.438 0.716 0.704 0.562 0.000 0.229 0.631 0.716 0.517 0.533 0.817 0.399 0.094 0.711 0.719 0.094 0.030 0.390 0.728 0.684 0.539 0.000 0.205 0.595 0.683 0.492 0.528 0.779 0.406 0.092 0.654 0.694 0.092 0.030 7 9 8 9 4 4 6 5 6 4 9 6 3 5 6 3 2 0.778 0.722 0.444 0.111 0.000 0.444 1.000 0.722 0.722 0.556 1.000 0.556 0.111 1.000 1.000 0.111 0.111 0.671 0.819 0.623 0.269 0.000 0.391 0.662 0.647 0.652 0.550 0.821 0.523 0.058 0.731 0.649 0.058 0.058 0.583 0.810 0.618 0.258 0.000 0.410 0.615 0.605 0.648 0.534 0.795 0.462 0.058 0.652 0.606 0.057 0.057 3 2 7 6 4 2 3 3 4 3 6 4 3 2 5 3 1 0.800 0.267 0.667 0.733 0.062 0.062 1.000 0.562 0.667 0.200 0.875 0.688 0.250 1.000 0.875 0.133 0.000 0.626 0.265 0.713 0.815 0.094 0.032 0.548 0.639 0.542 0.108 0.667 0.581 0.138 0.516 0.670 0.305 0.000 0.559 0.260 0.624 0.803 0.122 0.032 0.533 0.610 0.585 0.102 0.621 0.521 0.128 0.516 0.635 0.295 0.000 4 2 8 6 1 2 4 2 6 2 4 3 2 3 4 2 1 0.938 0.188 0.562 0.562 0.000 0.188 0.938 0.375 0.438 0.188 0.938 0.250 0.125 0.938 0.938 0.062 0.000 0.723 0.216 0.809 0.680 0.000 0.192 0.584 0.208 0.742 0.100 0.622 0.529 0.066 0.599 0.632 0.032 0.000 0.662 0.213 0.806 0.681 0.000 0.213 0.553 0.201 0.704 0.098 0.582 0.536 0.065 0.568 0.571 0.032 0.000 Note: A = number of alleles; He = expected heterozygosity; He(ad) = expected heterozygosity after allele dosage correction; Ho = observed heterozygosity. a Voucher and locality information are provided in Appendix 1. b Loci that showed tetraploid peaks. selected to assess polymorphism. The PCR reaction was performed incorporating the FAM-labeled M13 primer according to Schuelke (2000) and consisted of 4 μL of HOT FIREPol Blend Master Mix (Solis BioDyne, Tartu, Estonia), 0.24 μM of each reverse primer, 0.24 μM of M13-labeled fluorescent dye (FAM or HEX), 0.08 μM of each forward primer modified with an M13 tail, and 10–20 ng of genomic DNA template, in a final volume of 20 μL. PCR was performed using PTC-220 DYAD Thermal Cycler (MJ Research, Waltham, Massachusetts, USA) with the following parameters: 15 min of enzyme activation at 95°C; followed by 35 cycles of denaturation at 95°C for 20 s, annealing at 53–57°C for 45 s, extension for 1 min at 72°C; with a final extension period of 15 min at 72°C. The amplified products were visualized on 2% agarose gels and, after dilution to an appropriate concentration (3 : 17 to 3 : 57), were separated on a capillary sequencer (ABI PRISM 3130xl; Applied Biosystems, Foster City, California, USA) using the GeneScan 350 internal size standard (Applied Biosystems). Allelic profiles of each individual were determined using GeneMapper version 5 (Applied Biosystems). Of the 30 loci, 20 loci were found to be polymorphic; however, peaks from three loci were difficult to interpret and were not included in further analyses (Table 1). Characteristics of 10 monomorphic SSR loci are given in Appendix 2. It is noteworthy that the allelic profiles of some loci indicated that A. tinctoria is a tetraploid species. This observation is consistent with Coppi et al. (2006), who also observed a 4x ploidy level in A. tinctoria. For further analysis, we treated the data as tetraploid based on the available literature evidence (Coppi et al., 2006) and our own observation of >50% of loci (nine out of 17) with multi-allelic genotypes consistent with tetraploidy (Table 2). The nucleotide sequences of all loci assembled from the RNA-Seq data set of A. euchroma are given in Appendices S1 and S2. Subsequently, 67 individuals from four populations (Appendix 1) were characterized by the 17 polymorphic loci. The DNA isolation method is similar to that described above, except a lithium chloride–containing buffer (50 mM Tris-HCl, 0.7 M NaCl, 20 mM EDTA, 0.4 M LiCl, and 2% PVP 40) was used instead of http://www.wileyonlinelibrary.com/journal/AppsPlantSci the grinding and lysis buffer. In addition, 20 μL of dithiothreitol (1 M) was added before incubation at 60°C (Lefort and Douglas, 1999). PCR reaction mixture and cycling conditions were the same as described above. GenoDive version 2.023 (Meriman and van Tienderen, 2004) was used to estimate the number of alleles and the levels of observed (Ho) and expected heterozygosity (He), with and without allele dosage correction. Allele dosage was inferred using the maximum likelihood method implemented in GenoDive (Table 2). The number of alleles ranged from one to nine, with an average of 5.94 alleles per locus. Levels of He and Ho of individual loci ranged from 0.000 to 0.821 and 0.000 to 1.000 in the studied populations, respectively. We note that indepth cytogenetic work would be needed to clarify the precise cytotype status of each accession and population. Nevertheless, He represents a useful estimate of gene diversity for any ploidy level, and we report values with and without allele dosage correction; therefore, we regard our estimates of diversity and information content of the markers as robust and conservative (Table 2). The cross-species transferability of 17 markers was tested on three Alkanna Tausch species: A. graeca Boiss. & Spruner, A. hellenica Rech. f., and A. sfikasiana Tan, Vold & Strid (Appendix 1). In addition, we also tested cross-species amplification in Echium vulgare L., E. plantagineum, Lithospermum officinale L., Borago officinalis L., and Anchusa officinalis Gouan (Appendix 1) to ascertain whether these markers are applicable to genera other than Alkanna. All primer pairs gave expected size products in E. plantagineum, and 14 amplified in L. officinale, E. vulgare, and all tested species of Alkanna (Table 3). In contrast, only ~50% of the tested primer pairs had expected size bands in B. officinalis and A. officinalis (Table 3). CONCLUSIONS Through mining COS markers, a first set of microsatellite markers was developed for A. tinctoria. The observed genetic diversity indices and level of polymorphism in A. tinctoria showed that these markers could be useful for genotyping and genetic structure © 2019 Ahmad et al. http://www.wileyonlinelibrary.com/journal/AppsPlantSci Ahmad et al.—Alkanna tinctoria microsatellites Note: – = no amplification; ≡ = multiple bands; ND = not determined. a Voucher and locality information for A. graeca, A. hellenica, A. sfikasiana, and E. vulgare are provided in Appendix 1. Lithospermum officinale (Clone 10 and Clone 21) and E. plantagineum (Clone 2 and Clone 3) individuals were provided by INOQ GmbH, Germany. Anchusa officinalis (accession no. BVAL-901753) and B. officinalis (accession no. BVAL-901040) seeds were purchased from the Austrian Agency for Health and Food Safety. – 400 – 200 220 ≡ 120 – ND – 200 130 – 150 130 200 250 – 300 – – 220 ≡ – – ND 230 200 130 – 150 130 – 250 160 150 230 200 220 ≡ 120 120 ≡ 250 200 130 – 150 130 200 250 160 – 230 200 220 ≡ 120 120 ≡ 230 200 130 150 150 130 250 250 C2 C3 C5 C9 C12 C13 C14 C16 C20 C24 C29 C30b C32 C35 C41 C42 C45 160 150 230 200 220 ≡ 120 120 ≡ 230 200 130 150 150 130 250 250 160 150 230 200 220 ≡ 120 120 ≡ 230 200 130 150 150 130 250 250 160 150 230 200 220 260 120 120 ND 250 200 130 150 150 130 200 250 160 150 230 – 220 ≡ 120 120 ND 250 200 130 150 150 130 200 250 Borago officinalis (n = 2) Anchusa officinalis (n = 2) Lithospermum officinale (n = 2) Echium plantagineum (n = 2) Echium vulgare (n = 6) Alkanna sfikasiana (n = 6) Alkanna hellenica (n = 6) Alkanna graeca (n = 6) Locus TABLE 3. Cross-species amplification of 17 polymorphic microsatellite markers developed for Alkanna tinctoria in eight different species in the Boraginaceae, with approximate sizes of amplified products given in base pairs.a Applications in Plant Sciences 2019 7(10): e11296 • 4 of 5 analysis in this species. Successful amplification of these loci suggests their potential utility to other related taxa in the Boraginaceae. ACKNOWLEDGMENTS The authors thank A. Sessitsch and our partners in MICROMETABOLITE project, especially N. Fokialakis, A. N. Assimopoulou, N. Krigas, E. Maloupa, G. Brader, and P. Roedel for the provision of plant material used in this study. This project has received financial support from the European Union’s Horizon 2020 research and innovation program (grant agreement no. 721635). AUTHOR CONTRIBUTIONS M.A. designed the study and performed in silico analysis and lab work. D.L. and K.H.H. provided support in lab work, and C.L. and E.M.S. supervised the work. All authors read and approved the final version of the manuscript. DATA AVAILABILITY Nucleotide sequences for the developed markers are provided in Appendix S1 and Appendix S2. SUPPORTING INFORMATION Additional Supporting Information may be found online in the supporting information tab for this article. APPENDIX S1. Nucleotide sequences of polymorphic conserved ortholog set–simple sequence repeat (COS-SSR) markers developed in Alkanna tinctoria. These nucleotide sequences are assembled from the RNA-Seq data set of Arnebia euchroma. APPENDIX S2. Nucleotide sequences of monomorphic conserved ortholog set–simple sequence repeat (COS-SSR) markers developed in Alkanna tinctoria. These nucleotide sequences are assembled from the RNA-Seq data set of Arnebia euchroma. LITERATURE CITED Beier, S., T. Thiel, T. Münch, U. Scholz, and M. Mascher. 2017. MISA-web: A web server for microsatellite prediction. Bioinformatics 33: 2583–2585. Bolger, A. M., M. Lohse, and B. Usadel. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. Chapman, M. A. 2015. Transcriptome sequencing and marker development for four underutilized legumes. Applications in Plant Sciences 3(2): 1400111. Cock, P. J. A., J. M. Chilton, B. Grüning, J. E. Johnson, and N. Soranzo. 2015. NCBI BLAST+ integrated into Galaxy. GigaScience 4: 39. Coppi, A., F. Selvi, and M. Bigazzi. 2006. Chromosome studies in Mediterranean species of Boraginaceae. Flora Mediterranea 16: 253–274. Deng, X., Q. Chen, L. Qiang, M. Chi, N. Xie, Y. Wu, M. Yao, et al. 2018. Development of a porcine full-thickness burn hypertrophic scar model and investigation of the effects of shikonin on hypertrophic scar remediation. Frontiers in Pharmacology 9: 590. © 2019 Ahmad et al. Applications in Plant Sciences 2019 7(10): e11296 Ahmad et al.—Alkanna tinctoria microsatellites Dimopoulos, P., T. Raus, E. Bergmeier, T. Constantinidis, G. Iatrou, S. Kokkini, A. Strid, and D. Tzanoudakis. 2013. Vascular plants of Greece: An annotated checklist. Englera, vol. 31. Botanischer Garten und Botanisches Museum Berlin-Dahlem, Berlin, Germany. Grabherr, M. G., B. J. Haas, M. Yassour, J. Z. Levin, D. A. Thompson, I. Amit, X. Adiconis, et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644–652. Lefort, F., and G. C. Douglas. 1999. An efficient micro-method of DNA isolation from mature leaves of four hardwood tree species Acer, Fraxinus, Prunus and Quercus. Annals of Forest Science 56: 259–263. Li, W., and A. Godzik. 2006. CD-HIT: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22: 1658–1659. Malik, S., S. Bhushan, M. Sharma, and P. S. Ahuja. 2016. Biotechnological approaches to the production of shikonins: A critical review with recent updates. Critical Reviews in Biotechnology 36: 327–340. Meriman, P. G., and P. H. van Tienderen. 2004. Genotype and Genodive: Two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792–794. • 5 of 5 Papageorgiou, V. P., A. N. Assimopoulou, E. A. Couladouros, D. Hepworth, and K. C. Nicolaou. 1999. The chemistry and biology of alkannin, shikonin, and related naphthazarin natural products. Angewandte Chemie International Edition 38: 270–301. Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234. Valdés, B. 2011. Boraginaceae. In Euro+Med Plantbase: The information resource for Euro-Mediterranean plant diversity. Website http://ww2.bgbm. org/EuroPlusMed/ [accessed 30 January 2019]. van der Beek, J. G., R. Verkerk, P. Zabel, and P. Lindhout. 1992. Mapping strategy for resistance genes in tomato based on RFLPs between cultivars: Cf9 (resistance to Cladosporium fulvum) on chromosome 1. Theoretical and Applied Genetics 84: 106–112. Yan, Y., F. Tan, H. Miao, H. Wang, and Y. Cao. 2019. Effect of shikonin against Candida albicans biofilms. Frontiers in Microbiology 10: 1085. Zhang, S., Q. Gao, W. Li, L. Zhu, Q. Shang, S. Feng, J. Jia, et al. 2019. Shikonin inhibits cancer cell cycling by targeting Cdc25s. BMC Cancer 19: 20. APPENDIX 1. Geographic coordinates, locality, and voucher information for plant species used in this study.a Species Alkanna tinctoria Tausch Alkanna tinctoria Alkanna tinctoria Alkanna tinctoria Alkanna graeca Boiss. & Spruner Alkanna hellenica Rech. f. Alkanna sfikasiana Tan, Vold & Strid Echium vulgare L. Population Geographic coordinates Location N IPEN accession no. AT3 AT4 AT9 AT10 AG1 AH1 AS1 Ev 40.630447°N, 22.971729°E 40.64277°N, 22.99777°E 37.69021°N, 24.05341°E 37.87581°N, 23.77331°E 37.433121°N, 22.685267°E 37.900980°N, 2.877485°E 37.339370°N, 22.602229°E 48.32097°N, 16.06838°E Thessaloniki, Greece Thessaloniki, Greece Sounion, Greece Imittos, Greece Parnonas, Greece Nea Corintheas, Greece Parnonas, Greece Tulln, Austria 17 18 16 16 6 6 6 6 GR-1-BBGK-18,6081 GR-1-BBGK-18,6091 GR-1-BBGK-18,6135 GR-1-BBGK-18,6136 GR-1-BBGK-18,6138 GR-1-BBGK-18,6137 GR-1-BBGK-18,6139 Note: IPEN = International Plant Exchange Network; N = number of individuals sampled. All of the living material from Alkanna species used in this study is deposited and maintained at the Institute of Plant Breeding and Genetic Resources, Hellenic Agricultural Organization– Demeter (HAO-Demeter), Thessaloniki, Greece. a APPENDIX 2. Characteristics of 10 monomorphic conserved ortholog set–simple sequence repeat markers markers identified in Alkanna tinctoria.a Locus C1 C7 C8 C11 C18 C30a C31a C36a C39 C47 Primer sequences (5′–3′) F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: GAAACTACCCTTCAGSAAGG TCCTTTTCTGACAATTTGCG ACTTCAGCTCCAGCACCAC CCAATTGGGCAAAAACTGAG TGATGARAATGATTGGCATG TGGAAYTTGATGATAGRAAGTCCC TTATGTAGAGCTCTCAAATTCC CTGTTTCTTCATAGTATTACCTGG CCCTCCTCCAAATCTTGATC GGTGATGATGTTAGCTTACAC GCGGTACCCTCAATAAAATAAGC GCGCTTCAATCGATCATCGC GCCTGGGAACAAGTATAAT TTCCAAATATTGTTCCACATATG GGATCTTCAGTTGGTACTCTGG AACATTGAACCAACTGAACC CTTGTGGGGCTTGTAATTTATGC GCAGAATGTTGGGGGCTATTGG AGGCTAATTGGTCTGATGAAGAAG GCATGAGGGAAATCATTATCTG Repeat motif Allele size (bp) Ta (°C) (ATG)7 155 50 (GAA)6 129 62 (GAT)6 113 57 (GAT)14 155 53 (TC)7 205 56 (GAG)7 241 56 (CTCAGG)6 224 53 (ATC)5 158 53 (AT)8 123 56 (TTC)6 181 56 Note: Ta = annealing temperature. a Nucleotide sequences of each locus are provided in Appendix S2. http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Ahmad et al.