Revista LANKESTERIANA

ISSN 1409-3871
VOL. 13, No. 3 JANUARY 2014
I N V I T E D PAP E R S
Instalación de la primera Junta Asesora del Jardín Charles Lankester

Rafael Lucas Rodríguez Caballero † 155
Rapid transformation of orchid floras
James D. Ackerman 157
From Cuba to most of the Neotropic: Habenaria bicornis (Orchidaceae) is
widespread from Mexico to southeastern Brazil
João A. N. Batista, Karina Proite, Bruno M. Carvalho, Aline A. Vale
and Leonardo P. Felix 165
Illustrations and studies in Neotropical Orchidaceae. The Specklinia condylata
group (Pleurothallidinae) in Costa Rica and Panama
Diego Bogarín, Zuleika Serrachín and Zabdy Samudio 185
A new species in the Cohniella ascendens complex from Amazonian Venezuela
(Orchidaceae: Oncidiinae)
William Cetzal-Ix, Germán Carnevali and Eliana Noguera-Savelli 207
The Reverend Charles Samuel Pollock Parish – plant collector and botanical
illustrator of the orchids from Tenasserim Province, Burma
Dudley Clayton 215
Slipper orchids in art and science
Phillip Cribb 229
Three new Masdevallia species from Peru (Orchidaceae: Pleurothallidinae)
Stig Dalström and Saul Ruíz Pérez 251
continues
4 0 t h
A N N I V E R S A R Y C E L E B R AT I V E I S S U E
ii INDEX
New species and records of Orchidaceae from Costa Rica. III

Melania Fernández, Diego Bogarín, Adam P. Karremans and Daniel Jiménez 259
El grupo Epidanthus, subgrupo Selaginella de Epidendrum

Eric Hágsater and Elisabeth Santiago Ayala 283
What is in a orchid name: a tribute to the early naturalists in Costa Rica

Rudolf Jenny 291
Lankesteriana, a new genus in Pleurothallidinae (Orchidaceae)

Adam P. Karremans 319
The first ten years of Selby Gardens

Carlyle A. Luer 333
Consideraciones sobre la historia de la prioridad taxonómica de Oncidium

ornithorhynchum – Consideration on the historical background of a
nomenclatural taxonomic priority of Oncidium ornithorhynchum
Laura C. Mazo, Alberto Gómez–Gutiérrez, Sonia R. Quintanilla,
Jaime E. Bernal and Pedro Ortiz–Valdivieso, SJ† 337
A new species of Vanilla (Orchidaceae) from the Colombian Pacific region

Francisco Molinero–Urtado, Robert Tulio González Mina, Nicola S. Flanagan
and J. Tupac Otero 353
Charles H. Lankester (1879–1969): his life and legacy

Carlos Ossenbach 359
Generic and subtribal relationships in Neotropical Cymbidieae (Orchidaceae)

based on matK/yfc1 plastid data
W. Mark Whitten, Kurt N. Neubig and Norris H. Williams 375
LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

INDEX iii
R E G U LAR PAP E R S
A new large-flowered Odontoglossum (Orchidaceae: Oncidiinae) from the

Cusco region in Peru
A new and striking Odontoglossum (Orchidaceae: Oncidiinae) from Peru
Nocturnal pollination by fungus gnats of the Colombian endemic species,
Pleurothallis marthae (Orchidaceae: Pleurothallidinae)
Carol Andrea Duque–Buitrago, Néstor Fabio Alzate–Quintero
and J. Tupac Otero 407
Organización espacial y estructura de una población de Ionopsis
utricularioides (Orchidaceae) en un área suburbana de Pinar del Río, Cuba
Alfredo García–González y Frander B. Riverón-Giró 419
Reviewers of the manuscripts submitted to Lankesteriana, Vol. 13 429

lankesteriana
International Journal on Orchidology
Copyright © 2014 Lankester Botanical Garden, University of Costa Rica

Effective publication date: January 30, 2014
Layout: Jardín Botánico Lankester.

Cover: Lankester Botanical Garden’s 40th Anniversary celebrating medal.
Printer: MasterLitho.
Printed copies: 500
Printed in Costa Rica / Impreso en Costa Rica
R Lankesteriana / International Journal on Orchidology

No. 1 (2001)-- . -- San José, Costa Rica: Editorial
Universidad de Costa Rica, 2001--
v.
ISSN-1409-3871
1. Botánica - Publicaciones periódicas, 2. Publicaciones

periódicas costarricenses
LANKESTERIANA 13(3): 155—156. 2014.
i n t r o d u c t o r y p a p e r*
Instalación de la primera Junta Asesora

del Jardín Charles H. Lankester
Rafael Lucas Rodríguez Caballero †
Escuela de Biología, Universidad de Costa Rica
Se necesitó 40,000,000 de años de la accidentada crecer y florecer y dar fruto, que alentaba en el corazón
trayectoria geológica de esta región para formar el de otro inglés, Stanley Smith, manifestándose después
istmo centroamericano que conocemos y la ación del de su deceso en un Fondo establecido para fomentar
tibio, violento y húmedo clima del caribe para dar la horticultura dondequiera fuese posible, aún en
forma en él al paisaje natural, asombrosamente rico en tierras nunca visitadas por el, y cuyo director también
especies y en números. nos acompaña… y las características generosidad
Se necesitó el alma de un hombre como Charles H. y tendencia a la acción cooperativa del pueblo
Lankester, que al tiempo que contribuía a la destrucción norteamericano, manifestándose en un llameo hecho
inexorable de este paraíso natural, precio obligado del por la Asociación Norteamericana de Orquideología
avance de la agricultura y del “progreso”, fue por 3 por medio de su Fondo para Investigación y Educación,
generaciones amigo y compañero de los exploradores algunos de cuyos dirigentes hoy nos honran con su
de la flora costarricense, supo disfrutar de su belleza y compañía… para reunir la suma necesaria y entregar
llegó a apasionarse per ella en todas sus formas, que este jardín a la Universidad de Costa Rica, la cual la
viendo 30 años antes de la oleada de preocupación que aceptó comprometiéndose a mantener en él el ideal, la
hoy corre por el mundo, la destrucción inminente de visión y el esfuerzo de Don Carlos Lankester.
tantas especies y de tantos paisajes, supo soñar en un Al reunirnos aquí para instalar la primera Junta
abrigo, un refugio para el bosque que veía desaparecer Asesora del Jardín Carlos H. Lankester, rindamos
y dedicarse a realizar ese sueño en este rincón que hoy homenaje a la belleza natural de nuestra tierra, que
recibe su nombre… esfuerzo que mantuvo hasta los merece muchos esfuerzos más para su protección, a aquel
últimos instantes de su vida. individuo notable, Charles H. Lankester, quien mereció
Se necesitó la mirada sensitiva de varias personas, del pueblo que lo contara como uno de los suyos [“Don
entre las que destacaron la Dra. Mildred E. Mathias, Carlos”], al amor por la horticultura de Stanley Smith,
la Sra. Betty Marshall y muy conspicuamente, que desboradaba los bordes de su mundo para envolver
la orquideóloga Rebecca Tyson Northen, quien la tierra entera en su entusiasmo y a esa fraternal
afortunadamente nos acompaña hoy, para empe˜ãr generosidad de los orquideólogos norteamericanos,
en un llamado para buscar el modo de conservar este muchos de los cuales ni habían visitado Costa Rica ni
jardín y continuar la labor que quedaba inconclusa al pensaban llegar nunca a visitarla, pero supieron ayudar
extinguirse aquella chispa de entusiasmo que alentaba a lo que consideraban una causa digna de esfuerzo.
en Don Carlos… Que este homenaje de admiración, de recuerdo y
Se necesitó la devoción por todo lo que puede gratitud nos guíe en el desarrollo futuro de este jardín.
* El manuscrito autógrafo de este discurso, pronunciado por el Dr. Rafael Lucas Rodríguez Caballero durante la ceremonia
de inauguración del Jardín Botánico Lankester el 2 de marzo de 1973, ha sido amablemente proporcionado por sus herederos
como contribución para las celebraciones del 40 Aniversario de la institución.
156 LANKESTERIANA
Figure 1. Primera página del manuscrito autógrafo de Rafael Lucas Rodríguez Caballero, con el discurso pronunciado en
ocasión de la inauguración del Jardín Botánico Lankester. En la parte superior se aprecia un mapa estilizado del Jardín
Botánico Lankester en el año 1973. Cortesía de los herederos de R. L. Rodríguez Caballero.

LANKESTERIANA 13(3): 157—164. 2014.
i n v i t e d p a p e r*
RAPID TRANSFORMATION OF ORCHID FLORAS
James D. Ackerman
Department of Biology and Center for Applied Tropical Ecology and Conservation,
University of Puerto Rico, PO Box 23360, San Juan, PR 00931-3360, U.S.A.
ackerman.upr@gmail.com
Abstract. What does the future hold for the Orchidaceae? Historically the family has been quite plastic and
responsive to large-scale habitat transformations, perhaps none so dramatic as the changes experienced during
the formation of the cordilleras of the Northern Andes and lower Central America. Coupled with the backdrop
of global fluctuations in climate, the rapid rise of these mountains over the last 0.5-2 M years have fragmented
habitats and changed climate locally. These mountains are one of the most biologically diverse regions of
the planet and may have served as a species pump for the Caribbean and other regions of Central and South
America. The development of such diversity occurred over a scale of tens of millions of years to perhaps just a
few thousand. While the same processes of the past are likely operational now, the current rate of habitat change
may be unprecedented outside asteroid or major meteor impacts as global climate change accelerates, human-
altered landscapes spread, and shifts occur in land use. We expect the structure and composition of orchid floras
to change as populations respond evolutionarily through adaptation, extinctions and immigrations. Certainly
the total destruction of a habitat, whether caused by volcanic eruptions or strip mining, is sure to have dire
consequences but resiliency may occur if refugia serve as seed sources for colonization in the event of habitat
recovery. As most orchids occupy ephemeral habitats or at least substrates, their natural population behavior
likely entails cycles of local colonization and extinction as metapopulations. Another component of change is
the increasing number of orchids that have become naturalized after human assisted dispersal (intentional or
not). These alien orchids have overcome constraints imposed by pollination and mycorrhizal requirements. Will
natural or human-assisted range expansions overcome extinction losses? Will they be among those that become
the genetic material for a new wave of adaptive radiations? Much depends on population variation, patterns of
gene flow, and rates of change. The Orchidaceae have had a history of ecological resiliency and evolutionary
flexibility, which provides some degree of assurance. But this is no excuse for complacency since without some
form of intervention the pace of change underway may be more than what orchid populations can overcome.
Key words: Orchidaceae, conservation, resiliency, floristic change, forest recovery

The orchid mystique is alive and well. The the Convention on International Trade in Endangered
bizarre flowers, weird pollination mechanisms, and Species (CITES). Moreover, several books have
rarity of many species have captured the attention of focused on orchid conservation (e.g., IUCN/SSC
enthusiasts and academics for nearly two centuries. Orchid Specialist Group 1996, Koopowitz 2001, Dixon
Population declines of marquee species have been et al. 2003). Are these symptoms of a dire outlook for
obvious due to over-collecting and habitat degradation the family? Will orchids survive rapid climate and land
(e.g., Miranda 1990, Cribb 1998, Soto Arenas et use changes?
al. 2007). Consequently, orchids are frequent if not To address these questions, I look at how the
prominent occupants of endangered species lists and family has responded to disturbances through history.
all 28,000-plus species of the family (Govaerts et al. I emphasize processes related to diversification and
2010) have been placed on either appendix I or II of population biology of the family in the northern Andes
* This contribution was prepared as part of the special edition of Lankesteriana that is dedicated to the commemoration of
Lankester Botanical Garden´s 40th anniversary.
158 LANKESTERIANA
and the cordilleras of Panama and Costa Rica, two 2013, Cascante-Marín & Nivia-Ruíz 2013). The result
regions of extraordinary species diversity (Dressler has been rapid diversification and fragmentation of
1981, Myers et al. 2000, Bogarín et al. 2013). habitats, which become isolated not only by valleys and
ridges within mountain ranges, but also by intervening
Early patterns of diversification. — Variance in hotter and drier lowlands between them (Kirby 2011).
age estimates for the Orchidaceae has been rather Not surprisingly, topographic diversity is strongly
substantial (Arditti 1992, Gustafsson et al. 2010), associated with orchid diversity, even exceeding area
but our current data indicate that the family is rather as a factor linked to species richness (Dodson 2003,
old. Initial age estimates of Ramírez et al. (2007) and Ackerman et al. 2007). This relationship is well
Gustafsson et al. (2010) based on molecular clock illustrated by the Maxillariinae of Panama and Costa
calculations have been further refined by Guo et al. Rica. Kirby (2011) found that widespread species
(2012) who have found that the most recent common of the subtribe tend to occupy lowlands whereas the
ancestor of the Orchidaceae existed roughly 80-90 Ma, narrow endemics and more derived species are those
in the Late Cretaceous. From their analyses, most, if occupying the cooler, wetter montane slopes and
not all of the five current subfamilies diverged prior to valleys. While we expect such barriers to substantially
the global disturbance and mass extinctions associated limit gene flow, we still need to reconcile meta-
with the Cretaceous/Paleogene (K-Pg) boundary. This analysis of Fst (or Gst) statistics that indicate high levels
boundary, likely instigated by an asteroid impact at the of gene flow among orchid populations (Phillips et
edge of the present day Yucatan Peninsula (Morgan al. 2012). But if natural selection is intense enough
et al. 2008), not only caused extinctions of many and sustained, then selection could overcome any
forms of life, most famously the non-avian dinosaurs, homogenizing effect of occasional input from long-
but also opened doors to the evolutionary theater for distance dispersal, allowing for local adaptation and
diversification of other forms, including mammals diversification. Of course such population genetic
and flowering plants. Beyond the K-Pg boundary, two data are only consistent with high levels of gene flow.
clades represented by subfamilies Orchidoideae and Alternatively, it may also reflect only a relatively
Epidendroideae underwent evolutionary diversification recent colonization event with little or no subsequent
that accounts for most of the species diversity of the gene flow (Tremblay et al. 2005). Changes in neutral
orchid family as it is known today. Many clades from alleles would be mutation-dependent and divergence
those subfamilies diverged just 15-20 Ma BP in the from parental populations may take a long time to
early Miocene (Ramírez et al. 2007, Guo et al. 2012). occur. On the other hand, frequencies of alleles under
Of course, not all species that evolved during these selection may change rapidly as has been observed in
years of diversification have survived. Extinction is a other organisms (Losos 2014) and such differences
natural process and does not need the helping hand of would be missed by population genetic data based on
humans. Nevertheless, we may assume that there has assessment of neutral alleles.
been an overall net gain in species. So, although the While rapid rise of mountain ranges are clearly
family’s origins are rather old and some clades are associated with the evolution of biological diversity,
relatively species-poor, the Orchidaceae as a whole is it is not a prerequisite for rapid orchid speciation.
hardly relictual or static. Gustafsson et al. (2010) found that much of the extant
diversity of the orchid genus Hoffmannseggella in
Recent evolutionary diversification. — While broad- the geologically ancient eastern mountains of Brazil
scale orchid diversification events cannot be easily diverged since the Pliocene (< 2.5 Ma). During this
linked to large-scale disturbances, tectonic dynamics same period significant fluctuations in moisture
most assuredly fostered the diversification of orchids availability occurred (Auler & Smart 2001, Ledru
and other families (Hughes & Eastwood 2006). A good et al. 2005), perhaps climatically fragmenting
example is the recent rise of lower Central America the landscape and affecting gene flow among
and northern Andean cordilleras over the last 0.5- populations with consequences akin to abrupt
10 Ma (Dodson 2003, Kirby 2007, Karremans et al. mountain building.
Ackerman — Orchid flora transformations 159
The driver for the remarkable evolutionary the family and the presumably high frequency of rare
diversification of this family is likely tied to the process species, the number of known extinctions is quite low
of pollination (van der Pijl & Dodson 1966, Stebbins (IUCN/SSC Orchid Specialist Group 1996). This is
1984, Nilsson 1992, Chase 2001, Papadopulos et al. counter-intuitive since rare species should be more
2013), though the family also shows a broad range vulnerable to habitat destruction. One explanation may
of physiological and vegetative adaptations (Dressler be a function of the lack of human effort to document
1981, Benzing 1986, Arditti 1992), and we are only extinctions and the other may be a function of the
just beginning to understand the role of mycorrhizal biology of orchids. The former is difficult to verify so
associations in orchid evolution (e.g., Otero & I will explore the latter.
Flanagan 2006; Motomura et al. 2010, Martos et Rapid changes in habitats have occurred
al. 2012). The plethora of pollination mechanisms, throughout history and some dramatic events that have
some rather fantastic, and the exploitation of a occurred recently will serve as examples. Disturbances
broad spectrum of pollinators suggest that the post that have caused population extinctions may occur at
K-Pg diversification of insects, particularly Diptera, every scale. When a host tree sheds twigs and branches
Lepidoptera and Hymenoptera, is closely tied to or dies entirely, so do its epiphytes. In 1989, a strong
the evolutionary potential of the Orchidaceae, hurricane passed over Puerto Rico and through a
although not necessarily in a co-evolutionary dance relatively mature forest for the first time in many
(Ackerman 1983a, Ramírez et al. 2011, see also decades. Nearly half the trees fell or snapped off and
Schiestl & Dötterl 2012). Species with little sequence those that withstood the winds had all their orchid
divergence may have arisen rapidly via exploitation epiphytes stripped away (Migenis & Ackerman 1993).
of existing pollinator diversity. This is perhaps best Volcanic eruptions can be even more destructive than
exemplified by genera that employ sexual deception hurricanes. Krakatau is the best known example of
(e.g., Lepanthes R.Br., Ophrys L., Telipogon Kunth, nearly instant devastation when it exploded in 1883,
Chiloglottis R.Br.; Blanco & Barboza 2007, Bateman destroying itself and nearby islands, covering extensive
et al. 2003, Neubig et al. 2012, Peakall et al. 2010). areas with debris, generating severe earthquakes and
Thus, the family is rather old, but much diversification tsunamis, and by the infusion of sulfur dioxide in the
is recent, geologically speaking. It appears that orchids stratosphere, cooling the planet for years afterwards
are adept at responding evolutionarily to change (Thornton 1997). In a somewhat older violent eruption,
occurring over millions of years to perhaps just a few Tungurahua II of the Ecuadorian Andes literally blew
thousand. Gentry and Dodson (1987) even suggested its top approximately 3000 years ago devastating the
that speciation may occur over just a few decades, an landscape with massive amounts of rubble and thick
idea with virtually no support, but it had planted the layers of ash (Hall et al. 1999), presumably creating
seed for breaking the shackles of gradualism in orchids lifeless moonscapes as were observed in the Krakatau
(Tremblay et al. 2005). explosion. Despite such ever-present yet rare natural
threats to habitat stability, the most pressing issues for
Habitat changes over ecological time. — Change orchid conservation are the devastating consequences
is ubiquitous and has always been that way, but the of human activities.
current rate of habitat change may be unprecedented Like natural disturbances, those caused by man can
outside asteroid or major meteor impacts as global be at every scale up to regional or even global. At very
climate change accelerates, human-altered landscapes local levels human activities such as trampling can
spread, and shifts occur in land use. Habitat destruction have both indirect and direct effects on orchids (Light
is the foremost threat to orchids (IUCN/SSC Orchid & MacConaill 2007; Ballantyne & Pickering 2013).
Specialist Group 1996), so the question is whether the In the orchid-rich tropics, slash and burn agriculture
family as a whole has the resiliency to withstand the created forest gaps, but much of that has been replaced
onslaught of change. by increasingly larger scale agriculture to the point of
One obvious way in which orchids may respond having farms measured in square kilometers rather
to change is extinction. But considering the size of than in hectares where topography and environmental
160 LANKESTERIANA
conditions permit it. Perhaps the greatest changes will still continues in some regions of the world at an
come from accelerating (anthropogenic or not) climate alarming rate, there has been a reversal in the trend,
changes whose effects may be seen even within a span mostly in shrubby arid zones and mountainous
of a few years to decades (Allen & Breshears 1998, regions where modern large scale, mechanized
Kelly & Goulden 2008). Whether it is the warming agriculture has not been practical (Aide et al. 2012).
trend with accompanying drier or wetter conditions A general reforestation trend has been occurring in
(depending on region), or the increasing severity of both temperate and tropical regions such as Europe,
weather, we have already begun to see changes and USA, Puerto Rico, Dominican Republic, Costa
developing consequences, and cloud forests, where Rica, Ecuador and Colombia, a phenomenon often
orchids thrive, seem to be highly susceptible (Pounds associated with abandonment of small rural farms as
et al. 1999, Parmesan 2006, Gradstein 2008). a consequence of industrialization, economic growth,
and sometimes armed conflicts (Sánchez-Cuervo et al.
Recovery. — I expect that natural disturbances beget 2012). I expect that orchid population recovery should
natural recoveries. Small-scale disturbances are follow provided the existence of nearby refugia that
common and most orchids likely have the capacity may serve as propagule sources.
for recovery. After all, epiphytic orchids must Once forests are restored or recover from human
constantly be on the move as bark and branches are disturbances, will orchid floristic composition return
shed and trees die, so orchid population dynamics to past conditions? Considering the forests themselves
may resemble metapopulation behavior (Ackerman may not return to past structure and composition (e.g.,
1983b, Tremblay et al. 2006). Certainly one expects Thompson et al. 2002, Lugo 2004), we may assume
that after a hurricane, orchids should be resilient since the same for orchid floras as change occurs for both
they have been for millions of years (Ackerman & ecological and evolutionary reasons. The extensive
Moya 1996, Mújica et al. 2013). Recovery can be forested regions of Mexico, Guatemala, and Belize
relatively rapid, even after volcanic eruptions. Among were once thought to be pristine, but we know now
the first vascular plants to colonize the remnants of that they were deforested and extensively cultivated
Krakatau were orchids, and now the number of species by Mayans, which was severe enough to create several
continues to accumulate (63 species after 115 years) episodes of significant erosion (Beach et al. 2006). The
as the vegetation structure becomes more complex and forests are now orchid-rich, but we will never know
more hospitable for epiphytes (Partomihardjo 2003). whether they have lost or even gained species from
As for the Tungurahua II eruption in the Ecuadorian pre-Maya times. In a relatively well-documented case,
Andes, the mountain has rebuilt to 50% of its former approximately 95% of the island of Puerto Rico was
size (Tungurahua III, Hall et al. 1999). The slopes deforested and converted to farmlands by the 1940s
have become re-vegetated, the orchid flora changes (Roberts 1942, Wadsworth 1950). This was followed
during this process, and colonizing species gradually by a change from an agrarian to an industrial-based
disappear as others replace them. The overall effect is society accompanied by human migration from rural
the mountain becomes orchid-rich once again, which areas to cities. The abandoned farmland formed
includes a number of species that presumably occur secondary forests composed of a mix between native
nowhere else, with the implication that they may have and non-native trees. Despite high human population
evolved in just a few thousand years (Dodson 2003). densities, over 40% of the island now has forest cover
The case of this volcano is not likely unusual. Ecuador (Grau et al. 2003). How did the orchid flora fair? Very
has over 200 volcanoes and according to naturalist few of the reported species for the island have been
Alex Hirtz, approximately 20% of the orchid flora on lost, and most of those that have not been seen for
each is endemic to that volcano (http://alexanderhirtz. decades were known from only a single specimen, if
com/orchid). any at all (Ackerman 1996). Small refugia were likely
Recovery of orchid floras from anthropogenic critical for floristic recovery as has been proposed
disturbances is currently not well characterized, but will for vegetation transition on other islands (de Boer et
soon be with us on a grand scale. While deforestation al. 2013). But where disturbance had been severely
habitat altering, recovery for some orchid species has Coda. — There are few botanical institutions in tropical
yet to occur, even after ecosystem recovery (Bergman regions of high orchid diversity. Over a relatively
et al. 2006). Shifts in the orchid flora over the last short period of time, Lankester Botanical Garden
few decades have been dramatic. Large populations has become one of those that have had a significant
of twig epiphytes were once commonly encountered role in tropical orchid systematics and conservation,
but now have become uncommon as forest recovery effectively promoting in-house research; facilitating
has progressed, shading out both the orchids and their studies at other institutions through collaborations and
hosts. Moreover, non-native orchids have taken hold the development of the online resource, Epidendra;
in many parts of the island, currently making up about and fostering communication among botanists by
7% of the orchid flora (Ackerman 2007). publishing Lankesteriana and sponsoring scientific
meetings. Indeed, I have had many influences in the
Conclusions.— Orchids throughout their history seem development of the ideas contained herein, but articles
to have done well in face of climatic change caused by in Lankesteriana did as much as any to help coalesce
shifting continents, mountain building, fluctuating sea them.
levels and temperatures. All these phenomena occur
today but the rate of change seems to be occurring Acknowledgements. I thank Stephen Kirby and Raymond
faster than the detectable past. Nature reserves are of Tremblay for fruitful discussions over the years that helped
course as susceptible to climate change as anywhere solidify some ideas contained here, though any blame falls
else. Liu et al. (2010) estimate that populations of at squarely on my shoulders. I delivered a version of this essay
at IV Andean Orchid Conservation Conference (Guayaquil,
least 15% of the orchid species in a diverse region of
Ecuador, 2012), and I thank the organizers, especially Alec
southwestern China will be threatened with extinction Pridgeon and José Portilla Andrade, for facilitating my
over the next two centuries given projected climate participation. Further financial support was provided by
changes. We already see a drying trend in some cloud CREST-CATEC (Elvira Cuevas, project director, National
forests of the world, including Costa Rica, raising Science Foundation, USA, HRD-0734826) for which I am
real concerns for those species such as the hundreds grateful.
of Neotropical Lepanthes that depend on cool, wet
conditions (Nadkarni & Solano 2002; Olaya-Arenas et
al. 2011). How orchids respond remains to be seen but
it seems certain that the floras at any given site will not Literature Cited
be the same as before. Ackerman, J.D. 1983a. Specificity and mutual dependency
Orchids as a group show evolutionary flexibility of the orchid-euglossine bee interaction. Biol. J. Linn.
whereby diversification in the family is often related Soc. 20: 301-314.
to habitat complexity and fragmentation. Orchids Ackerman, J.D. 1983b. On the evidence for a primitively
also show ecological resiliency with the capacity for epiphytic habit in orchids. Syst. Bot. 8: 474-477.
Ackerman, J.D. 1996. Caribbean Islands. Pages 59-61 in
recolonization after habitat destruction and recovery.
IUCN/SSC Orchid Specialist Group. Orchids – status
For particular orchid species, the realization of these survey and conservation action plan. IUCN, Gland
capacities likely depends upon dispersal from refugia Switzerland and Cambridge, UK
(large or small), the severity of disturbance, effects Ackerman, J.D. 2007. Invasive orchids: weeds we hate to
of invasive species, and the natural history of the love? Lankesteriana 7: 19-21.
individual orchid species. Should refugia cease to Ackerman, J.D. & E.J. Meléndez-Ackerman. 2008.
exist, or habitat restoration becomes constrained, then Orquídeas. Pages 189-246 in R. L. Joglar, ed.
recovery of orchid floras will not only be lethargic, but Biodiversidad de Puerto Rico: Agustín Stahl, Flora,
Hongos. Serie de Historia Natural de Puerto Rico. La
the floristic outcome may only superficially resemble
Editorial Universidad de Puerto Rico, San Juan.
the species composition and relative abundance Ackerman, J.D. & S. Moya. 1996. Hurricane aftermath:
patterns of the past. And whether changes are local or resiliency of an orchid-pollinator interaction in Puerto
global, we can only hope that the ability of orchids to Rico. Carib. J. Sci. 32: 369-374.
adapt or migrate will keep pace. Ackerman, J.D., J.C. Trejo Torres & Y. Crespo Chuy. 2007.

162 LANKESTERIANA
Orchids of the West Indies: predictability of diversity C. Baider, S. Engels, V. Dakos, M. Blaauw & K.D.
and endemism. J. Biogeogr. 34: 779-786. Bennett. 2013. Rapid succession of plant associations
Aide, T.M., M.L. Clark, H.R. Grau, D. López-Carr, M.A. on the small oceanic island of Mauritius at the onset of
Levy, D. Redo, M. Bonilla-Moheno, G. Riner, M.J. the Holocene. Quatern. Sci. Rev. 68: 114-125.
Andrade-Nuñez & M. Muñiz. 2013. Deforestation Dixon, K.W., S.P. Kell, R.L. Barrett & P.J. Cribb, eds. 2003.
and reforestation of Latin America and the Caribbean Orchid conservation. Natural History Publications
(2001-2010). Biotropica 45: 262-271. (Borneo), Kota Kinabalu, Malaysia.
Allen, C.D. & D.D. Breshears. 1998. Drought-induced shift Dodson, C.H. 2003. Why are there so many orchid species?
of a forest-woodland ecotone: rapid landscape response Lankesteriana “No. 7” 3(2): 99-103.
to climate variation. Proc. Nat. Acad. Sci. (USA) 95: Dressler, R.L. 1981. The orchids: natural history and
14839-14842. classification. Harvard University Press, Cambridge,
Arditti, J. 1992. Fundamentals of orchid biology. John MA.
Wiley & Sons, New York. Gentry, A.H. & C.H. Dodson. 1987. Diversity and
Auler, A.S. & P.L. Smart. 2001. Late quaternary paleoclimate biogeography of neotropical vascular epiphytes. Ann.
in semiarid northeastern Brazil from U-series dating of Missouri Bot. Gard.74: 205-233.
travertine and water-table speleothems. Quatern. Res. Govaerts, R., K. Kratochvil, G. Gerlach, G. Carr, P. Alrich,
55: 159-167. A.M. Pridgeon, J. Pfahl, M.A. Campacci, D. Holland
Ballantyne, M. & C. Pickering. 2012. Ecotourism as a Baptista, H. Tigges, J. Shaw, P. Cribb, A. George,
threatening process for wild orchids. J. Ecotourism 11: K. Kreuz & J. Wood. 2010. World Checklist of
34-47. Orchidaceae. Facilitated by the Royal Botanic Gardens,
Bateman, R.M., P.M. Hollingsworth, J. Preston, Y.-B. Kew. http://www.kew.org/wcsp/monocots/ accessed 24
Luo, A.M. Pridgeon & M.W. Chase. 2003. Molecular June 2010.
phylogenetics and evolution of Orchidinae and selected Gradstein, S.R. 2008. Epiphytes of tropical montane forests
Habenariinae (Orchidaceae). Bot. J. Linn. Soc. 142: – impact of deforestation and climate change. Pages 51-
1-40. 65. In S.R. Gradstein, J. Homeier & D. Gansert, eds.
Beach, T., N. Dunning, S. Luzzadder-Bech, D.E. Cook & J. The tropical mountain forest – patterns and processes
Lohse. 2006. Impacts of the ancient Maya on soils and in a biodiversity hotspot. Universitätverlag Göttingen.
soil erosion in the central Maya Lowlands. Catena 65: Grau, H.R., T.M. Aide, J.K. Zimmerman, J.R. Thomlinson,
166-178. E. Helmer and X. Zou. 2003. The ecological
Benzing, D.H. 1986. The genesis of orchid diversity: consequences of socioeconomic and land-use changes
emphasis on floral biology leads to misconceptions. in postagriculture Puerto Rico. Bioscience 53: 1159-
Lindleyana 1: 73-89. 1168.
Bergman, E., J.D. Ackerman, J. Thompson & J.K. Guo, Y.-Y., Y.-B. Luo, Z.-J. Liu & X.-Q. Wang. 2012.
Zimmerman. 2006. Land use history affects the Evolution and biogeography of the slipper orchids:
distribution of the saprophytic orchid Wullschlaegelia Eocene vicariance of the conduplicate genera in the
calcarata in Puerto Rico. Biotropica 38: 492-499. Old and New World tropics. PLoS ONE 7: e38788.
Blanco, M.A. & G. Barboza. 2007. Pseudocopulation doi:10.1371/journal.pone.0038788
pollination in Lepanthes (Orchidaceae: Pleurothalli- Gustafsson, A.L., C.F. Verola & A. Antonelli. 2010.
dinae). Ann. Bot. 95: 763-772. Reassessing the temporal evolution of orchids with new
Bogarín, D., F. Pupulin, C. Arrocha & J. Warner. 2013. fossils and a Bayesian relaxed clock, with implications
Orchids without borders: studying the hotspot of Costa for the diversification of the rare South American genus
Rica and Panama. Lankesteriana 13: 13-26. Hoffmannseggella (Orchidaceae:Epidendroideae).
Cascante-Marín, A. & A. Nivia-Ruíz. 2013. Neotropical BMC Evol. Biol. 10: 177. doi10.1186/1471-2148-10-
flowering epiphyte diversity: local composition and 177
geographic affinities. Biodivers. Conserv. 22: 113-125. Hall, M.L., C. Robin, B. Beate, P. Mothes & M. Monzier.
Chase, M.W. 2001. Origin and biogeography of 1999. Tungurahua Volcano, Ecuador: structure, eruptive
Orchidaceae. Pages 1-5. In A. Pridgeon, P. Cribb & F. history and hazards. J. Volcanology Geothermal Res.
Rasmussen, eds. Genera Orchidacearum. Vol. 2. Oxford 91: 1-21.
University Press, Oxford. Hughes, C. & R. Eastwood. 2006. Island radiation
Cribb, P. 1998. The genus Paphiopedilum. 2nd edition. on a continental scale: Exceptional rates of plant
Natural History Publications (Borneo), Kota Kinabalu, diversification after uplift of the Andes. Proc. Nat.
Malaysia. Acad. Sci. USA 103: 10334–10339.
De Boer, E.J., H. Hooghiemstra, F.B. Vincent Florens, IUCN/SSC Orchid Specialist Group. 1996. Orchids – status
survey and conservation action plan. IUCN, Gland T. Yukawa. 2010. Mycoheterotrophy evolved from
Switzerland and Cambridge, UK mixotrophic ancestors: evidence in Cymbidium
Karremans, A.P., F.T. Bakker, F. Pupulin, R. Solano-Gómez (Orchidaceae). Ann. Bot. 106: 573-581.
& M.J.M. Smulders. 2013. Phylogenetics of Stelis and Mújica, E., J. Raventos, E. González & A. Bonet. 2013.
closely related genera (Orchidaceae: Pleurothallidinae). Long-term hurricane effects on populations of two
Pl. Syst. Evol. 299: 151-176. DOI 10.1007/s00606-012- epiphytic orchid species from Guanahacabibes
0712-7 Peninsula, Cuba. Lankesteriana 13: 47-55.
Kelly, A.E. & M.L. Goulden. 2008. Rapid shifts in plant Myers, N., R.A. Mittermeter, C.G. Mittermeter, G.A.B.
distribution with recent climate change. Proc. Nat. da Fonseca & J. Kent. 2000. Biodiversity hotspots for
Acad. Sci. USA 105:11823-11826. conservation priorities. Nature 403: 853-858.
Kirby, S.H. 2007. Geological processes and orchid Nadkarni, N.M. & R. Solano. Potential effects of climate
biogeography with applications to southeast Central change on canopy communities in a tropical cloud forest:
America. Lankesteriana 7: 53-55. an experimental approach. Oecologia 131: 580-586.
Kirby, S.H. 2011. Active mountain building and the Neubig, K.M., W.M. Whitten, N.H. Williams, M.A. Blanco,
distribution of “core” Maxillariinae species in tropical L. Endara, J.G. Burleigh, K. Silvera, J.C. Cushman
Mexico and Central America. Lankesteriana 11: 275- & M.W. Chase. 2012. Generic recircumscriptions
291. of Oncidiinae (Orchidaceae: Cymbidieae) based on
Koopowitz, H. 2001. Orchids and their conservation. maximum likelihood analysis of combined DNA
Timber, Press, Portland, Oregon. datasets. Bot. J. Linn. Soc. 168: 117-146.
Ledru, M.-P., F.W. Cruz Jr., C. Riccomini, I. Karmann & Nilsson, L.A. 1992. Orchid pollination biology. Trends
L. Martin. 2005. Paleoclimate changes during the last Ecol. Evol. 7: 255-259.
100,000 yr from a record in the Brazilian Atlantic Olaya-Arenas, P., E.J. Meléndez-Ackerman, M.E. Pérez &
rainforest region and interhemispheric comparison. R. Tremblay. 2011. Demographic response by a small
Quatern. Res. 64: 444-450. epiphytic orchid. Amer. J. Bot. 98: 2040-2048.
Light, M.H.S. & M. MacConaill. 2007. Effect of trampling Otero, J.T. & N.S. Flanagan. 2006. Orchid diversity –
on a terrestrial orchid environment. Lankesteriana 7: beyond deception. Trends Ecol. Evol. 21: 64-65.
294-298. Papadopulos, A.S.T., M.P. Powell, F. Pupulin, J. Warner,
Liu, H., C.-L. Feng, Y.-B. Luo, B.-S. Chen, Z.-S. Wang & J.A. Hawkins, N. Salamin, L. Chittka, N.H. Williams,
H.-Y. Gu. 2010. Potential challenges of climate change W.M. Whitten, D. Loader, L.M. Valente, M.W. Chase
to orchid conservation in a wild orchid hotspot in & V. Savolainen. 2013. Convergent evolution of floral
Southwestern China. Bot. Rev.76: 174-192. signals underlies the success of Neotropical orchids.
Losos, J.B. 2014. What Darwin got wrong. Chron. Higher Proc. Roy. Soc. B 280: 20130960. http://dx.doi.
Ed. http://chronicle.com/article/What-Darwin-Got-Wro org/10.1098/rspb.2013.0960
ng/144021/?key=TGxzdFc9YXRHZH8yYTtHYW4D Parmesan, C. 2006. Ecological and evolutionary responses
O3I5ZRh1NX8ZYn9wbl9QFw%3D%3D to recent climate change. Ann. Rev. Ecol. Evol. Syst.
Lugo, A.E. 2004. The outcome of alien tree invasions in 37: 637-669.
Puerto Rico. Frontiers Ecol. Environ. 2: 265-273. Partomihardjo, T. 2003. Colonisation of orchids on the
Martos, F., F. Munoz, T. Pailler, I. Kottke, C. Gonneau & M.- Krakatau Islands. Teleopea 10:299-310.
A. Selosse. 2012. The role of epiphytism in architecture Peakall, R., D. Ebert, J. Poldy, R.A. Barrow, W. Francke,
and evolutionary constraint within mycorrhizal C.C. Bower & F.P. Schiestl. 2010. Pollinator specificity,
networks of tropical orchids. Mol. Ecol. 21: 5098-5109. floral odour chemistry and phylogeny of Australian
Migenis, L.E. & J.D. Ackerman. 1993. Orchid-phorophyte sexually deceptive orchids: implications for pollinator-
relationships in a forest watershed in Puerto Rico. J. driven speciation. New Phytol. 188: 437-450.
Trop. Ecol. 9: 231-240. Phillips, R.D., K.W. Dixon & R. Peakall. 2012. Low
Miranda, F.E. 1990. Brazilian Laelias – part III: section population genetic differentiation in the Orchidaceae:
Parviflorae. Amer. Orchid Soc. Bull. 59: 462-472. implications for the diversification of the family. Mol.
Morgan, J., C. Lana, A. Kearsley, B. Coles, C. Belcher, Ecol. 21: 5208-5220.
S. Montanari, E. Díaz-Martínez, A. Barbosa & V. Pounds, J.A., M.P L. Fogden & J H. Campbell. 1999.
Neumann. 2006. Analyses of shocked quartz at the Biological response to climate change on a tropical
global K-P boundary indicate an origin from a single, mountain. Nature 398: 611-614.
high-angle, oblique impact at Chicxulub. Earth and Ramírez, S.R., B. Gravendeel, R.B. Singer, C.R. Marshall &
Planetary Sci. Lett. 251: 264-279. N.E. Pierce. 2007. Dating the origin of the Orchidaceae
Motomura, H., M.-A. Selosse, F. Martos A. Kagawa & from a fossil orchid with its pollinator. Nature 448:
164 LANKESTERIANA
1042-1045. Doi10.1038/nature06039 E.M. III, Everham, D.J. Lodge, C.M. Taylor, D.

Ramírez, S.R., T. Else, M.K. Fujiwara, G. Gerlach, B. García-Montiel & M. Fluet. 2002. Land use history,
Goldman-Huertas, N.D. Tsutsui & N.E. Pierce. 2011. environment, and tree composition in a tropical forest.
Asynchronous diversification in a specialized plant- Ecol. Appl. 12: 1344-1363.
pollinator mutualism. Science 333: 1742-1746. doi: Thornton, I.W.B. 1997. Krakatau: the destruction and
10.1126/science.1209175 reassembly of an island ecosystem. Harvard University
Roberts, R.C. 1942. Soil survey of Puerto Rico. Washington Press, Cambridge, Massachusetts.
DC: U.S. Printing Office. USDA Series 1936., No. 8. Tremblay, R.L., J.D. Ackerman, J.K. Zimmerman & R.N.
Sánchez-Cuervo, A.M., T.M. Aide, M.L. Clark & A. Etter. Calvo. 2005. Variation in sexual reproduction in orchids
2012. Land cover change in Colombia: surprising forest and its evolutionary consequences: a spasmodic journey
recovery trends between 2001 and 2010. PLoS One 8: to diversification. Biol. J. Linn. Soc. 84: 1-54.
e43943. doi:10.1371/journal.pone.0043943 Tremblay, R.L., E. Meléndez-Ackerman & D. Kapan. 2006.
Schiestl, F.P. & S. Dötterl. 2012. The evolution of floral scent Do epiphytic orchids behave as metapopulations?
and olfactory preferences in pollinators: coevolution or Evidence from colonization, extinction rates and
pre-existing bias? Evolution 66: 2042-2055. asynchronous population dynamics. Biol. Conserv. 129:
Soto Arenas, M.A., R. Solano Gómez & E. Hágsater. 2007. 70-81.
Risk of extinction and patterns of diversity loss in van der Pijl, L. & C.H. Dodson. 1966. Orchid flowers: their
Mexican orchids. Lankesteriana 7: 114-121. pollination and evolution. University of Miami Press,
Stebbins, G.L. 1984. Mosaic evolution, mosaic selection Coral Gables.
and angiosperm phylogeny. Bot. J. Linn. Soc. 88: 159- Wadsworth, F.H. 1950. Notes on the climax forest of Puerto
164. Rico and their destruction and conservation prior to
Thompson, J., N. Brokaw, J.K. Zimmerman, R.B. Waide, 1900. Caribb. Forester 11: 48-47.

LANKESTERIANA 13(3): 165—184. 2014.
FROM CUBA TO MOST OF THE NEOTROPIC:

HABENARIA BICORNIS (ORCHIDACEAE) IS WIDESPREAD
FROM MEXICO TO SOUTHEASTERN BRAZIL
João A. N. Batista1,3, Karina Proite1, Bruno M. Carvalho1, Aline A. Vale1

& Leonardo P. Felix2
1
Departamento de Botânica, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais,
Av. Antônio Carlos 6627, Pampulha, Belo Horizonte, Minas Gerais 31270-910, Brazil
2
Departamento de Ciências Biológicas, Centro de Ciências Agrárias, Universidade Federal da Paraíba,
Campus II, Areia, Paraíba 58397-000, Brazil
5
Author for correspondence: janb@icb.ufmg.br
Abstract. Habenaria bicornis was first described in 1835 from Cuba and has only been known from that country
and from a few records in Panama from the 1920s. Here we show that H. bicornis and H. goyazensis, known
from Brazil and Guyana, are conspecific and that the species is distributed from Mexico to southeastern Brazil.
Niche modeling and collection data indicate that this species has a preference for wet lowland savannas and its
distribution is predicted to include most of the Neotropics with suitable habitats. The molecular phylogenetic
analyses based on DNA sequences from the nuclear internal transcribed spacer (ITS) region and part of the
plastid matK gene placed H. bicornis in an isolated position near the base of the Neotropical clade, although
with low support. In terms of its morphology, its relationships are likewise not clear as there are no evident
similarities between H. bicornis and the basal subclades or any other Neotropical subclade. Cytogenetic analysis
indicated a basic chromosome number of x=21, similar to other basal Neotropical species.
Resumen: Habenaria bicornis fue descrita por primera vez en 1835, para Cuba, y era conocida apenas para
este país y unos pocos registros de Panamá, de 1920. En el presente estudio, demostramos que H. bicornis
y H. goyazensis, esta última conocida para Brasil y Guiana, son específicas y la especie se distribuye desde
México hasta el sudeste de Brasil. El modelado de nicho y la recolección de datos indican que esta especie
posee una preferencia por sabanas húmedas de tierras bajas y es predicho que su distribución incluye gran
parte del Neotrópico con hábitats favorables. Los análisis filogenéticos moleculares con secuencias del ADN
nuclear (ITS) y plastidial (matK) ubicaron H. bicornis en una posición aislada próximo a la base del clado
Neotropical, aunque con bajo soporte. En términos de su morfología, sus relaciones no están aclaradas, ya que
no hay similitudes evidentes entre H. bicornis y los subclados básales o cualquier otro subclado Neotropical.
Los análisis citogenéticos indican un número cromosómico básico de x=21, similar a las otras especies basales
del Neotrópico.
Key words: Biogeography, cytogenetics, molecular phylogenetics, Orchidinae, taxonomy
Habenaria Willd. (Orchidinae, Orchideae, 2001). In a synopsis of the New World species of the
Orchidaceae) is a large genus of terrestrial orchids genus, Batista et al. (2011a) listed 298 taxa for the
comprising approximately 881 species (Govaerts et al. Neotropics. Brazil, with 163 taxa, and Mexico, with
2013) distributed throughout tropical and subtropical 79 species, are the major centers of diversity of this
regions of the Old and New Worlds (Pridgeon et al. genus in the New World. Although some species are
Lankester Botanical Garden´s 40th anniversary.
166 LANKESTERIANA
widely distributed throughout the American tropics (1893) based on a collection from central Brazil
and subtropics, most (69%) are restricted to a single (Gardner 3995) and is currently known there from
country. Narrow endemics are few, however, and the Brazilian states of Goiás, Minas Gerais, Mato
in many cases endemic taxa can represent obscure Grosso, Pará, Pernambuco, Sergipe, and Tocantins,
taxa or species known from a few collections or just as well as from Guyana (Batista et al. 2008, 2011a).
the type material, so that their exact identity often Here we investigated here the morphological and
remains unclear. taxonomic relationships between H. bicornis and H.
Studies of New World Habenaria and New goyazensis based on examinations of the respective
World Orchidaceae have generally been undertaken type material and additional herbarium collections.
on a piecemeal basis, and limited by geographic and Based on a previous molecular phylogenetic analysis
political subdivisions. Floras have been published for of New World Habenaria (Batista et al. 2013), we
several countries, but revisions on continental scales also assessed the phylogenetic relationships of H.
are few and have largely been limited to groups with bicornis, performed niche modeling analyses to infer
small numbers of species. As a consequence, several the potential distribution of the species, and performed
species (especially those with broad distributions) cytogenetic analyses to determine its chromosome
have been described several times from different number and CMA/DAPI banding patterns. This paper
countries. An example of this situation is H. trifida was prepared as part of the commemorations for the
Kunth, which is currently known from Mexico to 40th anniversary of the Lankester Botanical Garden.
northern Argentina but first described from Colombia
and only later from Brazil, Venezuela, Mexico, Material and Methods
Paraguay, and Costa Rica – and now comprises 21
Taxonomic analyses. – Descriptions were based
synonyms (Batista et al. 2011b).
on examination of pickled and herbarium material.
Habenaria bicornis Lindl. was described by
Floral details were examined under a stereoscopic
Lindley (1835) based on a collection of Poeppig
microscope and measured using a digital caliper.
from Cuba. Several authors subsequently confirmed
Gynostemium images of H. bicornis were done with
the record for Cuba (Richard 1850, Grisebach 1866,
a digital camera DFC295 coupled to a stereoscopic
1873, Kränzlin 1892, Cogniaux 1909, Ames 1910,
microscope (Leica M205C) and assembled using
Galé 1938, León & Schweinfurth 1946) and the
Leica Application Suite v. 3.8.0 software. Data
several collections known from that country suggest
relating to flowering times, habitat, and distribution
that the species is relatively common there. In the
were obtained from the labels of herbarium
1920s, Ames (1922) recorded H. bicornis in Panama
specimens. A total of 48 specimens and digital
based on a single collection from the Canal Zone
images (photographs) of H. bicornis were examined
(Pittier 6792). Several other authors subsequently
from the following herbaria: A, AMES, BHCB, BM,
reported the species from Panama (Ames 1928,
BR, CEN, EAN, EAP, G, GH, HB, IPA, K, MO, NY,
Williams 1946, 1956, Dressler 1980, 1993, D’Arcy
OXF, P, RENZ, S, SP, US, and W. In addition to these
1987, Correa et al. 2004), but only one additional
herbaria, material of morphologically similar species
collection was made (Powell 315), with most workers
were examined from: ALCB, B, CEPEC, CESJ,
simply quoting the original record without critical re-
CTES,ESA, HBG, HRB, HRCB, HUEFS, IBGE,
examinations of the identity of the specimen. Presence
ICN, L, LP, M, MBM, MBML, OUPR, PMSP, R, RB,
in Panama of a species previously known only from
SI, SPF, UB, U, and UEC. Descriptive terminology is
Cuba seemed curious, but no one investigated further
based on Stearn (1992) and Simpson (2006).
the subject or revised the identity of the Panamanian
specimens. In a synopsis of New World Habenaria, Taxon sampling for phylogenetic analyses. – The
Batista et al. (2011a) noted that H. bicornis is similar datasets for the phylogenetic analyses consisted of
to H. goyazensis Cogn. and that the identities of the combined ITS and partial matK DNA sequences
the two species should be assessed in more detail. of 208 terminals of 157 Neotropical Habenaria
Habenaria goyazensis was described by Cogniaux species, corresponding to 52% of the total number
Batista et al. —Taxonomy and distribution of Habenaria bicornis 167
Table 1.Voucher information and GenBank accessions for the new sequences produced for this work.
Taxon Voucher Origin ITS matK
Habenaria bicornis Lindl. L.P. Felix 10803 (EAN) Brazil: Paraíba KF998087 KF998088
of species known from the Neotropics (Batista et incongruence were detected in our previous
al. 2011a, 2011b); four African Habenaria species analyses with the same datasets (Batista et al.
and Gennaria diphylla Parl. were was used as the 2013). Phylogenetic analyses using maximum
functional outgroup. This dataset is basically the parsimony (MP) were performed using PAUP*
same used to infer phylogenetic relationships of version 4 (Swofford 2002) with Fitch parsimony
New World Habenaria by Batista et al. (2013), (equal weights, unordered characters; Fitch 1971)
but including Habenaria bicornis and excluding as the optimality criterion. Each search consisted
most of the Old World taxa. Voucher information, of 1,000 replicates of random taxon additions,
geographic origins, and GenBank accession numbers with branch swapping using the tree-bisection
can be found in Batista et al. (2013); information and reconnection (TBR) algorithm, saving ≤10
concerning the newly sequenced accessions is trees per replicate to avoid extensive swapping on
provided in Table 1. suboptimal islands. Internal support was evaluated
by character bootstrapping (Felsenstein 1985)
Molecular markers. – Nucleotide sequences from one
using 1,000 replicates, simple addition, and TBR
nuclear (ITS) and one plastid (matK) genome regions
branch swapping, saving ≤10 trees per replicate. For
were analyzed. The ITS region consisted of the 3’ and
bootstrap support levels, we considered bootstrap
5’ ends of the 18S and 26S ribosomal RNA genes, re-
percentages (BPs) of 50–70% as weak, 71–85% as
spectively, the internal transcribed spacers (ITS1 and
moderate, and >85% as strong (Kress et al. 2002).
ITS2), and the intervening 5.8S gene of the nuclear
Bayesian analysis was conducted using MrBayes
ribosomal multigene family. Amplifications of this
v. 3.1.2 (Ronquist et al. 2005), treating each DNA
region were performed using primers 17SE and 26SE
region as a separate partition. An evolutionary
(Sun et al. 1994). We used an internal fragment of ap-
model for each DNA region was selected using the
proximately 630 bp of the matK gene, amplified with
Akaike Information Criterion (AIC) in MrModeltest
primers matK-F2 and matK-R2 (Batista et al. 2013),
2 (Nylander 2004). Each analysis consisted of
which approximately corresponds to the region wide-
two independent runs, each with four chains, for
ly used for barcoding land plants (Chase et al. 2007).
5,000,000 generations, sampling one tree every
This fragment is the most variable region of the gene
1000 generations. To improve chain swapping,
in several orchid groups (e.g., Whitten et al. 2000).
the temperature parameter for heating the chains
DNA extraction, amplification, and sequencing were
was lowered to 0.01 in the combined analysis.
carried out following standard protocols, as described
Convergence between the runs was evaluated using
by Batista et al. (2013). Bidirectional sequence reads
the average standard deviation of split frequencies
were obtained for all of the DNA regions, and the re-
(<0.01). After discarding the first 50% of the trees
sulting sequences were edited and assembled using
as the burn-in, the remaining trees were used to
the Staden Package software (Bonfield et al. 1995).
assess topology and posterior probabilities (PPs) in
The edited sequences were aligned with MUSCLE
a majority-rule consensus. PPs in Bayesian analysis
(Edgar 2004), and the resulting alignments were
are not directly comparable to BPs, being generally
manually adjusted using MEGA4 software (Tamura
much higher (Erixon et al. 2003). Therefore, we
et al. 2007).
used criteria similar to a standard statistical test,
Phylogenetic analyses. – The data were analyzed considering groups with PPs >0.95 as strongly
by means of parsimony and Bayesian inference. supported, groups with PPs ranging from 0.90–0.95
Searches were performed only with a combined as moderately supported, and groups with PPs <0.90
matrix, because no cases of strongly supported as weakly supported.
168 LANKESTERIANA
Niche modeling. – We assembled a database of 40 min, re-stained with DAPI (1 µg mL─1) for 30 min,
taxonomically depurated, georeferenced unique mounted in glycerol:McIlvaine buffer pH 7.0 (1:1),
occurrence records, based on revision of specimens and subsequently aged for 3 days before analysis in
from 22 herbaria (see Taxonomic analyses, earlier). an epifluorescence Leica DMLB microscope. Images
The geographic coordinates were plotted using ESRI were captured with a Cohu CCD video camera using
ArcGIS 9 software. The extent of occurrence (EOO) Leica QFISH software, and were subsequently edited
was calculated by tracing a minimum polygon, with in Adobe Photoshop CS3 version 10.0. The rDNA
angles exceeding 180° and containing all points of sites were localized using 5S rDNA from Lotus
occurrence (IUCN 2010). The environmental variables japonicus (Regel) K.Larsen labeled with Cy3─dUTP
were extracted from the database in Worldclim (Amersham) and 45S rDNA from Arabidopsis thaliana
(Hijmans et al. 2005) at a spatial resolution of 0.98 (L.) Heynh. labeled with digoxigenin─11─dUTP as
km. Niche model was generated using Maxent version probes. Labeling was performed by nick translation.
3.3.2 (Phillips et al. 2006, Sérgio et al. 2007) under The 45S rDNA probe was detected with sheep anti-
the default values. The threshold was determined to digoxigenin FITC conjugate (Roche) and amplified
turn the probability model into a model of presence with rabbit anti-sheep FITC conjugate (Dako). The
and absence designed to distinguish appropriate and hybridization mixture contained 50% formamide
inappropriate areas for H. bicornis. We adopted the (v/v), 10% dextran sulfate (w/v), 2× SSC, and 5 ng/
Lowest Presence Threshold (LPT) method, which µL of each probe. The slides were denatured at 75 oC
is suitable for guiding field studies whose main for 3 min. Stringent washes were performed, reaching
purpose is to identify unknown distribution areas and a final stringency of approximately 76%. Images of
to find new populations (Pearson et al. 2007). GIS the best cells were captured as previously described.
techniques were applied (ESRI ArcGIS 9.2) for the
visualization of modeling results and a presence and Results and discussion
absence value of 0.15 was adopted (LPT) to view the
Taxonomic and morphological analyses. –
predicted area. The model was evaluated based on the
Examination and comparison of the type specimens
jackknife method developed by Pearson et al. (2007).
and several other collections of H. bicornis and
CMA/DAPI banding and FISH (fluorescent in H. goyazensis (see list of the materials examined)
situ hybridization). – Root tips from specimen revealed that the two concepts are conspecific,
L.P Felix 10803 were pretreated with 0.002 M of sharing the following distinctive characters: well-
8-hydroxyquinoline for 24 h at 10 ºC and fixed in developed, patent, lanceolate leaves up to 28 cm long
Carnoy’s solution. CMA/DAPI banding and FISH and 2.5 cm wide; medium-sized flowers (dorsal sepal
procedures were performed according to Souza et al. 4–8 mm long), anterior petal segment longer than
(2012). Fixed root tips were washed in distilled water the posterior segment; and spur 2.5–4.6 cm long,
and digested in a 2% (w/v) cellulase (Onozuka)/20% being about 1.3–2.1 times as long as the pedicellate
(v/v) pectinase (Sigma) solution at 37 ºC for 120 ovary (Fig. 1 and Table 2). In terms of the overall
min and macerated in a drop of 45% acetic acid; morphology of the flowers, Habenaria bicornis shares
the coverslip was later removed in liquid nitrogen. some similar characters with, and has been mistaken
The CMA/DAPI double-staining technique was for, other species such as H. caldensis Kraenzl. and
used for fluorochrome banding. Slides were aged H. exaltata Barb.Rodr. (Fig. 2) that also have a spur
for 3 days, stained with CMA (0.1 mg mL─1) for 60 approximately twice the size of the pedicellate ovary
Right, Figure 1. Floral and vegetative morphology of Habenaria bicornis and similar species. From left to righ on each
row: lateral view of ovary, spur and gynostemium, dissected perianth, and habit. Habenaria bicornis. A — Batista
683, CEN. B — Santos et al. 2422, CEN. C — Pastore 1452, BHCB. Habenaria caldensis. D — Batista et al. 1382,
CEN. E — Batista 2415, BHCB. F — Borba 102, BHCB. G — Munhoz & Martins 94, BHCB. Habenaria exaltata.
H, I — Batista 2798, BHCB. J — Batista 2520, BHCB. Habenaria rodeiensis. K, M — Batista & Peixoto 3273, BHCB.
L — Mota 2824, BHCB. Scales = 1 cm, for ovary, spur, gynostemium, and dissected perianth; 5 cm for habit.


170 LANKESTERIANA
Table 2. Diagnostic characters comparing H. bicornis and morphologically similar species. Abbreviations for the Brazilian
states are: BA, Bahia; DF, Distrito Federal; ES, Espirito Santo; GO, Goiás; MG, Minas Gerais; MT, Mato Grosso; PA, Pará;
PB, Paraíba; PE, Pernambuco; PR, Paraná; RJ, Rio de Janeiro; RS, Rio Grande do Sul, SE, Sergipe; SP, São Paulo; TO,
Tocantins.
H. bicornis H. caldensis H. exaltata H. rodeiensis
Leaves length × 13–24(28) × (0.8)1.1–2(2.5) 5–12(16) × 0.3–0.9(1.4) 8.5–28 × 1.5–3.5 5–12 × 0.6–1.6
width (cm)
Dorsal sepal length × 4–8 × 4.5–6(8) 5–7× 4.5–6 3.7–5.3 × 3.8–5.8 4.5–7× 4–6
width (mm)
Lateral sepals length 6.5–9.5 × 3–5 6.2–8.8 × 2.6–3.8 4.7–7.8 × 2.3–4.4 5.5–8 × 2.5–3
× width (mm)
Corola color base white, segments white throughout base whitish, segments base white, segments
green green light green to whitish
Posterior petal 4.6–7.1 × 1.7–1.85 4.8–6 × 1.3–1.8 3.7–5.7 × 1–1.8 4.5–7.5 × 2–3.5
segment length ×
width (mm)
Anterior petal 6.8–8.8 8–13 1.2–4.4 4.5–6(7)

segment length (mm)
Anterior petal 1.3–1.5 times as long 1.6–2.2 times as long 0.2–1 times as long 1–1.2 times as long
segment length
relative to posterior
segment
Ovary length (mm) 13–28 10–14 11–15 12–16
Pedicel length (mm) 2.3–6 5–8 1.5–4.4 18–28
Spur length (mm) 25–46 32–41 28–35 28–36
Spur size relative to 1.3–2.1 times as long 1.6–2.3 times as long 1.5–1.8 times as long 0.9–1.2 times as long
the pedicelate ovary
Spur position relative free from the bracts free from the bracts free from the bracts placed between the
to floral bracts bracts
Spur clavate clavate linear linear
Spur apex subacute to acute rounded acute acute
Hemipollinaria separated united separated united
Rostellum midlobe obtuse, placed between acute, projected obtuse, placed between subacute, projected
apex the anther loci beyond the anther loci the anther loci beyond the anther loci
Distribution Mexico, Guatemala, Brazil (BA, GO, MG) Brazil (MG, PR, RS, SP) Brazil (BA, DF, ES, GO,
Honduras, Panama, and Paraguay MG, MT, PR, RJ, SP),
Cuba, Venezuela, Guyana Paraguay and Peru*
and Brazil (PA, PB, PE,
SE, GO, MT, TO, MG)
*The records of H. rodeiensis from northern South America and Central America in Belize, Costa Rica and French Guiana need
confirmation because this species is remarkably similar to H. longipedicellata, H. lehmanniana Kraenzl., and H. ernestii Schltr.
That are known from northern Brazil or northern South America, and the separations between them are not clear.
(Fig. 1, and Table 2). However, H. caldensis differs in (1.2–4.4 mm long), which is about 0.2–1 times as
the smaller plants with smaller leaves, a completely long as the posterior segment, and the spur linear
white corolla, anterior petal segment 1.6–2.2 times throughout (Figs. 1, 2; Table 2). Other differences are
as long as the posterior segment, and rounded spur found in the morphology of the gynostemium: in H.
apex. On the other hand, H. exaltata is distinguished bicornis the midlobe apex of the rostellum is obtuse,
from H. bicornis by its shorter anterior petal segment placed between the anther loci and the hemipollinaria
Figure 2. Inflorescences and flower morphology of Habenaria bicornis and similar species. Habenaria bicornis.
A — Inflorescence. B — Flower, both from Felix 10803, EAN. C — Flower, from Batista 683, CEN. Habenaria
caldensis. D — Inflorescence, from Batista 2633, BHCB. E — Flower, from Batista 2621, BHCB. Habenaria rodeiensis.
F — Inflorescence. G — Flower, both from Batista & Peixoto 3273, BHCB. Habenaria exaltata. H — Inflorescence.
I — Flower, both from Batista et al. 2520, BHCB.

172 LANKESTERIANA
Figure 3. Gynostemium morphology. A — Habenaria bicornis, from Batista et al. 683, CEN. B — Habenaria caldensis,
from Batista 2621, BHCB. C — Habenaria exaltata, from Batista et al. 2520, BHCB. D — Habenaria rodeiensis, from
Batista & Peixoto 3273, BHCB. Scale bars A = 2 mm; B-D = 1 mm. Ac = anther canals; An = anther; Ap = anterior petal
lobe; Au = auricules; Co = connective; Ds = dorsal sepal; Pe = petal; Pg = pollen grains; Pp = posterior petal lobe; Ra =
rostellum arms; Rm = rostellum midlobe; Sp = stigmatic lobes; Spr = stigmatic projections; Vi = viscidium.
are separated, whereas in H. caldensis the rostellum projection that partially divides the space between
midlobe apex is acute, projected beyond the anther the stigma lobes and the entrance to the spur into two
loci, and the hemipollinaria are united (Fig. 3). In apertures (Fig. 3), which is a very distinctive character
H. exaltata the stigma lobes have a protruding, erect not found in any of the other species mentioned
above. Habenaria bicornis has also been confused Pickel 3615, which is H. goyazensis, but his concept
with H. rodeiensis Barb. Rodr. However, the leaves of the species was equivocal, as he used the same
of the latter are smaller and more appressed to the name for another species, currently known as H.
stem, the pedicel is about the same size or longer than tamanduensis Schltr. Pabst (Pabst & Dungs 1975)
the ovary, the spur is linear throughout and usually apparently only examined one collection of the species
covered by the bracts, the posterior segment of the (Macedo 1695), which he identified as H. caldensis,
petals is wider (Fig. 1; Table 2), and the hemipollinaria using the name H. goyazensis for several other
are united by the viscidia (Fig. 3). Further differences species (including H. caldensis, H. dusenii Schltr.,
between H. bicornis and the species mentioned above H. glaucophylla Barb. Rodr., H. longipedicellata
are outlined in the key below and in Table 2. Hoehne, H. macilenta [Lindl.] Rchb.f., and H.
With few exceptions, the identification of rodeiensis). Other extra-Brazilian South American
specimens of H. bicornis has been straightforward. This collections of H. goyazensis remained indeterminate
species was previously only known from Cuba, and is or were more recently identified as H. caldensis by
very distinct from other Cuban species of Habenaria. Snuverink & Westra (1983) and Renz (1992).
The identity of H. goyazensis and its taxonomic Excluding the material from Panama, other
history, on the other hand, has been confusing because Central American and Mexican specimens of H.
each taxonomist who examined material of the species bicornis remained indeterminate or received disparate
(Cogniaux 1893, Kränzlin 1911, Hoehne 1940, Pabst identifications (such as H. bractescens Lindl. or H.
& Dungs 1975, Snuverink & Westra 1983, Renz 1992) jaliscana S. Watson). Ames (1922, 1928) was the
misidentified it or applied that name to other species. only taxonomist able to correctly identify extra-
Lindley was apparently the first to examine collections Cuban specimens of H. bicornis; probably because
of H. goyazensis because there is a sheet in his he had personally examined and correctly identified
herbarium (K-L) with drawings of a plant and a flower several specimens from Cuba.
(Fig. 4) of the type collection (Gardner 3995), but he
apparently never assigned a name to this material. There Phylogenetic analyses. – The matrix with the
is also a duplicate of the type collection (W-R 51336) combined ITS and partial matK gene consisted of
at the Reichenbach herbarium (W-R) and another sheet 1372 aligned characters, of which 304 (22%) were
in the same herbarium (W-R 54022) bearing a sketch parsimony-informative. The parsimony analysis
of a flower from the type made by Reichenbach (Fig. retained a total of 5150 most parsimonious trees with
4), as well as a reproduction of Lindley’s drawings at a tree length of 935 steps, a consistency index (CI)
K-L. Curiously, the two major orchid taxonomists of of 0.65, and a retention index (RI) of 0.85. The strict
the 19th century examined collection Gardner 3995 in consensus of 5150 trees was for the most congruent
detail (judging from the illustrations they drew; Fig. with the Bayesian majority-rule consensus tree, but
4), but neither reached a conclusion about its identity. because the latter was more fully resolved and had
For his description of H. goyazensis, Cogniaux stronger overall support it was chosen for presentation
(1893) apparently did not examine duplicates of the here (Fig. 5). The relationships recovered were similar
type material nor the illustrations located at K-L and to those of our previous molecular phylogenetic study
W-R, as his protologue only mentions material from (Batista et al. 2013), with the New World Habenaria
B and G. Cogniaux’s herbarium, now in BR, holds species forming a well-supported monophyletic
a fragment of the type collection of H. goyazensis group (1.00 PP, 87% BS, Fig. 5) that was sister to the
as well as a complete specimen of the species (Pohl African species H. tridens Lindl. (1.00 PP, 100% BS).
s.n.), although the latter is misidentified as H. sartor Within the New World clade, several well-supported
Lindl. Kränzlin (1911) examined two collections of H. subclades were recovered (Fig. 5) that corresponded
goyazensis from Mato Grosso, Brazil, but identified to the same subclades identified in our previous
one as H. exaltata (Lindman 2765) and the other analyses (Batista et al. 2013). Habenaria bicornis
as H. caldensis (Lindman 2791½). Hoehne (1940) formed a polytomy (0.75 PP) with a clade formed by
examined and correctly identified the collection subclades 2 and 3 and another formed by subclades 4
174 LANKESTERIANA
Figure 4. Historical illustrations of Habenaria bicornis and H. goyazensis. A — Habenaria bicornis. Lindley’s original
drawing of the species based on the holotype: E.F. Poeppig s.n. (K-L 000463128). B — Habenaria goyazensis.
Lindley’s drawing of the type material based on G. Gardner 3995(K-L 000363784). C — Habenaria goyazensis.
Reichenbach’s drawing of the type material (Gardner 3995), probably from W-R 51336. D — Habenaria goyazensis.
Drawing published by Kränzlin (1911) based on Lindman 2791 ½ (S 06-6545). A and B reproduced with the permission
of the Royal Botanic Gardens, Kew. C provided by the National History Museum, Vienna.
Right, Figure 5. Bayesian majority-rule consensus tree of the combined ITS and matK (partial) datasets. Numbers next
to the nodes represent the posterior probabilities from the Bayesian analysis (PPs) and bootstrap values from the
parsimony analysis (PP/MP). Bootstrap values ≤50% are shown by a dash (-). Only values of the major clades are
shown. Neotropical subgroups are numbered according to Batista et al. (2013). Old World taxa are indicated by an
asterisk (*). The generic name for all Habenaria species is abbreviated. Habenaria bicornis is highlighted in bold and
indicated by an arrow.


176 LANKESTERIANA
to 6. In the strict consensus of the parsimony analysis

this node collapsed and H. bicornis was placed in a
polytomy near the base of the Neotropical clade.
In terms of infrageneric classifications, Kränzlin
(1892, 1901) placed H. bicornis in sect. Macroceratitae
Kraenzl., while Cogniaux (1893) and Kränzlin (1901)
placed H. goyazensis in sect. Pentadactylae Kraenzl.
These classifications are clearly equivocal because
H. bicornis and H. goyazensis do not match the
morphological characters of the corresponding sections,
and also because all Neotropical sections of the genus
are polyphyletic or paraphyletic (Batista et al. 2013).
The morphological relationships of H. bicornis
with other Neotropical species or subclades are
likewise unclear because Habenaria bicornis is Figure 6. Occurrence records and potential distribution
morphologically distinct from any of the basal of Habenaria bicornis inferred with Maxent.
Political divisions are highlighted in white. Country
subclades (Fig. 5, subclades 2 to 6) and any other
abbreviations are as follows: Arg, Argentina; Bol,
Neotropical subclade. Bolivia; Bra, Brazil; Col, Colombia; Ecu, Ecuador;
Niche modeling. – The potential distribution of H. Mex, Mexico; Nic, Nicaragua; Per, Peru; Pry, Paraguay;
Sur, Suriname; Ven, Venezuela.
bicornis as modeled with Maxent using the threshold
(LPT) value of 0.151 as the upper limit is shown in
some high probability areas of occurrence were
figure 6. The hit ratio generated by this model was
unexpected, such as the coastline of Ecuador and
93%. The potential geographic distribution of the
parts of the states of Rio de Janeiro and Espirito Santo
species extends from the Atlantic coast of the state of
in southeastern Brazil (Fig. 6).
VeraCruz in Mexico, southwards to the coast of Santa
Catarina State in southern Brazil, and eastwards to Cytogenetics. – Habenaria bicornis has 2n = 42
the Bahamas, northeastern Brazil, and the Guyanas. (Fig. 7A-C, G) and a symmetrical karyotype, with
The bioclimatic variables that contributed most to chromosomes ranging in size from 2.9 to 9.8 µm
the model were mean monthly diurnal temperature and being mainly metacentric to submetacentric,
ranges (maximum temperature minus minimum except for two small acrocentric pairs (Fig. 7C,
temperature), precipitation seasonality, and annual arrows). Regular meiosis was observed, with 21
temperature range (maximum temperature of chromosomes in each cell of the dyad in meiosis
warmest month minus minimum temperature of II (Fig. 7D-F). Although the species did not show
coldest month). Distribution modeling predicted a clearly differentiated CMA/DAPI bands in meiosis,
larger area of occurrence than that currently known CMA−/DAPI+ pericentromeric regions (Fig. 7A,
for the species, which includes the Yucatan Peninsula B) were observed in mitosis. Terminal chromosome
in Mexico, Guatemala, Honduras, Panama, Cuba, regions staining slightly more intensely with CMA
Venezuela, Guyana, and Brazil. According to our than with DAPI were observed only in mitotic
results, however, H. bicornis should also be expected prometaphases (Fig.7C). Two 45S rDNA sites were
to occur in Belize, Nicaragua, Costa Rica, all the observed on the terminal chromosome regions of
major islands of the Antilles, as well as Colombia, a large metacentric pair (Fig. 7G) that did not co-
Suriname, Ecuador, Peru, Bolivia and Paraguay. occur with CMA bands. Two 5S rDNA sites were
Many of the predicted areas of occurrence should be observed in the interstitial and subterminal regions of
expected based on the current known distribution of a long arm on two chromosome pairs per monoploid
the species, such as other Mesoamerican countries complement (Fig. 7G). The basic number x = 21 is
and some areas of northeastern Brazil. However, the most frequent among Neotropical and Old World

Figure 7. Habenaria bicornis. A-C, G. Mitotic metaphases. D-F. Meiotic metaphase II. A, D. Stained with DAPI. B, E.
Stained with CMA. C, F. CMA/DAPI overlap showing CMA terminal bands and DAPI pericentromeric bands. G. FISH
with 45S (green) and 5S rDNA sites (red). Arrows in C indicate acrocentric chromosomes; scale bar in A corresponds
to 10 µm.
species of Habenaria (Felix & Guerra 1998, 2005). Orchidiinae), and Heterotaxis discolor (Lodd. ex
This number was previously reported for H. pratensis Lindl.) Ojeda & Carnevali (Cabral et al. 2006;
(Salzm. ex Lindl.) Rchb.f. and H. repens Nutt. (Felix Epidendroideae, Maxillariinae), suggesting that the
& Guerra 1998), both of which are “basal” species loss or acquisitions of this heterochromatin may be
in our previous molecular phylogenetic analysis recurrent events in orchids. However, the occurrence
of Neotropical Habenaria (Batista et al. 2013), of GC-rich heterochromatin on the terminal regions
suggesting that x = 21 maybe the ancestral basic of all chromosomes in H .bicornis has not been
number for Neotropical Habenaria. reported for any other orchid species. The evolution
The banding patterns observed in H. bicornis of CMA/DAPI band patterns in subtribe Maxillariinae
stand out because of the presence of pericentromeric is highly variable within and between different
and terminal heterochromatin. Pericentromeric monophyletic lineages and has been important for
heterochromatin has been observed in unrelated the cytotaxonomic characterization of several species
groups of orchids, such as Psygmorchis pusilla (Moraes et al. 2012). If this is also true for Habenaria,
(L.) Dodson & Dressler (Felix & Guerra 1999; CMA/DAPI band patterns may provide an additional
Epidendroideae, Oncidiinae), several species of tool for characterization of lineages and species and
Ophrys L. (D’Emerico et al. 2005; Orchidoideae, for testing phylogenetic hypothesis in the genus.
178 LANKESTERIANA
Taxonomic treatment
Key to Habenaria bicornis and morphologically similar species
1. Petal posterior segment 2.0–3.5 mm wide; spur about the same length as the pedicellate ovary, usually hidden
between the bracts H. rodeiensis
1. Petal posterior segment 1.0–1.85 mm wide; spur 1.3–2.3 times as long as the pedicellate ovary, free from the
bracts 2
2. Petal anterior segment 0.2–1.0 times as long as posterior segment; spur linear throughout H. exaltata
2. Petal anterior segment 1.3–2.2 times as long as posterior segment; spur clavate to subclavate 3
3. Plants 19–44 cm tall including inflorescence; leaves 5–12(–16) × 0.3–0.9(–1.4) cm; petals and lip
completely white; anterior petal segment 1.6–2.2 times as long as posterior segment; spur apex
rounded; hemipollinaria united; rostellum midlobe apex acute, projected beyond the anther locules
H. caldensis
3. Plants (25–)37–90(–107) cm tall including the inflorescence; leaves 13–24(–28) × (0.8–)1.1–2.0(–2.5)
cm; petals and lip with base white and green segments; anterior petal segment 1.3–1.5 times as long
as posterior segment; spur apex subacute to acute; hemipollinaria separated; rostellum midlobe apex
obtuse, situated between the anther locules H. bicornis
Habenaria bicornis Lindl., Gen. Sp. Orchid. Pl. 309. shorter than or about the same size as the pedicellate
1835. Type: CUBA. 1822, E.F. Poeppig s.n. (Holotype: ovary. Flowers 19–28(–33), resupinate, greenish-
K [s.n.]; isotype: K-L [000463128, drawings of white; pedicellate ovary parallel to or spreading from
holotype by Lindley]). the rachis, (13–)21–26(–32) mm long; ovary slightly
arched, 13–28 mm; pedicel shorter than the ovary,
Synonyms: Habenaria tricuspis A. Rich., Hist. Fis.
2.3–4.2 mm. Sepals green, aristate, smooth; dorsal se-
Cuba, Bot. 11: 249. 1850. Type: CUBA. 1836, R.
pal concave, when flattened ovate, 4–8 × 4.5–6.0(–8.0)
de La Sagra s.n. (Holotype: P [00408997]; isotype:
mm; lateral sepals obliquely lanceolate, acute or sub-
W-R [43232]).
acute, reflexed, 6.5–9.5 × 3–5 mm. Petals bipartite;
Habenaria goyazensis Cogn., Fl. Bras. (Martius) 3(4):
posterior segment falcate, 4.6–7.1 × 1.7–1.9 mm, sub-
77. 1893. Type: BRAZIL. Goyaz [Tocantins],
acute, lying beside or free from the dorsal sepal, base,
campos (marsh) near Conceição [Conceição do
middle part and inner margin white, outer margin from
Tocantins], fls. greenish-white, February 1840
the middle to the apex light green; anterior segment
(fl), G. Gardner 3995 (Holotype: not indicated;
divergent, linear, inserted at the base of the posterior
Lectotype, designated by Batista et al. 2011a:
segment, 6.8–8.8 × 0.4–0.8 mm, 1.3–1.5 times as long
K [000363814]; Isotypes: B [destroyed], BR
as the posterior segment, base whitish, towards the
[642571; fragment from B or G], BM [000032714],
segments apex light green. Lip tripartite, light green,
F [24791; negative from the specimen from G], G
base white, towards the segments apex light green;
[00169025], K [000363815], K-L [000363784],
undivided basal part prominent, 1–2.8 × 1.7–2.5 mm;
OXF, W-R [51336, 54022], RENZ [1446; photo,
side segments linear, 7.8–8.8(–11.0) × 0.6–0.9(–1.0)
drawing and fragment from W-R 51336]).
mm, 1.3–1.5 times as long as the median segment;
Terrestrial herb. Roots few, short, at the base of median segment linear-ligulate, straight, 5.5–7.0 ×
the stem. Tuberoid fusiform, 2.2–3.0 × 1.0–1.8 cm. 0.9–1.9 mm; spur slightly sinuous to hooked, some-
Stem erect, (25–)37–90(–107) cm long, including the times projected frontwards, free from the bracts, sub-
inflorescence, 3.0–7.7 mm wide. Leaves 6–10(–17), clavate, 1.3–2.1 times as long as the pedicellate ovary,
spreading, largest at the center of the stem, lanceolate, 2.5–4.6 cm long, base 0.6–1.4 mm wide, whitish, apex
13–24(–28) × (0.8–)1.1–2.0(–2.5) cm. Inflorescence 1.4–2.4 mm wide, green. Gynostemium erect, 2.6–2.9
6–20 cm long, many-flowered, spiral; floral bracts mm high; connective emarginate, light green; auricles
lanceolate, acuminate, (1.3–)1.5–2.8(–3.2) cm long, fleshy, verrucose, whitish, 0.6 × 0.7 mm, apex round-
ed. Anther locules 1.8–2.3 mm high, canals short, between wet grassland and gallery forests. Elevations
1.0–1.1 mm long, hemipollinaria separated, 3.7 mm range from near the sea level to 800 m, but most
long, viscidium 0.75 × 0.6 mm, spaced 1.4–1.6 mm records (90%) are from below 400 m. Flowering
apart, caudicles 1.3 mm long, pollinia 1.6 × 1.1 mm. occurs from the peak of the rainy season to its end:
Stigma lobes 2, mostly separate, in contact only at the from February to March in central and southeastern
apex, oblong, light green, flat, receptive surface turned Brazil; and from June to October in northeastern Brazil
upwards, 2.1–2.3 mm long, apex 1.2 mm wide, obtuse, and in the northern hemisphere (Table 3). As in most
margins not involute, space between the stigma lobes species of the genus, H. bicornis begins a new growth
oblong to elliptic. Rostellum 3.4 mm long, white; mid- cycle during the rainy season. A new vegetative shoot
lobe triangular, fleshy, erect, obtuse, completely placed grows from the tuber formed during the previous
between the anther loci, 1.8 mm high; side-lobes paral- season and produces a new stem, which forms a new
lel throughout, 1.9 mm long. tuber and a terminal inflorescence. After maturation
of the capsules as the dry season approaches, the stem
Distribution and conservation status: Habenaria
and leaves wither and are lost, and the new tuberoid
bicornis is distributed from southern Mexico
becomes dormant. Because of its habitat preferences,
(Campeche and Veracruz), Central America
Habenaria bicornis seems to be less affected by fire
(Guatemala, Honduras, and Panama), the Caribbean
regimens than other Neotropical species of the genus
(Cuba), northern South America (Venezuela and
from seasonal humid grasslands (Batista et al. 2003,
Guyana), to northern (Pará), northeastern (Paraíba,
2010, Batista & Bianchetti 2010), which usually
Pernambuco, and Sergipe), central (Goiás, Mato
depend upon fire for large-scale flowering.
Grosso, and Tocantins) and southeastern (Minas Gerais)
Brazil. Although the species is widespread throughout Illustrations: Kränzlin (1911, table 2, fig. 2, as H.
most of the Neotropics, it is uncommon and locally caldensis, based on Lindman 2791 ½), Hoehne (1940,
known from few collections (except from Cuba, where plate 67; figure I, as H. goyazensis, based on Pickel
several collections are known, particularly from the 3615), Snuverink & Westra (1983: 572, fig. 3, as H.
province of Pinar del Rio). Despite its low frequency, caldensis, based on Wilson-Browne 2), Batista et al.
but because of its broad distribution, H. bicornis can (2008, fig. 2K-L, as H. goyazensis, based on Batista
be classified as Least Concern (LC) according to the et al. 683).
World Conservation Union Red List Categories and The illustration of H. exaltata in Flora Brasilica
Criteria (IUCN, 2001). (Hoehne 1940, plate 68) is most probably based on
Lindman 2765 (S) and referable to H. bicornis. The
Habitat, ecology and phenology: Habenaria bicornis
material illustrated in Pabst & Dungs (1975: 250,
is commonly found in lowland, permanently wet
fig. 97), and identified as H. goyazensis, is based in
savannas (chagüite, matorral, selva baja caducifolia
on Chagas s.n. – INPA 826, and is referable to H.
inundable, acuática, wet grassland, wet boggy
longipedicellata.
meadow, sandy wet banks, moist grassy places, wet
fields, campo alagado, campo úmido, pântano, brejo). Additional specimens examined: MEXICO. Campeche:
The species also occasionally occurs at the interface Carretera Kalkiní-El Remate, 2 km antes de llegar a El
Table 3. Number of flowering specimens of H. bicornis for each of its main geographic distribution areas. The total includes
all collected specimens from each region, including materials with fruits, and with or without collection dates.
Taxa Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Total
Mexico and Central America 2 2 1 8
Cuba 8 4 2 25
Northeastern Brazil and northern South

1 1 2 2 8
America
Central and southeastern Brazil 4 1 7

180 LANKESTERIANA
Remate, selva baja caducifolia inundable, acuática, comum, Las sabanas, fl. greenish, 10 September 1914 (fl), H.F.
flor verde-amarillenta, con el centro blanquecino, 11 Pittier 6792 (US); Panama City, near Matías Hernández,
October 1999 (fl), M. Pena-Chocarro, J. Tun, L. Salinas & wet field, common but plants all dried, 30 December 1923
J. Hinojosa 599 (BM); Veracruz: Totutla, Mata Obscura, (fr), P.C. Standley 28982 (US); Panama City, between
matorral en terreno plano, flores verdes tierno con el Matías Hernández and Juan Diaz, 21 January 1924 (fr),
centro blanquecino, 30 September 1972 (fl), A.F. Ventura P.C. Standley 32032 (US). VENEZUELA. Bolivar: Cuidad
7072 (EAP). CUBA. Herb. Estac. Centr. Agron. 753 Guayana, Mission deu Caroni, Canton de Upata (?), dan les
(BR). Cienfuegos: Cieneguita, in wet grassy lands, not savannes humiden, 1864 (fl), Grosourdy s.n. (P 00386911);
uncommon, 7 or 8 August 1895 (fl), R. Combs 440 (AMES, Portuguesa: Guanare, Mesa Alta (Mesa del Indio), 10
GH, MO); Cieneguita, in wet grassland and open wood land, km al N-W de Guanare, en chaparrales associados com
3 September 1895 (fl), R. Combs 755 (GH). Guantánamo: sabanas, flores blanco-verdosas, 9º4’N, 69º44’W, 300 m, 19
Oriente, in savanna, 2 August 1914 (fl), E.L. Ekman 2375 September 1988 (fl), G. Aymard & C. Ramirez 7067 (MO).
(NY); Bayate, Sabana Miranda, 15 September 1915 (fl), GUYANA. Upper Takutu-Upper Esequibo: Rupununi
E.L. Ekman 6449 (US). Matanzas: San Miguel de los River, savanna, August 1948 (fl), G. Wilson-Browne 2 (K,
Baños, on slope of Jacán hill, Grassy place, 6 August 1919 NY, RENZ). BRAZIL. Goiás: Mossâmedes, Serra Dourada,
(fl), B. León & M. Roca 8898 (NY). Pinar del Rio: vicinity Fazenda Agua Fria, Pohl 1645 (BR, W); São Domingos,
of Herradura, Royal Palm savanna, flowers greenish-yellow, Fazenda Craibinha, cerrado, campo úmido, 16 March 2004
26-30 August 1910 (fl), N.L. Britton, E.G. Britton, F.S. Earle (fl), A.A. Santos et al. 2422 (BHCB, CEN). Minas Gerais:
& C.S. Gager 6337 (AMES, K, NY, US); Laguna Santa Ituiutaba, margens do Rio Paranaíba, Fazenda Santa
María, sandy pinelands, 8 September 1910 (fl), N.L. Britton, Terezinha, varjão (campo alagado), fl. verde-amareladas, 18
E.G. Britton & C.S. Gager 7153 (AMES, NY); Vicinity of February 1949 (fl), A. Macedo 1695 (HB). Mato Grosso:
Pinar del Río, sandy wet bank, in pinelands, sepals green, Serra das Araras, in campis, perianthum viride, 15 February
5-12 September 1910 (fr), N.L. Britton, E.G. Britton & 1894 (fl), C.A.M. Lindman 2765 (S); prope rivum Esmeril,
C.S. Gager 7247 (AMES, NY); Pinar del Río to Viñales, in campo uliginoso graminoso, C.A.M. Lindman 2791 ½ (S,
grassy bank, flowers greenish, 12 September 1910 (fl), N.L. spirit). Pará: Marajó, 1877-1878 (fl), Jobert 141 (P, RENZ).
Britton, E.G. Britton & C.S. Gager 7302 (NY); north of La Paraíba: Remígio, terrenos alagados e encapoeirados, flores
Guira, San Diego de los Baños, 26 August 1914 (fl), B. León branco-creme, segmentos vegetativos verdes, 13 September
4585 (NY); Pinar del Río, Sabana de Bacunagua, October 2005 (fl), L.P. Felix 10803 (EAN). Pernambuco: Tapera
1931 (fl, fr), B. León 15061 (US); Sumidero, Savanna del (S. Bento), no pântano (lagoa do cercado), flores branco-
Sumidero, in campis graminosis, October 1823 (fl), Poeppig amarellas, 26 June 1934 (fl), B. Pickel 3615 (IPA, NY, SP);
1845 (G, W, W-R 20324); 1824 (fl), Poeppig s.n. (W); Lagoa do Ouro, 9º08’60”S, 35º28’60”W, 24 August 2013
Poeppig s.n. (W-R 20323); in savannarum regionis humiden (fl), L.P Felix & E.M Almeida 14643 (EAN). Sergipe:
locis uliginosis,flor albo, Poeppig s.n. (W-R 20322); campi Japaratuba, beira de rodovia pavimentada, campo limpo
inundati, Poeppig s.n. (P 386869); North of [Consolacion] encharcado (brejo), ao lado de um filete d água, relevo
del Sur, savana, 23 August 1924 (fl), J.T. Roíg y Mesa & plano, conspícuas, se destacando no campo, flores alvo-
M.A. Chrysler 3263 (NY); west of Guane along the Mantua esverdeadas, 23 July 2005 (fl), J.F.B. Pastore 1452 (BHCB).
road, palm barren, moist grassy places, 25 November 1911 Tocantins: Araguaçu, 18-20 km após Araguaçu, na estrada
(fr), J.A. Shafer 10480 (A, NY); Cuchillas de San Sebastian, para Alvorada, nas bordas de mata ciliar úmida com campo
vicinity of Sumidero, siliceous formation, grassy hillside, úmido adjacente, 16 February 1997 (fl), J.A.N. Batista et al.
fls. greenish-white, 9 August 1912 (fl), J.A. Shaffer & B. 683 (CEN).
León 13714 (A, BM, NY); Cuchillas de San Sebastian,
vicinity of Sumidero, top of Cuchillas, flower greenish- Taxonomic notes: Poeppig collected several specimens
white, 9 August 1912 (fl), J.A. Shaffer & B. León 13718 of H. bicornis in Cuba. The holotype in K is labeled
(NY). Villa Clara: Santa Clara, Banks of Lagoon Haití, just ‘Cuba, 1822’. The collection data of the other
Mordazo, 29 December 1915 (fr), B. León & F.R. Cazanás specimens varies from ‘Cuba, Savana del sumidoro,
5924 (NY); Santa Clara, near Manacas, 27 December 1915 October 1823, E.F. Poeppig 1845’ (G 169029, W-R
(fr), B. León & F.R. Cazanás 5966 (NY). GUATEMALA. 20324, W s.n.), to ‘Cuba, 1824’ (W s.n.) or just ‘Cuba’
graminosis uliginosis, August 1870 (fl), G. Bernoulli 922
without any date or collection number (P 386869,
(W-R). HONDURAS. Francisco Morazán: Near Las
Mesas, in chagüite, common, 2 December 1950 (fr), P.C.
W-R 20322, W-R 20323). In a synopsis of New World
Standley 27834 (EAP); near Las Mesas, wet boggy meadow, Habenaria, Batista et al. (2011a) incorrectly cited the
petals greenish-white, 30 August 1948 (fl), L.O. Williams & most complete collection data as the type data and
A. Molina 14712 (EAP). PANAMA. Panamá: Canal Zone, interpreted the specimens in G and P as isotypes.
Some authors have considered H. bidentata Poepp. The genus Habenaria (Orchidaceae) in the Brazilian
ex Steud., a nomen nudum, a synonym of H. bicornis Amazon. Rev. Bras. Bot. 31: 105–134.
(Cogniaux 1909, Galé 1938). However, the name was Batista, J.A.N. & L.B. Bianchetti. 2010. Taxonomy,
distribution and new taxa from the Habenaria crucifera
first published by Sprengel (1826) as a synonym of H.
(section Nudae, Orchidaceae) aggregate from Brazil
alata Hook. Accordingly, there are several collections
and the Guianas. Brittonia 62: 57–79.
from Poeppig at W (W s.n., W-R 43241, W-R 20301, Batista, J.A.N., B.M. Carvalho, A.J. Ramalho & L.B.
W-R 20302) originally identified as H. bidentata Bianchetti. 2010. Three new species of Habenaria
and which are all referable to H. alata. Some authors (Orchidaceae) from Serra da Canastra, Minas Gerais.
have considered H. tricuspis a synonym of H. repens Phytotaxa 13: 27–39.
(Cogniaux 1909, Ames 1910, Galé 1938, León & Batista, J.A.N., L.B. Bianchetti, R. González-Tamayo,
Schweinfurth 1946), but examinations of the type X.M.C. Figueroa & P.J. Cribb. 2011a. A synopsis of
new world Habenaria (Orchidaceae) I. Harvard Pap.
materials in P and W confirmed it as a synonym of H.
Bot.16: 1–47.
bicornis. Habenaria radicans Griseb., from Cuba, was
Batista, J.A.N., L.B. Bianchetti, R. González-Tamayo,
published as a synonym of H. tricuspis (Grisebach X.M.C. Figueroa & P.J. Cribb. 2011b. A synopsis of
1866), but the name is based on the specimen C. Wright new world Habenaria (Orchidaceae) II. Harvard Pap.
3309 (AMES 70164, BM 32525, K), which is H. repens. Bot. 16: 233–273.
Acknowledgments. The authors thank the curators and Batista, J.A.N., K.S. Borges, M.W. Faria, K. Proite, A.J.
staff of the following herbaria for providing digital Ramalho, G.A. Salazar & C. van den Berg. 2013.
images or access to their collections and support Molecular phylogenetics of the species-rich genus
Habenaria (Orchidaceae) in the New World based on
during our visits: A, ALCB, AMES, B, BHCB, BM,
nuclear and plastid DNA sequences. Mol. Phylogenet.
BR, CEN, CEPEC, CESJ, CTES, EAN, EAP, ESA, G, Evol. 67: 95–109.
GH, HB, HBG, HRB, HRCB, HUEFS, IBGE, ICN, Bonfield, J.K., K.F. Smith & R. Staden. 1995. A new DNA
IPA, K, L, LP, M, MBM, MBML, MO, NY, OUPR, sequence assembly program. Nucleic Acids Res. 24:
OXF, P, PMSP, R, RB, RENZ, S, SI, SP, SPF, U, UB, 4992–4999.
UEC, US, W; Gustavo Romero for scanning the image Cabral, J.S., L.P. Felix & M. Guerra. 2006. Heterochromatin
of H. goyazensis published by Kränzlin, Adalberto José diversity and its co-localization with 5S and 45S rDNA
dos Santos for permission and assistance in the use of sites in chromosomes of four Maxillaria species
(Orchidaceae). Genet. Mol. Biol. 29: 659–664.
Leica M205C stereoscopic microscope, Ana Cláudia
Chase, M.W., R.S. Cowan, P.M. Hollingsworth, C. van
Fernandes for translation of the abstract to Spanish, den Berg, S. Madriñán, G. Petersen, O. Seberg, T.
and two anonymous reviewers for improvements Jørgsensen, K.M. Cameron, M. Carine, N. Pedersen,
on the manuscript. JANB acknowledges financial T.A.J. Hedderson, F. Conrad, G.A. Salazar, J.E.
support from Conselho Nacional de Desenvolvimento Richardson, M.L. Hollingsworth, T.G. Barraclough,
Científico e Tecnológico (CNPq), Fundação de Amparo L. Kelly & M. Wilkinson. 2007. A proposal for a
a Pesquisa do Estado de Minas Gerais (FAPEMIG) and standardised protocol to barcode all land plants. Taxon
a scholarship (Pq-2) from CNPq. 56: 295–299.
Cogniaux, A. 1893. Orchidaceae. Habenaria. Pp. 18–102
in: C.F.P. Martius, A.G. Eichler & I. Urban (eds.) Flora
Literature cited Brasiliensis 3(4). München, F. Fleischer.
Ames, O. 1910. The genus Habenaria in North America. Cogniaux, A. 1909. Orchidaceae VII. Habenaria. Pp.
Orchidaceae 4: 1–288. 297–309 in: I. Urban (ed.), Symbolae Antillanae seu
Ames, O. 1922. New or noteworthy orchids from different Fundamenta Florae Indiae Occidentalis. Vol. 6. Leipzig,
parts of the world. Orchidaceae 7: 83–140. F. Borntraeger.
Ames, O. 1928. Orchidaceae. In: P.C. Standley (ed.), Flora Correa, A., D. Mireya, C. Galdames & M.N.S. Stapf.
of the Panama Canal Zone. Contributions from the 2004. Catálogo de las Plantas Vasculares de Panamá.
United States national Herbarium. Vol. 27. Smithsonian Tropical Research Institute, Panama.
Batista, J.A.N., L.B. Bianchetti & E.G. Gonçalves. 2003. An D’Arcy, W.G. 1987. Flora of Panama. Check list and
overlooked new species of Habenaria (Orchidaceae) index. Part I: The introduction and checklist. Missouri
from Central Brazil. Novon 13: 397–402. Botanical Garden. St. Louis, Missouri.
Batista, J.A.N., J.B.F. Silva & L.B. Bianchetti. 2008. D’Emerico, S., D. Pignone, G. Bartolo, S. Pulvirenti, C.
182 LANKESTERIANA
Terrasi, S. Stuto & A. Scrugli. 2005. Karyomorphology, Version 3.1. IUCN Species Survival Commission,
heterochromatin patterns and evolution in the genus Gland.
Ophrys (Orchidaceae). Bot. J. Linn. Soc. 148: 87–99. IUCN Standards and Petitions Subcommittee. 2010.
Dressler, R.L. 1980. Checklist of the orchids of Panama. Guidelines for Using the IUCN Red List Categories
Monographs in Systematic Botany from the Missouri and Criteria. Version 8.1. Prepared by Standards and
Botanical Gardens 4: 1–26. Petitions Subcommittee in March 2010.
Dressler, R.L. 1993. Field guide to the orchids of Costa Rica Kränzlin F. 1892. Beitrage zu einer monographie der
and Panama. New York, Cornell University Press. gattung Habenaria Willd. Engl. Bot. Jahrb. 16: 52–223.
Edgar R.C. 2004. MUSCLE: multiple sequence alignment Kränzlin, F. 1901 Orchidacearum genera et species. Vol. I.
with high accuracy and high throughput. Nucleic Acids Habenaria. Mayer & Müller, Berlin.
Res. 32: 1792–1797. Kränzlin, F. 1911. Beiträge zur orchideenflora Südamerikas.
Erixon P., B. Svennblad, T. Britton & B. Oxelman. 2003. Kongl. Svenska Vetenskapsakad. Handl. 46: 1–105.
Reliability of Bayesian posterior probabilities and Kress W.J., L.M. Prince & K.J. Williams. 2002. The
bootstrap frequencies in phylogenetics. Systematic phylogeny and a new classification of the gingers
Biol. 52: 665–673. (Zingiberaceae): evidence from molecular data. Amer.
Felix L.P. & M. Guerra 1998. Cytological studies on species J. Bot. 89: 1682–1696.
of Habenaria Willd. (Orchidaceae-Orchidoideae) León, H. & C. Schweinfurth. 1946. Familia 2. Orquideas.
occurring in the Northeast of Brazil. Lindleyana 13: In: H. León (ed.) Flora de Cuba. Vol. 1. Contribuciones
224–230. ocasionales del Museo de Historia Natural del Colegio
Felix, L.P. & L.P. Guerra. 1999. Chromosome analysis de La Salle, 8. Habana, Cultural S.A.
in Psygmorchis pusilla (L.) Dodson & Dressler: the Lindley, J. 1830–1840. The genera and species of
smallest chromosome number know in Orchidaceae. orchidaceous plants. J. Ridgways, London.
Caryologia 52: 165–168. Moraes, A.P., I.J. Leitch & A.R. Leitch. 2012. Chromosome
Felix, L.P. & L.P. Guerra. 2005. Basic chromosome numbers studies in Orchidaceae: karyotype divergence in
of terrestrial orchids. Pl. Syst. Evol. 254: 131–148. Neotropical genera in subtribe Maxillariinae. Bot. J.
Felsenstein J. 1985. Confidence limits on phylogenies: an Linn. Soc. 170: 29–39.
approach using the bootstrap. Evolution 39: 783–791. Nylander, J.A.A. 2004. MrModeltest v2. Program
Fitch W.M. 1971. Toward defining the course of evolution: distributed by the author. Evolutionary Biology Centre,
minimum change for a specific tree topology. Syst. Uppsala University.
Zool. 20: 406–416. Pabst, G.F.J. & F. Dungs. 1975. Orchidaceae Brasilienses.
Galé, J.A. 1938. Catálogo descriptivo de las orquideas Vol. 1. Brucke-Verlag Kurt Schmersow, Hildesheim.
cubanas. Bol. Estac. Exp. Agron. Santiago de las Vegas. Pearson, R.G., C.J. Raxworthy, M. Nakamura & A.T.
Vol. 60 Peterson. 2007. Predicting species’ distributions from
Govaerts, R., P. Bernet, K. Kratochvil, G. Gerlach, G. Carr, small numbers of occurrence records: a test case using
P. Alrich, A.M. Pridgeon, J. Pfahl, M.A. Campacci, cryptic geckos in Madagascar. J. Biogeog. 34: 102–117.
D. Holland Baptista, H. Tigges, J. Shaw, P. Cribb, A. Phillips, S.J., R.P. Anderson & R.E. Schapire. 2006.
George, K. Kreuz & J. Wood. 2013. World Checklist of Maximum entropy modeling of species geographic
Orchidaceae. Royal Botanic Gardens, Kew. Available distributions. Ecol. Model. 190: 231–259.
from: http://apps.kew.org/wcsp/ (accessed: 11 July 2013). Pridgeon A.M., P.J. Cribb, M.W. Chase & F.N. Rasmussen
Grisebach, A. 1866. Catalogus plantarum cubensium. G. .2001. Genera orchidacearum, Vol. 2. Orchidoideae,
Engelmann, Leipzig. part 1. Oxford University Press Inc, New York.
Grisebach, A. 1873. Habenaria. Pp. 233 in: F.A. Sauvalle Renz, J. 1992. The genus Habenaria (Orchidaceae) in the
(ed.), Flora Cubana: enumeration nova plantarum Guianas. Candollea 47: 483–512.
cubensium. Havana, La Antilla. Richard, A. 1850. Ophrydeae. Habenaria. Pp. 249–250 in:
Hoehne, F.C. 1940. Orchidaceas. Habenaria. Pp 52–254 D. Ramon de La Sagra (ed.), Historia fisica, politica
in: F.C. Hoehne (ed.) Flora Brasilica 12(1). São Paulo, y natural de la isla de Cuba. Segunda parte. Historia
Secretaria da Agricultura, Indústria e Comércio de São Natural. Tomo XI. Botanica. Paris, A. Bertrand.
Paulo. Ronquist, F., J.P. Huelsenbeck & P. van der Mark. 2005.
Hijmans, R.J., S.E. Cameron, J.L. Parra, P.G. Jones & A. MrBayes: Bayesian Inference of Phylogeny. Program
Jarvis. 2005. Very high resolution interpolated climate distributed by the authors. Available from: http://
surfaces for global land areas. Int. J. Climatol. 25: mrbayes.sourceforge.net/index.php.
1965–1978. Sérgio, C., R. Figueira, D. Draper, R. Menezes & A.J.
IUCN. 2001. IUCN Red List Categories and Criteria, Sousa. 2007. Modelling bryophyte distribution based
on ecological information for extent of occurrence Sun, Y., D.Z. Skinner, G.H. Liang & S.H. Hulbert. 1994.
assessment. Biol. Conserv. 135: 341–351. Phylogenetic analysis of Sorghum and related taxa
Simpson, M.G. 2006. Plant systematics. Elsevier Academic using internal transcribed spacers of nuclear ribosomal
Press, Burlington, San Diego and London. DNA. Theor. Appl. Genet. 89: 26–32.
Snuverink, J.H & L.Y. Th. Westra. 1983. Studies on the Tamura, K., J. Dudley, M. Nei & S. Kumar. 2007. MEGA4:
flora of the Guianas. 3. A survey of Habenaria Willd. Molecular evolutionary genetics analysis (MEGA)
in Suriname (Orchidaceae). Proc. Kon. Nederl. Akad. software version 4.0. Mol. Biol. Evol. 24: 1596–1599.
Wetensch., C, 86(4): 567–594. Whitten, W.M., N.H. Williams & M.W. Chase. 2000.
Souza, L.G.R., O. Crosa, P. Speranza & M. Guerra. Subtribal and generic relationships of Maxillarieae
2012. Cytogenetic and molecular evidence suggest (Orchidaceae) with emphasis on Stanhopeinae:
multiple origins and geographical parthenogenesis Combined molecular evidence. Amer. J. Bot. 87: 1842–
in Nothoscordum gracile (Alliaceae). Ann. Bot. 109: 1856.
987–999. Williams, L.O. 1946. Orchidaceae. Habenaria. Pp. 11–16
Sprengel, C.P.J. 1826. Systema vegetabilium. Editio decima in: R.E. Wood & R.W. Schery (eds.), Flora of Panana.
sexta, vol. 3. Sumtibus Librariae Dieterichianae, Part. 3. fas. 2. Annals of the Missouri Botanical Garden.
Göttingae. Vol. 33(1). Facsimile reprint (1980).
Stearn, W.T. 1992. Botanical Latin. 4o ed. Timber Press, Williams, L.O. 1956. An enumeration of the Orchidaceae of
Portland. Central America, British Honduras and Panama. Ceiba
Swofford, D.L. 2002. PAUP*. Phylogenetic analysis using 5(1): 1–256.
parsimony (*and other methods). Version 4. Sinauer
Associates, Inc., Sunderland.
Appendix. Additional specimens examined of morphological similar species.

Habenaria caldensis. BRAZIL. A. Ghillany s.n. (HB 57918), UEC), 34025a (UB), 35417 (NY), Jobert 87 (P), J. Badini
A. Glaziou 16372 (BR, P, RENZ), A. Macedo 2964 (NY, s.n. (OUPR 9712, 9721, 9726), J. Semir & A.B. Joly 3811
RB, US), 5206 (HB), A.C.D. Munhoz & C.A.N. Martins 91 (SP), 3814 (SP), J. Semir & M. Sazima 4941 (SP, UEC), J.A.
(BHCB), 94 (BHCB), A.C.D. Munhoz et al. 69 (BHCB), 84 Lombardi 4615 (BHCB), J.A.N. Batista 154 (CEN), 250
(BHCB), 157 (BHCB), 165 (BHCB), A. Salino et al. 10863 (CEN), 1828 (BHCB), 2621 (BHCB), 2633 (BHCB), J.A.N.
(BHCB), A.B. Joly et al. 1246 (SP), 1366 (SP), A.F. Regnell Batista & A.R.C. Lemos 1061 (CEN, UEC), J.A.N. Batista &
III 1181 (P, S, US, W), A.J. Sampaio 6706 (BHCB, R), E.R. Pansarin 1139 (CEN), 1156 (CEN, UEC), J.A.N. Batista
6888 (SP, R), A.P. Duarte 7835 (NY, RB), B. Orssich s.n. & K. Proite 987 (CEN), 1021 (CEN), J.A.N. Batista & L.B.
(HB 66528), C.M. Sakuragui et al. in CFCR 15109 (SPF), Bianchetti 396 (CEN), 895 (CEN), 919 (CEN), J.A.N. Batista
D. Zappi et al. 9568 (SPF), E.N. Lughadha & J.R. Pirani et al. 714 (CEN, MBM, SP), 1359 (CEN, SP), 1382 (CEN),
H51022 (K), E. Pereira 8903 (AMES, HB, RB), E. Simonis 1389 (CEN), 1798 (BHCB), 1818 (BHCB), 1900 (BHCB),
& I. Cordeiro in CFCR 4098 (SPF), E.L. Borba 102 (BHCB), 1950 (BHCB), 2405 (BHCB), 2413 (BHCB), 2415 (BHCB),
107 (BHCB), E.P. Heringer & A. Castellanos 6014 (AMES, 2458 (BHCB), 2737 (BHCB), 2794 (BHCB), 2820 (BHCB),
HB), 6074 (UB), 6219 (UB), 6219-A (HB), 6228 (UB), 2856 (BHCB), 2877 (BHCB), 2955 (BHCB), 3120 (BHCB),
22243 (R), E.P. Heringer 6229 (UB), E.R. Pansarin & A.O. 3147 (BHCB), J.R. Pirani et al. 2212 (SPF), 2296 (SPF),
Simões 786 (CEN, UEC), 803 (CEN, UEC), F.C. Hoehne 3963 (SPF), in CFCR 9144 (SPF), L. Damasio s.n. (OUPR
s.n. (SP 4945, SPF 65025), G. Hatschbach & Z. Ahumada 9707, 9708), L.B. Smith et al. 15958 (HB, US), L. Mickeliunas
31572 (MBM), G. Hatschbach & J. Cordeiro 51837b & E.R. Pansarin 03 (CEN, UEC), 15 (CEN, UEC), 34 (CEN,
(MBM), G. Hatschbach et al. 28748 (HB, MBM, NY, UEC, UEC), L. Th. Dombrowski 7000 (MBM), L.A. Martens 255
US), 36315 (HB, MBM, NY, RENZ), 40828 (MBM), 64355 (SPF), M. Barreto 4870 (BHCB), 4871 (BHCB, SP), 8929
(HBG, MBM), 64355 (BHCB, MBM), G. Martinelli et al. (BHCB, R, SP), M. Magalhães 1100 (BHCB, SP), 1126
11343 (RB), G. Windisch 2582 (HB), G.W.A. Fernandes s.n. (BHCB), M.F.A. Calió et al. 29 (SPF), M.G.L. Wanderley
(BHCB 27951), H.S Irwin et al. 12406 (HB, NY), 18782 et al. 577-A (SP), M.M. Arbo et al. 4629 (AMES, K), 5215
(HB, NY, UB), 19899 (AMES, HB, RB, UB), 19993 (AMES, (AMES, SPF), M.S. Werneck 66 (BHCB), M. Sazima 13400
HB, M, NY, RB,UB, US), 20869 (AMES, HB, NY, RB, UB, (UEC), N.L. Menezes et al. 7099 (SP), N.S. Bittencourt Jr.
US), 22045 (UB), 22391 (HB, NY, UB), 22556 (HB, NY, 00/42 (UEC), P.L. Viana s.n. (BHCB 69740), P.L. Vianna
UB), 22701 (UB), 23431 (AMES, HB, NY, RB, UB, US), 577 (BHCB), Piliackas et al. 10907 (SPF), R. Mello-Silva
28037 (HB, UB), 32177 (NY, UB), 34025 (HB, HBG, NY, et al. in CFCR 8862 (SPF), 9040 (SPF), R.C. Mota & P.L.

184 LANKESTERIANA
Viana 1704 (BHCB, CEN), 1711 (BHCB), R.C. Mota 1698 167 (PMSP), C.N. de Fraga 609 (MBML), D. Sucre 2522 &
(BHCB, CEN), 1720 (BHCB), 1729 (CEN, BHCB), 2733 Braga 363 (RB), D. Sucre 2292 (NY, RB, US), E.P. Heringer
(BHCB), R.S. Oliveira 276 (CEN, UB), R.S. Oliveira et al. et al. 6332 (IBGE, K), 11078 (HB), 16824 (HB), 18146-A
s.n. (UB), R.W. Windisch 2596 (HB), R.W. Windisch 491 & (IBGE), 18201 (IBGE), E.R. Pansarin & L. Mickeliunas
A. de Ghillany (HB), S. Mayo et al. 7010-A (SP), S. Mayo et 1015 (BHCB, UEC), E. Ule 4006 (HBG), F.C. Hoehne 241
al. 7013 (SP), T.F. Daniel & N. Hensold 2298 (SPF) 2298A (SP), F.H. Caetano s.n. (HRCB), F.R. Nonato 994 (HUEFS),
(SPF), 2315 (BHCB), 2369 (BHCB), V.C. Souza et al. 8226 G. Edwall in CGGSP 3670 (SP), G. Hatschbach 1211
(ESA), W.A. Teixeira s.n. (BHCB 26081), W.R. Anderson et (MBM), G. Hatschbach et al. 13451 (MBM), G.F.J. Pabst
al. 35415 (HB), 35417 (HB, MBM, NY, UB, US), 36098 690 (HB), 928 (HB, NY), 937 (HB, NY), 938 (HB, K), 947
(HB, NY, UB, US). (HB), 964 (HB), 6822 (HB), 7323 (HB), G.J. Shepherd et al.
Habenaria exaltata. BRAZIL. Amadeu 37 (HB, ICN), E. 7451 (UEC), H. Schenck 2346 (BR), J. Vidal 89 (R), J.A.N.
Hassler 8721 (BM), G. Hatschbach 10946 (HB, L, MBM, Batista 1419 (CEN), J.A.N. Batista et al. 77 (CEN), 1471
U), 13773 (MBM), 15962 (HB, MBM), 18323 (MBM), (CEN), 1472 (CEN), J.A.N. Batista & T.R. Peixoto 3273
G.F.J. Pabst 1318 (B, HB, HBG, K, RB, S), J. Dutra 1074 (BHCB), J.A. Jesus & T.S. Santos 404 (CEPEC), Kuhlmann
(ICN, SI, SP), J. Klein 149 (BHCB), J.A.N. Batista et al. 6010 (RB), L. Kollmann 86 (MBML), 2732 (MBML), 2733
2771 (BHCB), 2520 (BHCB), 2798 (BHCB), J.L. Waechter (MBML), L. Kollmann & R.R. Veruloet 2826 (MBML), L.
1976 (ICN), L. Arzivenco 521 (ICN), M. Emmerich 3174 Kollmann et al. 2526 (MBML), L.H. Bailey & E.Z. Bailey
(HB, R), M. Pedron 6 (ICN), P. Jorgensen 4646 (US), 4648 1110 (AMES), M. Mattos s.n. (R 28932, 28954), N.L. Abreu
(S, SI), P.K.H. Dusen 3272 (R, SP, SPF), Z.A. Trinta 1204 et al. 143 (CESJ), O. Handro 2033 (SPF), 2085 (SPF), P.
(HB, HBG, K, L, LP, M). Martuscelli 101 (SP), R. Kautsky 88 (HB), 591 (HB), R.C.
Habenaria rodeiensis. BRAZIL. A.A. Vale et al. 133 (BHCB), Mota 2824 (BHCB), R.F. Campos s.n. (SP 28922), R.M.
A. de Saint-Hilaire B1 854 (P), B2 2201 (P), A. Krapovickas Valadão et al. 67 (ALCB), S.A. Mori et al. 10045 (CEPEC),
& C. L. Cristóbal 33555 (CTES), A. Ruschi 52 (SP), A.C. S. Lima & A.C. Brade 14322 (RB), T. Konno et al. 763 (SP),
Brade 10657 (SP), 11367 (R), 12541 (RB), s.n. (R 28922, T. Jost et al. 364 (HRB), V.C. Souza et al. 3651 (ESA), W.
RB 53103), C. Spannagel 228 (SP), C.M. Izumisawa et al. Boone 366 (MBML), 533 (MBML).

LANKESTERIANA 13(3): 185—206. 2014.
ILLUSTRATIONS AND STUDIES IN NEOTROPICAL ORCHIDACEAE.

THE SPECKLINIA CONDYLATA GROUP (PLEUROTHALLIDINAE)
IN COSTA RICA AND PANAMA
Diego Bogarín1,2,3, Zuleika Serracín2 & Zabdy Samudio2

1
Jardín Botánico Lankester, Universidad de Costa Rica. P.O. Box 302-7050 Cartago, Costa Rica, A.C.
2
Herbario UCH, Universidad Autónoma de Chiriquí, 0427, David, Chiriquí, Panama
3
Author for correspondence: diego.bogarin@ucr.ac.cr
Abstract. Taxonomy of discrete groups of taxa within Pleurothallidinae is critical for a better understanding
of species diversity, evolution and phylogenetics. This paper focuses on the taxonomy and systematics of the
species related to Specklinia condylata in Costa Rica and Panama. The taxonomic history and its phylogenetic
position are discussed. The group is treated as comprising five species, three of them proposed as new to science.
Each taxon is described on the basis of living material and illustrated in a composite plate. Overall distribution,
maps, derivation of name, notes on species ecology, natural variation and diagnostic features are presented for
each taxon. A key to the species and a comparative table is given to aid species identification.
Resumen: La taxonomía de grupos discretos de taxones dentro Pleurothallidinae es fundamental para una mejor
comprensión de la diversidad de especies, evolución y filogenética. Este documento se centra en la taxonomía y
sistemática de las especies relacionadas a Specklinia condylata en Costa Rica y Panamá. Se discute su historia
taxonómica y posición filogenética. El grupo comprende cinco especies, tres de ellas se proponen como nuevas
para la ciencia. Cada taxón se describe con base en material vivo y se ilustra en una lámina compuesta. Para
cada taxón se presenta la distribución general, mapas, derivación del nombre, notas sobre ecología, variación
natural y características diagnósticas. Se proporciona una clave para las especies y un cuadro comparativo para
ayudar a la identificación de especies.
Key words / Palabras clave: new species, Platystele, Sarcinula, Scaphosepalum, taxonomy
Lindley (1830) established Specklinia Lindl. Luer (1986) followed Garay in considering those
to include five species close to Pleurothallis R. species under a broad concept of Pleurothallis and
Br. Lindley did not choose a type for the genus. In created in addition two new subgenera: Empusella
Folia Orchidacea, Lindley (1859) himself decided Luer and Pseudoctomeria Kraenzl. (Luer) and
to merge the poorly defined group of about a dozen sections Muscariae Luer and Tribuloides Luer.
species contained in Specklinia into a broad concept Species of Specklinia remained in Pleurothallis
of Pleurothallis. More than a century later, Garay until Pridgeon & Chase (2001) assessed the
& Sweet (1972) designated the orange-flowered S. monophyly of Pleurothallidinae. In one of the most
lanceola (Sw.) Lindl. (=Epidendrum lanceola Sw.) parsimonious trees of the complete ITS nrDNA
as the lectotype of Specklinia. Then, Garay (1974) matrix, they found that S. lanceola belongs to a
determined to treat Specklinia under Pleurothallis clade (treated as Scaphosepalum clade or Clade F)
s.l. and proposed to classify the group under encompassing the species of subgenera Specklinia
Pleurothallis subgenus Specklinia (Lindl.) Garay. (sect. Hymenodanthe Barb.Rodr., Muscariae and
* This contribution was prepared as part of the special edition of Lankesteriana aimed to celebrate Lankester Botanical
Garden´s (JBL) 40th anniversary.
186 LANKESTERIANA
Tribuloides), Empusella and Pseudoctomeria, The Specklinia condylata Group. The first plant to
together with the traditionally accepted genera be known of this group was collected by Augustus
Acostaea Schltr., Dryadella Luer, Platystele Schltr. R. Endrés in the Pacific watershed of Cordillera de
and Scaphosepalum Pfitzer. Pridgeon & Chase (2001) Talamanca in the locality of “Boca de Dota, towards
and Luer (2006) published numerous transfers to Cerro Pito” in Costa Rica. He depicted the plant in a
Specklinia, making the genus large and difficult to fine drawing accompanied with a detailed description,
define morphologically. Luer (2006) regarded the however the species was never published (W-
new circumscription of Pridgeon & Chase (2001) as 0020241). Luer (1976) described the same species as
a polyphyletic aggregation of many taxa. Instead, he Pleurothallis condylata based on a plant collected in
proposed to split Specklinia into 13 genera: the five western Panama around San Vicente de La Concepción,
major groups of Muscarella Luer, Pabstiella Brieger Chiriquí at 500 m of elevation. Luer (1976) compared
& Senghas, Panmorphia Luer, Sarcinula Luer and the plant with P. brighamii S. Watson and its allies
Specklinia; the smaller groups of Phloeophila however the flower was described as comparatively
Hoehne & Schltr., Ronaldella Luer, Sylphia Luer and larger, with yellow sepals and petals and dispersed
Tribulago Luer; and four other monospecific genera purple-red dots or speckles. The purple, cuneate lip
created for the rest of the morphologically “aberrant” had the apex folded or decurved, appearing truncate.
species Luer (2006). Luer (2006) also suggested a close relationship with
Different interpretations of the morphologic and S. areldii (Luer) Pridgeon & M.W.Chase from western
phylogenetic evidence make Specklinia difficult Panama, a species with obovate, wider leaves, which
to define. Almost 500 binomials attributed to the we exclude from the S. condylata group because the
genus have been published but the exact number of acuminate sepals and the oblong lip, features that
species is still hard to calculate and it depends on resemble more the flowers of S. acrisepala (Ames &
the acceptance and definition of the groups within C. Schweinf.) Pridgeon & M.W. Chase.
the clades (Pupulin et al. 2012). When Pridgeon & In general, plant morphology is fairly uniform
Chase (2001) redefined the genus, they recognized 86 and it is almost imposible to identify a specimen
species. In Pridgeon (2005), Specklinia was treated as without flowers [even other closely allied species
comprising some 200 species, ranging from Mexico are quite similar when they are not in bloom i.e: S.
and the West Indies to Brazil and Bolivia. acrisepala and S. brighamii (S.Watson) Pridgeon &
Specklinia is still variable in terms of vegetative M.W.Chase]. The separation among species is largely
and floral morphology, however the genus can be based on floral characters and/or the sum of a set of
recognized by the caespitose small plants with differences. Although, the group can be characterized
ramicauls shorter than the leaves, an abbreviated stem mainly by the caespitose plants to 5.0-8.5 cm tall, with
with an annulus, the leaves erect, elliptic, obovate or ramicauls enclosed by two tubular sheaths at base, the
orbicular, coriaceous, the sepals and petals mostly elliptic, oblong or obovate, coriaceous, conduplicate
acute or obtuse, membranous, the lateral sepals leaves, narrowing into a short petiole, the racemose
variously connate, the petals oblong-spatulate, acute inflorescences developed into a filiform peduncle with
or obtuse and the lip is hinged to the column foot. the rachis congested appearing fasciculate and the
The column is winged, terete or clavate, with an erose imbricate floral bracts covering the persistent pedicels
or toothed clinandrium. The anther and stigma are forming like a mass of old bracts and pedicels. The
ventral. The pollinarium is made up by two pollinia, flowers are produced successively and singly; the
free or lightly adherent to minute viscidia (Bogarín et sepals and petals are entire, smooth, acute or obtuse,
al. 2013, Luer 2006, Pupulin et al. 2012, Pridgeon et tailless, frequently speckled, maculate or stained;
al. 2005). the lateral sepals are connate at the base, sometimes
This paper is focused on a group of Specklinia shallowly so, often forming a synsepal; and the petals
that comprises the species close to S. condylata widen towards the middle. The lip is oblong, spatulate
(Luer) Pridgeon & M.W.Chase. Here, it is informally or pandurate, always mostly purple, arcuate, entire,
treated as S. condylata group. denticulate or erose, sulcate with a pair of longitudinal,
Bogarín et al. —The Specklinia condylata Group 187
parallel, apically convergent keels running up to the and a “fascicle” of pedicels forming a extremely
apex, basally glandular-trichomate, glutinose from the congested raceme. The sepals are tailless and
base towards the apex and between the calli on the variously connate and the petals are acute or obtuse,
median groove, hinged to the column foot. The apex is widened towards the middle and always entire. Some
acute or obtuse but can be often curved downward so species of Muscarella and Panmorphia also share
appearing retuse or emarginate. The column is arcuate, the “fasciculate” congested raceme however the
toothed and erose at apex. The anther and stigma are acuminate or tailed, fringed, denticulate or fimbriate
ventral and the pollinarium is made up by a pair of sepals and shape of the lip distinguish them from
free, ovoid pollinia ending in a small hook at the base. Sarcinula (Luer 2006). Nevertheless, as proposed by
The plants treated in this study are restricted to the Luer (2006), Sarcinula is polyphyletic and certainly
tropical moist and wet forest from the central Pacific includes several species embedded within the type
in Costa Rica towards western Panama at elevations clade of Specklinia, as found by Pupulin et al. (2012).
between 300-1640 m (mostly between 300-600 m). Among them are the “orange-flowered” Specklinia
They are somewhat common and can be found along barbae (Schltr.) Luer, S. chontalensis (A.H.Heller
streams and rivers in warm, humid areas in gallery & A.D.Hawkes) Luer, S. corniculata (Sw.) Steud.,
forest, edges of primary forest or disturbed vegetation S. fulgens (Rchb.f.) Pridgeon & M.W.Chase, S.
(Luer 2003). They mostly flower through the year. guanacastensis (Ames & C.Schweinf.) Pridgeon &
Potential pollinators have not been observed. The M.W.Chase and S. psichion (Luer) Luer. The type
flowers produce a foetid, carrion-like smell in S. clade also encompasses: S. lentiginosa (F. Lehm. &
berolinensis, perhaps attracting flies. Kraenzl.) Pridgeon & M.W. Chase, S. tribuloides (Sw.)
Pridgeon et al. (2001) evaluated the phylogenetic Pridgeon & M.W.Chase and S. endotrachys (Rchb.f.)
position of S. brighamii and S. condylata. In one Pridgeon & M.W.Chase and its allies (Pupulin et al.
of the most parsimonious trees of the ITS nrDNA, 2012). The type of Sarcinula, Specklinia acicularis
both species were grouped into a subclade sister to (Ames & C. Schweinf.) Pridgeon & M.W. Chase, has
Platystele and Scaphosepalum. The previous subclade not been yet evaluated phylogenetically, however it is
is sister to another subclade comprising the species morphologically different from the species allied to
allied to S. lanceola, the type of Specklinia. However, S. brighamii-condylata as it has thick, acicular leaves
the position of S. brighamii-condylata as sister to (vs. oblong-elliptic, conduplicate) and the sepals are
Platystele and Scaphosepalum is weakly supported cellular-glandular, spiculate within (vs. glabrous).
(equally weighted bootstrap percentages < %50) in the The phylogenetic position of S. brighamii-
ITS nrDNA analysis. Thus, the subclade S. brighamii- condylata group is still subject of evaluation.
condylata is absent in the strict consensus tree from Preliminary evidence presented in Bogarín et al.
the combined matK/trnL-F/ITS nrDNA data set. In (2013) showed both species in a subclade basal to
that combined analysis, the type clade of Specklinia Specklinia s.s. The Specklinia clade which includes S.
is sister to the Scaphosepalum-Platystele clade with lanceola and its allies, S. absurda Bogarín, Karremans
95% support. Although the position of S. brighamii- & R.Rincón, S. fuegii (Rchb.f.) Solano & Soto Arenas,
condylata is not clear in Pridgeon & Chase (2001), [=Sylphia fuegii (Rchb.f.) Luer], S. grobyi (Bateman
they decided to transfer both species and their allies ex Lindl.) F. Barros, S. picta (Lindl.) Pridgeon &
into Specklinia. M.W. Chase and S. costaricensis (Rolfe) Pridgeon
Luer (2002) considered that Specklinia as & M.W. Chase is again sister to the Scaphosepalum-
proposed by Pridgeon & Chase (2001) is still Platystele clade (Bogarín et al. 2013, Pupulin et al.
polyphyletic and suggested retaining the species 2012, Pridgeon et al. 2001). Species closely allied
in Pleurothallis. Later, Luer (2006) proposed to to the S. condylata group include at least: Specklinia
classify S. condylata, along with 24 other species, acrisepala, S. alexii (A.H. Heller) Pridgeon & M.W.
in Sarcinula, a genus characterized by the caespitose Chase, S. areldii, S. brighamii, S. calderae (Luer)
plants (similar to many others), elongated peduncles Luer, S. scolopax (Luer & R. Escobar) Pridgeon &
with a succession of overlapping floral bracts M.W. Chase and S. simmleriana (Rendle) Luer.
188 LANKESTERIANA
A solid taxonomic basis is critical for phylogenetic of the type specimen with living material and to assess its
evaluations. This paper is part of a series of natural variation. The plants gathered were documented
contributions on the taxonomy of discrete groups of by pictures and ink drawings following the procedures
taxa within Specklinia s.l., and other allied genera, already described and deposited at UCH.
intended for a better understanding of species diversity
within clades and future phylogenetic evaluations. Taxonomic treatment
Here, we clarify the taxonomy of the S. condylata
Specklinia acoana Bogarín, sp. nov.
group. Fieldwork activities in Costa Rica and Panama
led to the discovery of three new species allied to S. TYPE: Costa Rica. San José: Pérez Zeledón, Platanares,
condylata that are here described and illustrated. near Villa Argentina, ca. 9°10’47”N 83°38’57”W,
Additional data related to S. vierlingii Baumbach are 950 m, recolectada por Jeremy Quesada, floreció
provided and discussed. Data on distribution, habitat en cultivo en el vivero de orquídeas de Gerson
and ecology, etymology, phenology and variation Villalobos en San Miguel de Santo Domino
among populations are given for each species. A key de Heredia, 27 octubre 2011, D. Bogarín 9352
to the species and a comparative table is given to aid (holotype, JBL). Figs. 1, 2a, 2b, 3, 4a.
species identification.
The combination of whitish flowers with dispersed
stains and blotches on the sepals and petals; the
Materials and Methods. This study was performed at
spatulate, minutely denticulate lip, less than 5 mm
Jardín Botánico Lankester (JBL) and the Herbario UCH
long; and the connate sepals to 5 mm forming a
of the Universidad Autónoma de Chiriquí, Panamá.
concave synsepal to 12.0 x 7.0 mm distinguish S.
Sketches and images were prepared from living
acoana from its close allies.
specimens with a Leica® MZ 9.5 stereomicroscope
with drawing tube, Nikon® D5100 digital camera Epiphytic, caespitose herb, up to 8.5 cm tall. Roots
with a AF-S VR Micro-NIKKOR 105mm f/2.8G IF- slender, flexuous, to 0.5 mm in diameter. Ramicauls
ED lens and Epson Perfection Photo Scanner V600. slender, erect, 5-6 mm long, enclosed by 2 tubular
Composite plates were diagrammed as consistently sheaths up to 1 cm long. Leaves narrowly elliptic
as possible to facilitate species comparison by using to obovate thick, coriaceous, acute, conduplicate,
Adobe Photoshop®. Ink drawings were prepared in emarginate, with a short apiculus, 2.7-7.5 × 0.8-1.2 cm,
smooth Fabriano® paper of 240 g/m2 with a Rotring® cuneate, the base narrowing into an indistinct petiole
Rapidograph 0.1mm using black capillary cartridges less than 1 cm long. Inflorescence racemose, distichous,
and traced in Artograph LightPad® A920. Specimens at glabrous, patent, erect or suberect, successively single-
JBL (from living and spirit collections), and dried and flowered, born by a slender filiform peduncle, the rachis
spirit material available at CR, INB, JBL, L, UCH and congested, appearing fasciculate, shorter than the
USJ were reviewed. The new species were illustrated leaves, up to 3.7 cm long, peduncle up to 3.3 cm long,
from living specimens. Phenological data were recorded rachis up to 0.4 cm long. Floral bracts ovate, acute,
in the field, herbarium labels and from cultivated conduplicate, membranaceous, tubular, imbricating,
specimens. Ecological zones were estimated by using up to 3 mm long. Pedicel 5 mm long, persistent. Ovary
the Holdridge Life Zone System (Holdridge 1987) and to 2 mm long, glabrous, green. Flowers the sepals and
the Mapa Ecológico de Costa Rica by Bolaños et al. petals whitish-yellowish with purple-red stains, the lip
(2005). The map and georeferences for specimens were purple, the column greenish with purple stains, anther
obtained by using a Garmin eTrex Vista GPS, Google cap reddish. Dorsal sepal ovate-elliptic, acute, entire,
Earth 6.1.0 © and the Epidendra (www.epidendra.org) concave, 3-veined, dorsally keeled, connate to the
database. The identity of S. condylata was studied by lateral sepals for about 2 mm, 11 × 5 mm. Lateral sepals
interpreting electronic images of the holotype of S. oblong, acute, connate for 5 mm, forming a mentum
condylata available at SEL and Epidendra together with at base, 3-veined, dorsally keeled, 12 × 7 mm. Petals
the protologue (Luer 1976). A visit to the type locality oblique, ovate-lanceolate, cuneate, acute, 3-veined, 4.1
was organized in order to complement the interpretation × 2.6 mm. Lip spatulate, obovate, basally unguiculate,
Figure 1. Specklinia acoana Bogarín. A – Habit. B – Flower. C – Perianth, flattened. D – Column and lip, side view.
E – Column. F – Pollinarium and anther cap. Drawn from the holotype by D. Bogarín and D. Solano.

190 LANKESTERIANA
Figure 2. Flower morphology of: A. Specklinia acoana (D. Bogarín 9352). B. Specklinia acoana (JBL-11957). C. Specklinia
berolinensis (F. Pupulin 2325). D. Specklinia berolinensis (A. Karremans 5807). E. Specklinia condylata (D. Bogarín
10364). F. Specklinia condylata (D. Bogarín 7855). G. Specklinia icterina (D. Bogarín 8767). H. Specklinia vierlingii
(F. Pupulin 2894). I. Specklinia vierlingii (D. Bogarín 7350).
with a pair of small lobules at the middle, adnate to viscidium, ending in a hook. Anther cap cucullate,
the column foot, slightly erose, arcuate, obtuse, with white, stained with purple.
two longitudinal, parallel, apically convergent keels
Distribution: endemic to the southern Pacific of Costa
running up to the apex, sulcate, basally glutinose from
Rica (Fig. 3).
the base towards the apex between the calli, 5.0 × 2.2
mm, the apex obtuse but often curved downward so Habitat and ecology: epiphytic in tropical moist
appearing retuse. Column cylindric, footed, to 5.2 mm forest, tropical moist forest premontane belt transition
long, erose, the anther and stigma ventral, greenish in secondary and primary vegetation at around 500-
stained with purple. Pollinia two, ovoid, without 800 m of elevation.
Etymology: named after Asociación Costarricense de condylata, however the latter has yellowish flowers
Orquideología (A.C.O) founded in 1970 by a group with dispersed speckles on the sepals and petals (vs.
of orchid enthusiasts led by Miguel Angel Ramírez, whitish with blotches and stains) and the lip is longer,
Dorothy Lankester, Rafael Lucas Rodríguez Caballero, >7.5 mm long and wider > 3.0 mm (vs. ~5.0 mm long,
Roy Lent and Margarita de Lent among others <2.2 mm wide), pandurate (vs. spatulate to oblong)
with the support of the Latin-American Committee and the callus is made up by two prominent whitish-
of Orchidology and Helena Baraya de Ospina, yellowish cushions at the middle (vs. two purple low
former President of the Sociedad Colombiana de keels) (Fig. 4a). For a detailed comparison among its
Orquideología. A.C.O’s efforts through Rafael Lucas allies see Table 1.
Rodríguez were crucial to save the orchid garden of
Additional material examined: Costa Rica. San José:
Charles H. Lankester at “El Silvestre” that was later
Pérez Zeledón, Rivas, brought to Jardín Botánico
transferred to the University of Costa Rica on March
Lankester by D. Jiménez s.n., June 26, 2012 (JBL-
2, 1973.
spirit). Without locality data, flowered in cultivation at
Phenology: plants flower through the year but mostly Jardín Botánico Lankester, Universidad de Costa Rica,
from October to November. October 31, 2009, JBL-11957 (JBL-spirit) (Fig. 2b).
The combination of whitish flowers with dispersed

Specklinia berolinensis Bogarín, sp. nov.
stains and blotches on the sepals and petals; the
spatulate, minutely denticulate lip, 5 mm long; TYPE: Costa Rica. San José: Pérez Zeledón, San
and the sepals connate to 5 mm forming a concave Ramón Norte, trail to the summit of Cerro Pelón,
synsepal to 12.0 x 7.0 mm distinguish S. acoana from 1420-1640 m, secondary mature and primary lower
other members of the group. It is most similar to S. montane moist forest, 3 May 2000, F. Pupulin 2325,
Figure 3. Geographic distribution of Specklinia acoana, Specklinia berolinensis and Specklinia icterina.

Table 1. Comparison of the main differences among the species of S. condylata group.
192
Character S. acoana S. berolinensis S. condylata S. icterina S. vierlingii
Ovary green spotted with red spotted with red green spotted with red
Dorsal sepal ovate-elliptic, 11 x 5 mm ovate, 8.0 x 4.5 mm oblong-elliptic, 12.0-16.0 x 3.3- ovate, 13.5 x 4.5 mm oblong, 12.0-14.0 x 5.0-5.5 mm
6.0 mm
Lateral sepals 12 x 7 mm, oblong, connate oblong, 9.4 x 6.3 mm, oblong-ovate, 12-17 x 4-8 mm, ovate, 14.5 x 8.5 mm, connate oblong-ovate, 12-14 x 6-7 mm,
to 5 mm connate 1.5 mm connate 5-9 mm or sometimes to 5 mm connate to 6.5 mm
almost free
Petals ovate-lanceolate, 4.1 x 2.6 oblong-obovate, 3.5 x 1.7 obovate-lanceolate, 4.5-5.0 x obovate, 4.5 x 2.0 mm narrowly oblong, 4.0-5.0 x 1.0-
mm mm 2.0-3.0 mm 1.5 mm
Lip spatulate to oblong, minutely spatulate, entire, 4.5-5.0 x pandurate, denticulate, 7.5-8.0 x oblong, minutely denticulate, pandurate, erose, 8.0-10.0 x
denticulate, 5.0 x 2.2 mm 1.7-2.0 mm 3.0-3.5 cm 5.0 x 2.5 mm 3.5-4.0 mm
often with the apex folded the apex never folding often with the apex folded often with the apex folded rarely with the apex folded
Lip apex

Lip color purple purple purple basally yellowish, apically purple
purple
LANKESTERIANA
Column greenish-yellowish, greenish-yellowish, 6.0 mm greenish-yellowish, 9 mm greenish, immaculate 5.4 mm greenish-yellowish, 12 mm

maculate, 5.2 mm
Flower color whitish with dispersed yellowish with blotches and yellowish with many dispersed yellow, immaculate yellowish-cream with purple
blotches and stains along stains along the veins of red-purple speckles along sepals speckles and blotches and
sepals and petals sepals and petals and petals sometimes with the veins purple
Habitat
Elevation (m) 500-800 1420 to 1640 200 to 600 see Habitat and 500 to 920 300 to 650
ecology for S. condylata
Life Zone tropical moist forest, tropical premontane wet forest tropical wet forest premontane wet forest, rain tropical wet forest, tropical moist
moist forest premontane belt forest transition and tropical forest premontane belt transition
transition wet forest premontane belt and tropical moist forest
transition
Figure 4. Comparison of lips (front view): A. Specklinia acoana (D. Bogarín 9352). B. Specklinia berolinensis (F. Pupulin
2325). C. Specklinia icterina (D. Bogarín 8767). D. Specklinia condylata (D. Bogarín 10364). E. Specklinia condylata
(D. Bogarín 7855). F. Specklinia vierlingii (F. Pupulin 2894). Scale bar = 5 mm.
L. Spadari, J. Cambronero, V. Juárez-Pérez & K. green spotted with red. Flowers hyaline, whitish or
Granado (holotype, JBL). Figs. 2c, 2d, 3, 4b, 5. greenish, the sepals stained with purple red along the
veins with few dispersed purple dots in between, the
Specklinia berolinensis is distinguished by the
dorsal sepal adaxially striped with purple, the petals
yellowish flowers with purple blotches, stains and
yellowish with purple stripes and purple apex, the lip
stripes along the veins of the sepals and petals, the
purple, the column greenish-yellow with purple red
smaller sepals < 3.5 mm long, the dorsal sepal < 8
stripes along the margin. Dorsal sepal ovate, acute,
mm long and lateral sepals < 9.5 mm long, the lateral
entire, reflexed, concave, 3-veined, dorsally keeled,
sepals almost free and not developing an evident
connate to the lateral sepals for about 1.5 mm, 8.0 ×
synsepal and the entire lip with rounded apex, never
4.5 mm. Lateral sepals oblong, acute, connate for 1.5
folding or curved down apically.
mm, forming a mentum at base, 3-veined, dorsally
Epiphytic, caespitose, pendent or suberect herb, keeled, 9.4 × 6.3 mm. Petals oblique, oblong-obovate,
up to 8 cm tall. Roots slender, flexuous, to 0.5 mm cuneate, acute, 3-veined, 3.5 × 1.7 mm. Lip spatulate,
in diameter. Ramicauls slender, erect, terete, to 7 mm oblong-obovate, basally unguiculate, with a pair of
long, enclosed by 2 tubular sheaths up to 1 cm long. small lobules at the middle, adnate to the column
Leaves narrowly obovate thick, coriaceous, acute, foot, entire, arcuate, rounded, with two longitudinal,
conduplicate, emarginate, with a short apiculus, 3.5- parallel, apically convergent keels running up to the
8.0 × 0.6-0.9 cm, cuneate, the base narrowing into a apex, sulcate, basally glutinose from the base towards
indistinct petiole less than 4 mm long. Inflorescence the apex between the keels, 4.5-5.0 × 1.7-2.0 mm.
racemose, distichous, glabrous, patent or creeping Column cylindrical, footed, to 6 mm long, with a
down, successively single-flowered, producing one pair of apical arms, erose, the anther and the stigma
flower at once, born by a slender filiform peduncle; ventral, greenish stained with purple. Pollinia two,
peduncle bracts tubular to 3 mm long, the rachis ovoid, without viscidium, ending in a hook. Anther cap
congested appearing fasciculate, up to 6.5 cm long, cucullate, white, stained with purple.
peduncle 3-4 cm long, rachis up to 1.5 cm long.
Floral bracts tubular, apiculate, conduplicate, Distribution: restricted to the type locality at Berlín de
membranaceous, imbricating, up to 4 mm long. Pedicel Páramo de Pérez Zeledón, San José in the neighbouring
5 mm long, persistent. Ovary to 2 mm long, glabrous, areas of Fila Temblor, Fila Zapotales, Cerro Pelón and
194 LANKESTERIANA
Figure 5. Specklinia berolinensis Bogarín. A – Habit. B – Flower. C – Perianth, flattened. D – Column and lip, side view.
E – Column. F – Pollinarium and anther cap. Drawn from the holotype by D. Bogarín and D. Solano.
the headwaters of río División in the Pacific watershed we accept S. condylata as a species ranging from the
of Cordillera de Talamanca in Costa Rica. (Fig. 3). central Pacific of Costa Rica towards western Panama.
This species shows variation in size of the flowers, the
Habitat and ecology: epiphytic in premontane wet
lip apex and coloration (see Table 1 and discussion of
forest along the edge of primary forest in trunks with
S. condylata). However this variation does not overlap
mosses from 1420 to 1640 m of elevation.
with the features observed in S. berolinensis. The color
Etymology: named after the locality of Berlín de Pérez and size of the flowers of S. berolinensis are consistent
Zeledón, San José where this species is restricted. among the populations studied. Those features were
not observed in the variation range of any of the
Phenology: plants flower through the year but mostly
populations of S. condylata.
from August to November.
Additional material examined: Costa Rica. San José:
Compared to its allies, S. berolinensis is
Pérez Zeledón, San Ramón Norte, trail to the summit
distinguished by the yellowish flowers with purple of Cerro Pelón, 1420-1640 m, secondary mature and
blotches, stains and stripes along the veins of the sepals primary lower montane moist forest, 3 May 2000, F.
and petals (vs. dispersed speckles or blotches); the Pupulin 2326, L. Spadari, J. Cambronero, V. Juárez-
smaller sepals < 3.5 mm long (vs. > 4 mm) (see Table Pérez & K. Granado (JBL-spirit). San José: Pérez
1); the dorsal sepal < 8 mm long (vs. > 11 mm) and Zeledón, Berlín, A. Quesada-Chanto s.n. (JBL-
lateral sepals < 9.5 mm long (vs. > 12 mm); the lateral spirit). Pérez Zeledón, Páramo, Berlín, Purruja, Fila
sepals almost free (connate for about 1.5 mm) and not Temblor, ca. 2 km al noroeste de Berlín, 9°26’13.22”N
developing an evident synsepal (vs. connate > 5 mm, 83°46’41.97”W, 1429 m, bosque pluvial premontano,
developing an evident synsepal) and the entire lip, with en bosque secundario, 21 marzo 2013, A.Karremans
rounded apex, never folding or curved down apically 5807 & D. Bogarín (JBL-spirit) (Fig. 2D).
(vs. denticulate or erose, acute or obtuse and folding
apically) (Fig. 4B). The inflorescences are patent but Specklinia condylata (Luer) Pridgeon & M.W. Chase,
sometimes they are creeping down, prostrate on the Lindleyana 16(4): 257. 2001. Pleurothallis condylata
substrate, just curving up when the first bud is mature. Luer, Selbyana 3(1-2): 80-81, f. 143. 1976. Sarcinula
Specklinia berolinensis is found at higher elevations condylata (Luer) Luer, Monogr. Syst. Bot. Missouri
(between 1420 to 1640 m) in comparison to its allies Bot. Gard 105: 208. 2006.
that have been recorded from lower elevations (< 920
m, mainly between 300-600 m). TYPE: Panama. Chiriqui: epiphytic in trees along
Specklinia berolinensis and S. condylata are quite the stream near San Vicente, alt. 500 m., between
different species separated mainly by the size and color Concepción and Volcán, 11 Sept 1976, C. Luer &
of the flowers which are yellowish with blotches and H. Butcher 1198 (holotype, SEL). Figs. 2e, 2f, 4d,
stains along the veins of sepals and petals (vs. yellowish 4e, 6, 7, 8, 9, 10.
with many dispersed red-purple speckles along sepals Epiphytic, caespitose, pendent or suberect,
and petals), the spatulate, entire, shorter lip to 4.5-5.0 herb, up to 8 cm tall. Roots slender, flexuous, to 0.5
× 1.7-2.0 mm (vs. pandurate, denticulate, larger to mm in diameter. Ramicauls slender, erect, 5-8 mm
7.5-8.0 × 3.0-3.5 cm) which never folds apically (vs. long, enclosed by 2 tubular sheaths up to 1 cm long.
folding apically) and without two prominent cushions Leaves narrowly obovate, thick, coriaceous, acute,
at the middle (vs. with prominent whitish-yellowish conduplicate, emarginate, with a short apiculus, 3.5-
cushions at the middle). Flowers of S. berolinensis 8.0 × 0.9-1.2 cm, cuneate, the base narrowing into a
produce a strong carrion-like smell in the afternoon indistinct petiole less than 4 mm long. Inflorescence
and evening similar to that of S. vierlingii but no smell racemose, distichous, glabrous, pendent or suberect,
has been perceived for S. condylata. Plants of both successively single-flowered, producing one flower
species are vegetatively similar but S. berolinensis has at once, born by a slender filiform peduncle; peduncle
narrower leaves < 0.9 cm long whereas S. condylata bracts tubular to 3 mm long, the rachis congested,
has wider leaves > 0.9 cm long and up to 1.2 cm. Here, appearing fasciculate, 3.5-6.0 cm long, peduncle 3.5-
196 LANKESTERIANA
Figure 6. Specklinia condylata (Luer) Pridgeon & M.W.Chase. A – Habit. B – Flower. C – Perianth, flatten. D – Column and
lip, side view. E – Column. F. Pollinarium and anther cap. Drawn by D. Bogarín and D. Solano based on D. Bogarín
et al. 10364 (UCH).
Figure 7. Specklinia condylata (Luer) Pridgeon & M.W.Chase. A – Habit. B – Flower. C – Perianth flattened. D – Column
and lip, side view. E – Column. F – Pollinarium and anther cap. Drawn by D. Bogarín and D. Solano based on D.
Bogarín 7859 (JBL-spirit).

198 LANKESTERIANA
Figure 8. Comparison of the flower morphology of individuals of Specklinia condylata: A. (D. Bogarín 7855, Costa Rica).
B. (M. Fernández 173, Costa Rica). C. (M. Fernández 171, Costa Rica). D. (D. Bogarín 7859, Costa Rica). E. (Z.
Samudio s.n., Panamá). F. (D. Bogarín 10364, Panamá). G. (D. Bogarín 7855, Costa Rica). H. (D. Bogarín 7859, Costa
Rica). I. (M. Fernández 168, Costa Rica).
6.0 cm long, rachis up to 1 cm long. Floral bracts to the lateral sepals for about 2 mm, 12.0-16.0 × 3.3-6.0
tubular, apiculate, conduplicate, membranaceous, mm. Lateral sepals oblong-ovate, acute, connate for
imbricating, up to 2-4 mm long. Pedicel 4-7 mm long, 5-9 mm, forming a mentum at base, 3-veined, dorsally
persistent. Ovary to 3 mm long, glabrous, green or keeled, 12-17 × 4-8 mm. Petals oblique, obovate-
with purple spots. Flowers showy, hyaline, yellowish, lanceolate, cuneate, acute, 3-veined, 4.5-5.0 × 2.0-
sepals and petals densely speckled with purple-brown, 3.0 mm. Lip spatulate, obovate, basally unguiculate,
the lip purple red, the column greenish stained with with a pair of small lobules at the middle, adnate to
maroon. Dorsal sepal oblong-elliptic, acute, entire, the column foot, minutely erose to fimbriate, arcuate,
reflexed, concave, 3-veined, dorsally keeled, connate obtuse, with two longitudinal, parallel, apically
Figure 9. Geographic distribution of Specklinia condylata and Specklinia vierlingii.
convergent keels running up to the apex, forming two type locality of S. icterina however it was not possible
prominent cushions (whitish-yellowish) at the middle, to check both specimens at MO. Although those records
sulcate, basally glutinose from the base towards the seem to considerably extend the elevation range of S.
apex between the calli, 7.5-8.0 × 3.0-3.5 cm, the apex condylata, no other records of this species are known
often curved downward so appearing retuse. Column from 600 to 1800 m. It seems that the locality given
cylindrical, footed, to 9 mm long, with a pair of apical in the specimens of L. Acosta are erroneous or may
arms, erose, the anther and stigma ventral, greenish correspond to a different species. Plants were observed
stained with purple. Pollinia two, ovoid, without growing on Zygia longifolia (Fabaceae) in Panama.
viscidium, ending in a hook. Anther cap cucullate, Etymology: from the Latin condylatus, “with
white, stained with purple. knuckles, or knuckled” and Greek kondylos “knuckle,
Distribution: endemic to the Pacific lowlands of Costa fist”, in allusion to the appearance of the lip of the type
Rica and Panama. specimen.
Habitat and ecology: epiphytic in tropical wet forest Phenology: plants flower through the year but mostly
on trees along streams and rivers, gallery forests and from April to November.
edge of mature vegetation in humid areas of the Pacific Luer (1976) described this species from a
coast from central Costa Rica towards western Panama, collection in western Panama. He stated that the
from 200 to 600 m of elevation Luer (2006) cited two species is vegetatively similar to P. brighamii and its
records of S. condylata from cultivated plants obtained allies, although the flower is considerably larger and
from L. Acosta allegedly from 1500 and 1800 m (one heavier. Luer (1976) characterized the species by the
in a quite odd location above San Cristóbal where no golden sepals and petals which are diffusely dotted
plants of this group have been seen in the field or in any with brownish-purple. The lip is deep purple, broadly
herbaria). The other comes from above San Vito the dilated towards the deflexed apex, appearing truncate
200 LANKESTERIANA
Figure 10. Drawing of Specklinia condylata by A.R. Endrés (W-0020241). Reproduced with the kind permission of the
Herbarium, Naturhistorisches Museum, Wien.
or retuse, giving the appearance of two-knuckled fist than > 7.5 mm long). Lip size is similar between S.
in a gauntlet (Luer 2003). Luer (2006) also suggested condylata and S. vierlingii. Both species present a
a close relationship with S. areldii (Luer) Pridgeon & larger lip (> 7.5 mm long, > 3.0 mm wide) when
M.W.Chase (see introduction). compared to their allies (vs. < 5.0 mm long, < 2.5 mm
Augustus R. Endrés collected and illustrated the wide). Other differences among its closest relatives are
first specimen attributed to this species in Costa Rica, summarized in Table 1.
however it was never published (W-0020241) (Fig. Plants gathered from the type locality in Panama
10). Specklinia condylata is easily distinguished by show variation in the lip apex and coloration (Figs. 8e,
the yellowish sepals densely speckled with purple- 8f). The lip is often deflexed apically but not always and
brown, and the pandurate lip, deep purple or reddish some flowers have a deep purple lip whereas others are
with yellowish calli at the middle. It is most similar to reddish with yellowish calli (Fig. 4d, 4e). However, the
S. vierlingii however the latter species has yellowish- characters cited by Luer (1976) in the protologue were
cream flowers with purple speckles and blotches, also observed in the plants studied from the type locality.
sometimes with the veins purple (vs. yellowish, In Costa Rica, this species is also variable in the colour
densely speckled with purple-brown) and the petals of flowers varying from yellowish to densely speckled
are narrowly oblong, < 1.5 mm wide (vs. obovate- with purple-brown and red to purple lip (Fig. 8). The
lanceolate, > 2 mm wide). Specklinia acoana is also lateral sepals are connate for 9 mm but sometimes they
similar but the latter species has white flowers with are almost free, connate to 5 mm (A.R. Endrés 267, W;
purple stains and the lip is shorter, < 5 mm long (rather M. Fernández 171, JBL). (Figs. 8h, 8e, 8c, 10).
Additional material examined: Costa Rica. San slender, erect, 5-6 mm long, enclosed by 2 tubular
José: Puriscal, Chires, Santa Rosa, Parque Nacional sheaths up to 1 cm long. Leaves narrowly elliptic
La Cangreja, orillas del Río Negro y Quebrada La to obovate thick, coriaceous, acute, conduplicate,
Cangreja, 9°42’02.5” N 84°23’29.9” W, 383 m, bosque emarginate, with a short apiculus, 6.0-7.0 × 1.0-0.8 cm,
muy húmedo tropical, epífitas en árboles caídos, 27 julio cuneate, the base narrowing into a indistinct petiole less
2010, D. Bogarín 7859, R.L. Dressler, M. Fernández & than 1 cm long. Inflorescence racemose, distichous,
C. Smith (JBL) (Figs. 7, 8H). Same locality, D. Bogarín glabrous, patent, erect or suberect, successively single-
7855 (JBL-spirit) (Fig. 8A, 8G), M. Fernández 168 flowered, born by a slender filiform peduncle, the
(Fig. 8I), M. Fernández 171 (Fig. 8C), M. Fernández rachis congested, appearing fasciculate, up to 7.5 cm
173 (JBL-spirit) (Fig. 8B) and M. Fernández 175 long, usually longer than the leaves, peduncle up to
(JBL-spirit). Tarrazú: Boca de Dota [Santa Marta de 5.7 cm long, rachis up to 1.8 cm long. Floral bracts
San Lorenzo de Tarrazú], towards Cerro Pito, Nov- ovate, acute, conduplicate, membranaceous, tubular,
Dec, A.R. Endrés 267 (W) (Fig. 10). Puntarenas: Osa, imbricating, up to 5 mm long. Pedicels to 1 cm long,
Sierpe, El Campo, subiendo por la fila entre Aguabuena persistent. Ovary to 2 mm long, glabrous, green.
y Baneguitas, cuenca superior de Quebrada Banegas, Flowers the sepals and petals yellow, immaculate, the
bajando hasta la Quebrada Digo digo, 8°42’00”N lip yellowish-cream basally, purple red apically, with
83°31’00”W, 350 m, 13 enero 1991, G. Herrera 4818 the callus yellowish, the column green, the anther
(INB). Osa, Sierpe, San Juan, cuenca superior de Río cap white. Dorsal sepal ovate, acute, entire, concave,
San Juan, 8°43’50”N 83°33’10”W, 600 m, epífita, 25 3-veined, dorsally keeled, connate to the lateral sepals
enero 1991, G. Herrera 4871 (INB). Panama. Chiriquí: for about 1.5 mm, 13.5 × 4.5 mm. Lateral sepals
Bugaba, La Estrella, orillas del río Escárrea, cerca de ovate, acute, connate for 5 mm, forming a mentum at
San Vicente, 8°32’01.96”N 82°39’54.4”W, 253 m, base, 3-veined, dorsally keeled, 14.5 × 8.5 mm. Petals
epífitas en Zygia longifolia, 25 julio 2013, D. Bogarín oblique, obovate, cuneate, acute, 3-veined, 4.5 × 2.0
10364, Z. Samudio & Z. Serracín (UCH) (Fig. 6, 8F). mm. Lip oblong, basally unguiculate, adnate to the
Same locality, Z. Samudio s.n., D. Bogarín & Z. Serracín column foot, minutely denticulate, arcuate, obtuse,
(UCH) (Fig. 8E). Chiriquí: sin más datos, obtenida de with two longitudinal, parallel, apically convergent
Finca Drácula, cultivada por Gerson Villalobos en Santo keels running up to the apex, sulcate, basally glutinose
Domingo de Heredia, Costa Rica, 23 enero 2012, D. from the base towards the apex between the calli, 5.0
Bogarín 9452 (JBL-spirit). × 2.5 mm, the apex obtuse but often curved downward
so appearing retuse or emarginate. Column cylindrical,
Specklinia icterina Bogarín, sp. nov. footed, to 5.4 mm long, erose, arcuate, the anther and
stigma ventral, greenish stained with purple. Pollinia
TYPE: Costa Rica. Puntarenas: Coto Brus, Limoncito,
two, ovoid, without viscidium, ending in a hook.
Jabillo, orillas del Río Cotón, ca. 500 m, invenit
Anther cap cucullate, white.
William Chacón, floreció en cultivo en el
Orquidario Happy Garden, 20 abril 2011, D. Distribution: only known from the southern Pacific
Bogarín 8767 (holotype, JBL; isotype CR). Figs. in Costa Rica. It is likely found in Panama as one of
2g, 3, 4c, 11. the localities is about 3 km far away from the frontier.
(Fig. 3).
Specklinia icterina is readily distinguished by the
immaculate yellow, ovate, acute sepals and petals, Habitat and ecology: plants were found growing
the oblong lip with the apex obtuse but often curved epiphytically in premontane wet forest, rain forest
downward so appearing retuse or emarginate, basally transition and tropical wet forest premontane belt
yellowish with purple from the middle towards the transition in secondary and primary vegetation, from
apex, the green immaculate ovary and column and the 500 to 920 m of elevation.
white anther cap. Etymology: from the Latin icterinus or ictericus
Epiphytic, caespitose herb, up to 7.5 cm tall. Roots and from the Greek ikterikos, ἰκτερικός, “jaundice or
slender, flexuous, to 0.5 mm in diameter. Ramicauls jaundiced” in allusion to the yellow coloured flowers.
202 LANKESTERIANA
Figure 11. Specklinia icterina Bogarín. A – Habit. B – Flower. C – Perianth, flattened. D – Column and lip, side view.
E – Column. F. –Pollinarium and anther cap. Drawn from the holotype by D. Bogarín and D. Solano.

Phenology: plants flower through the year but mostly up to 6 cm long, peduncle 4.2-5.2 cm long, rachis
from May to October. up to 1.1 cm long. Floral bracts tubular, apiculate,
conduplicate, membranaceous, imbricating, up to 4
Specklinia icterina is restricted to the premontane
mm long. Pedicels 6 mm long, persistent. Ovary to 3
forest of San Vito, Sabalito and neighbouring areas in
mm long, glabrous, green spotted with red. Flowers
southern Pacific of Costa Rica close to the boundary
showy, yellowish, the sepals stained or speckled with
with Panama. The plant is vegetatively similar to its
purple red from the centre towards the apex, the dorsal
allies however the species is readily distinguished by
sepal adaxially striped with purple, the petals yellow
the immaculate yellow, ovate, acute sepals and petals;
with red purple stripes and purple apex, the lip purple
the oblong lip basally yellowish and purple from the
red, the column greenish-yellow with purple red
middle towards the apex; the green immaculate ovary
stripes. Dorsal sepal oblong, acute, entire, reflexed,
and column; and the white anther cap (Figs. 2g, 11).
slightly arcuate, 3-veined, dorsally keeled, connate to
Frequently the lip apex is curved or folded apically so
the lateral sepals for about 2 mm, 12.0-14.0 × 5.0-5.5
appearing retuse (Fig. 4c). It also happens in S. acoana
mm. Lateral sepals oblong-ovate, acute, connate for
and S. condylata, its close relatives. However, those
6.5 mm into a ovate, acute, basally concave, entire,
species have purple or red brown maculate, speckled
bifid synsepal, forming a mentum at base, 3-veined,
sepals, petals and column. From S. condylata, it also
dorsally keeled, 12-14 × 6-7 mm. Petals narrowly
differs in the oblong, shorter lip up to 5 mm long,
oblong, acute, 4.0-5.0 × 1.0-1.5 mm, subfalcate,
tinged basally with yellow (vs. pandurate, 7.5-8.0
2-veined, with reflexed apex. Lip spatulate, obovate,
mm long, purple). Other differences among its closest
basally unguiculate, with a pair of small lobules
relatives are summarized in Table 1.
at the middle, adnate to the column foot, erose or
Additional material examined: Costa Rica. fimbriate, arcuate, obtuse, with two longitudinal,
Puntarenas: Coto Brus, Sabalito, Miraflores, 8°49’20” parallel, apically convergent keels running up to the
N 82°54’42” W, 923 m, F. Oviedo-Brenes 2537 apex, sulcate, basally papillose and glutinose from
(HLDG). Coto Brus, San Vito, sin más datos, cultivada the base towards the apex between the calli, with the
por Gerson Villalobos en Santo Domingo de Heredia, apex rarely folded, 8.0-10.0 × 3.5-4.0 mm. Column
Costa Rica, 23 enero 2012, D. Bogarín 9453 (JBL- cylindrical, footed, to 1.2 cm long, with a pair of
spirit). apical arms, erose, the anther and stigma ventral, with
purple dots and stripes along the margin. Pollinia two,
Specklinia vierlingii Baumbach, Orchideen (Hamburg) ovoid, without a viscidium, ending in a hook. Anther
63(5): 405–406. 2012. cap cucullate, white, stained with purple.
TYPE: Costa Rica. s.l.; ex cult. hort. Gerhard Vierling; Distribution: only known from central and southern
leg. Norbert Baumbach et Jurgen Roth, 7 August Pacific lowlands in Costa Rica. (Fig. 9)
2012 (holotype, HAL). Figs. 2h, 2i, 9, 12.
Habitat and ecology: epiphytic in tropical wet forest,
Epiphytic, caespitose, pendent or suberect, herb, tropical moist forest premontane belt transition and
up to 6.5 cm tall. Roots slender, flexuous, to 0.5 mm tropical moist forest in secondary and primary forest
in diameter. Ramicauls slender, erect, terete, to 5 mm along humid patches of forest and river banks in the
long, enclosed by 2 tubular sheaths up to 1 cm long. Pacific watershed of Cordillera de Talamanca from
Leaves narrowly obovate, thick, coriaceous, acute, the central Pacific through Valle de El General and
conduplicate, emarginate, with a short apiculus, 2.5- Fila Costeña in Costa Rica between 300 to 650 m of
6.5 × 0.6-1.0 cm, cuneate, the base narrowing into a elevation.
indistinct petiole less than 4 mm long. Inflorescence
Eponymy: named after Gerhard Vierling, who cultivates
racemose, distichous, glabrous, pendent or suberect,
this species in Germany.
successively single-flowered, born by a slender
filiform peduncle; peduncle bracts tubular to 3 mm Phenology: plants flower through the year but mostly
long, the rachis congested appearing fasciculate, from May to November.
204 LANKESTERIANA
Figure 12. Specklinia vierlingii Baumbach. A – Habit. B – Flower. C – Perianth, flattened. D – Column and lip, side view.
E – Column. F – Pollinarium and anther cap. Drawn by D. Bogarín and D. Solano based on F. Pupulin 2894 (JBL-spirit).

This species was published by Baumbach (2012) Castelfranco & L. Elizondo (JBL-spirit). Same
based on a plant collected in Costa Rica and imported locality, F. Pupulin et al 2894 (JBL-spirit) (Fig. 2H,
to Germany. According to the protologue, the plant 12). Pérez Zeledón, Viento Fresco de El Brujo, along
comes from the Botanischer Garten Heidelberg and the Quebrada del Camarón, about 450 m, 9°25’13”N
has been in culture by Gerhard Vierling. The holotype 83°56’27”W, epiphytic in disturbed primary forest,
was deposited outside of the country of origin (HAL). wet premontane forest, 20 January 2001, F. Pupulin
During the preparation of this research, this species 2817, D. Castelfranco & L. Elizondo (JBL-spirit).
was well known by the authors for several localities in Same locality, F. Pupulin et al 2816 (JBL-spirit). San
central and southern Pacific in Costa Rica, where it is Isidro de General, barrio El Hoyón, márgenes del Río
endemic. It is clearly characterized by the yellowish- Pedregoso, 650 m, epífita en troncos musgosos de
cream flowers with purple speckles or blotches, Ficus sp., floreció en setiembre del 2002 en cultivo de
sometimes with purple veins. The most important la familia Valverde Arias, Desamparados, San José,
feature to recognize this species is the narrowly R. Valverde 160 (JBL-spirit). Pérez Zeledón, General,
oblong petals to 4.0-5.0 × 1.0-1.5 mm, unique among Peñas Blancas, orillas del Río Caliente, 9°19’33.0”
its relatives. Baumbach (2012) differentiated S. N 83°37’10.6” W, 629 m, bosque húmedo tropical,
vierlingii from S. condylata by the much bigger flower transición a premontano, en bosque secundario
size and the fimbriate lip. However, we found that remanente a orillas del río, 28 julio 2009, D. Bogarín
floral measurements overlap between S. condylata 7350, J. Cambronero & F. Pupulin (JBL-spirit) (Fig.
and S. vierlingii (Table 1) and the lip is also fimbriate 2I). Pérez Zeledón, R.F. Los Santos, Savegre Abajo,
in both species (see the discussion of S. condylata and Finca de Neftalí Cordero, Fila el Zoncho, 9°27’18.0”
Table 1) (Fig. 4d-4f). N 83°51’09.7” W, 900 m, 11 mayo 1999, A. Estrada
The illustration provided in the protologue by 2185 (CR). Turrubares, Parque Nacional Carara,
Baumbach (2012) is confusing and it mixes features Valle del Tárcoles, Estación Bijagual, 9°45’30” N
of S. condylata. At least, he copied exactly the plant 84°33’10” W, 600 m, 26 julio 1995, M. M. Chavarría
habit from the original drawing of P. condylata by
895 (INB-spirit).
Luer (1976). The drawing shows the same four
leaves, roots and inflorescence that C. Luer drew
Key to the species of Specklinia condylata group
for P. condylata. The flower dissection and the
lateral view of the column and lip were also copied 1. Sepals and petals yellow, immaculate; base of the
with a little modification of the lip apex and petals lip yellowish S. icterina
and they do not represent its real morphology. The 1. Sepals and petals maculate, stained or speckled;
drawing by Baumbach (2012) does not agree with the
base of the lip purple 2
morphology of S. vierlingii as it was exactly copied
2. Lip > 7.5 mm long, > 3.0 mm wide, column
from the drawing of the type of S. condylata (Luer
> 9 mm in length 3
1976).
2. Lip < 5.0 mm long, < 2.5 mm wide, column
This species was intended to be published in
< 6.5 mm in length 4
this paper therefore, we provide the data we had
3. Petals narrowly oblong, < 1.5 mm wide
prepared for its description such as full locality data,
S. vierlingii
distribution map, illustrations and pictures of several
3. Petals obovate-lanceolate, > 2 mm wide
individuals, a composite plate based on a living plant
S. condylata
and a comparison among its closest relatives (Table
4. Flowers whitish with stains and blotches
1) to aid with a proper identification of this species.
dispersed on the sepals, sepals connate
Additional material examined: Costa Rica. San to 5 mm, 12.0 x 7.0 mm S. acoana
José: Pérez Zeledón, El Brujo, road to El Llano, 4. Flowers yellowish with stains and
along the boarder of Río División, 320 m, 9°25’40”N blotches along the veins of the sepals,
83°54’58”W, epiphytic on tall trees along the sepals connate to 1.5 mm, 9.4 x 6.3
river shore, 21 January 2001, F. Pupulin 2823, D. mm S. berolinensis

206 LANKESTERIANA
Acknowledgments. The scientific services of Ministerio para la Agricultura (IICA), San José, Costa Rica, 216 pp.
del Ambiente, Energía (MINAE) and Sistema Nacional Lindley, J. 1830. The genera and species of orchidaceous
de Áreas de Conservación (SINAC) of Costa Rica and plants 8. Asher, London. xvii, 554 pp.
Autoridad Nacional del Ambiente (ANAM) of Panama Lindley, J. 1859. Folia Orchidacea, an enumeration of the
for issuing the scientific permits, under which wild known species of Orchids, 43: Pleurothallis part 2.
specimens were managed. We are indebted to Clotilde 1–46.
Arrocha, Ivonne Oviedo, Franco Pupulin, Rafael Rincón Luer C.A. 1976. Miscellaneous species of Pleurothallis.
and Jorge Warner for their continuous support on the study Selbyana 3(1-2): 38-201.
of orchids in Panama. Darha Solano for finely inking the Luer, C.A. 1986. Systematics of Pleurothallis (Orchidaceae).
illustrations. Daniel Jiménez, Daniel Matamoros, Federico Icones Pleurothallidinarum III. Monogr. Syst. Bot.
Oviedo-Brenes (HLDG), Jeremy Quesada and Gerson Missouri Bot. Gard. 20.
Rodríguez kindly provided data and plant material. Two Luer, C. A. 2002. A systematic method of classification
anonymous reviewers greatly improved the manuscript. of the Pleurothallidinae versus a strictly phylogenetic
This research was enabled by the Project 814-B2-161 method. Selbyana 23(1): 57–110.
“Hacia una moderna flora de orquídeas de Panamá” by Luer, C.A. 2003. Pleurothallis. Pp. 386-452 in: B.E.
JBL and Herbario UCH, supported by the Vice-Presidency Hammel, M.H, Grayum, C. Herrera & N. Zamora
of Research, Universidad de Costa Rica and Universidad (eds.), Manual de Plantas de Costa Rica. Volumen
Autónoma de Chiriquí and “Flora Costaricensis: III: Monocotiledóneas (Orchidaceae-Zingiberaceae).
Taxonomía y Filogenia de la subtribu Pleurothallidinae Monogr. Syst. Bot. Missouri Bot. Gard. 93.
(Orchidaceae) en Costa Rica” (814-BO-052). Luer, C.A. 2006. A reconsideration of Masdevallia.
Systematics of Specklinia and vegetatively similar taxa
Literature cited (Orchidaceae). Icones pleurothallidinarum XXVIII.
Baumbach, N. 2012. Eine neue Specklinia-Art a us Costa Monogr. Syst. Bot. Missouri Bot. Gard. 105.
Rica. Orchideen (Hamburg) 63(5): 404–406. Pridgeon, A.M. 2005. 355. Specklinia. Pp. 402–405 in: A.
Bogarín, D., A.P. Karremans, R. Rincón & B. Gravendeel. M. Pridgeon, P.J. Cribb, M.W. Chase & F.N. Rasmussen
2013. A new Specklinia (Orchidaceae: Pleurothallidinae) (eds.), Genera orchidacearum Vol. IV. Oxford University
from Costa Rica and Panama. Phytotaxa 115(2): 31-41. Press, Oxford, UK.
Bolaños, R., V. Watson & J. Tosi. 2005. Mapa ecológico Pridgeon, A.M. & M.W. Chase. 2001. A phylogenetic
de Costa Rica (Zonas de Vida), según el sistema de reclassification of Pleurothallidinae (Orchidaceae).
clasificación de zonas de vida del mundo de L.R. Lindleyana 16: 235-271.
Holdridge. Scale 1:750 000. Centro Científico Tropical, Pridgeon, A.M., R. Solano & M.W. Chase. 2001.
San José, Costa Rica, 1 p. Phylogenetic relationships in Pleurothallidinae
Garay, L.A. 1974. Acostaea y los géneros del complejo (Orchidaceae): combined evidence from nuclear and
Pleurothallis. Orquideología 9: 103-124. plastid DNA sequences. Amer. J. Bot. 88: 2286-2308.
Garay, L.A. & H.R. Sweet. 1972. Notes on West Indian Pupulin, F., A.P. Karremans & B. Gravendeel. 2012.
orchids. J. Arnold Arbor. 53: 515–530. A reconsideration of the empusellous species of
Holdridge, L. R. 1987. Ecología basada en zonas de vida, 3ª Specklinia (Orchidaceae: Pleurothallidinae) in Costa
reimpresión. Instituto Interamericano de Cooperación Rica. Phytotaxa 63: 1-20.

LANKESTERIANA 13(3): 207—214. 2014.
A NEW SPECIES IN THE COHNIELLA ASCENDENS COMPLEX

FROM AMAZONIAN VENEZUELA (ORCHIDACEAE, ONCIDIINAE)
William Cetzal-Ix1,2,5, Germán Carnevali2,3 & Eliana Noguera-Savelli4
El Colegio de la Frontera Sur (ECOSUR), Unidad Chetumal, Av. del Centenario km 5.5,
1
Chetumal 77014, Quintana Roo, México

2
Current address: Herbarium CICY, Centro de Investigación Científica de Yucatán, A.C. (CICY), Calle
43. No. 130. Col. Chuburná de Hidalgo, Mérida 97200, Yucatán, México
3
Orchid Herbarium of Oakes Ames, Harvard University Herbaria. 22 Divinity Avenue,
Cambridge, Massachusetts 02138. U.S.A.
4
Francisco de Montejo, Mérida 97203, Yucatán, México
5
Author for correspondence: rolito22@hotmail.com
Abstract. Cohniella amazonica (Orchidaceae, Oncidiinae, Trichocentrum-clade) a species in the Cohniella

ascendens complex, from Amazonas, Venezuela, is herein newly described, illustrated, and characterized based
on morphological characters. The new taxon is similar to C. nuda, from which it differs in the subquadrate-
oblong lateral lobes of the labellum that are in the same plane as the central lobe, the 5-partite callus, the bipartite
column wings, and the distribution range restricted to the northeastern portion of Amazonas, Venezuela. The
conservation status of the new taxon is assessed as Data Deficient (DD) according to the IUCN (International
Union for Conservation of Nature) criteria. We provide a key and table of characters to diagnose the Cohniella
ascendens species complex, a comparative figure, and a map showing the geographical distributions of the
species in this group.
Resumen: Cohniella amazonica (Orchidaceae, Oncidiinae, clado-Trichocentrum), una especie en el complejo

Cohniella ascendens de Amazonas, Venezuela, es aquí descrito, ilustrado y caracterizado con base en caracteres
morfológicos. El nuevo taxón es similar a C. nuda, de la cual se distingue por los lóbulos laterales del labelo
subcuadrado-oblongos que se encuentran en el mismo plano que el lóbulo central, el callo 5-partito, las alas
de columna bipartitas y la distribución restringida a la porción noreste de Amazonas, Venezuela. El estado
de conservación del nuevo taxón es evaluado como Datos Deficientes (DD) de acuerdo a los criterios de la
UICN (Unión Internacional para la Conservación de la Naturaleza). Proporcionamos una clave y una tabla de
caracteres para diagnosticar las especies del complejo Cohniella ascendens, una figura comparativa y un mapa
que muestra sus distribuciones geográficas de las especies de este grupo.
Key words: Cohniella, Trichocentrum, Oncidiinae, Orchidaceae, Venezuela
The genus Cohniella Pfitzer includes 22 species, blades, succulent, medium sized to large terete leaves,
two natural hybrids, and five informal species and Oncidium-like flowers (Carnevali et al. 2010);
complexes (Cetzal-Ix et al. 2013a). The genus is furthermore, anatomical characters such as unifacial
distinguished from others members of the Oncidiinae leaves and the presence raphides in the epidermis
by the relatively small (<13 mm) and subspherical, (Cetzal-Ix et al. 2013b) also help distinguish the genus.
1-leaved pseudobulbs whose sheaths lack foliar Characters used to recognize species are primarily
Lankester Botanical Garden´s (JBL) 40th anniversary. Botanical collections of the JBL have been relevant to understand the
identity and distribution of Cohniella species in our previous studies, cited in this paper.
208 LANKESTERIANA
floral, such as the shape and position of the lateral n 1995 a plant collected by Carlos García Esquivel
lobes of the labellum, shape, position, and number of in an area of tropical humid forests with a strong dry
teeth of the callus of the labellum, shape and size of season in northwestern Amazonas state, Venezuela
the column base, and shape and position of the column was identified as Oncidium cebolleta (Jacq.) Sw.
wings (Cetzal-Ix et al. 2013a). Regarding the species by one of us (GC). However, despite this plant has
complexes, they are recognized by combinations morphological features characteristic of the Cohniella
of vegetative and floral characters. The vegetative ascendens complex. We here interpret the combination
characters include the size and thickness of the leaves, of morphological characters and distribution as
the length of the inflorescence relative to subtending evidence of species status for this plant, which is
leaf, the position, number, and the arrangement of herein proposed as the new species
flowers in the inflorescence. Floral characters useful in
species diagnoses include size and color of the flowers, Material and methods. The description of the
the shape of the platform of the labellum callus, and new species was prepared from herbarium material
the shape and presence or absence of the base of the preserved in a 70:25:5 ethanol:water:glycerine
column. solution. Additional material of related species used
Furthermore, species or species complexes can be for this study has been previously cited in Cetzal-Ix &
easily identified using these characters in combination Carnevali (2010) and Cetzal-Ix (2012b) where flowers
with discrete patterns of ecological and geographical from herbarium material were soaked in concentrated
distribution. The five species complexes in Cohniella ammonium hydroxide for about one minute for
are morphologically, ecologically, and geographically rehydration, then rinsed in water until soft and ready
discrete; moreover, they are recovered as monophyletic for study under a dissecting microscope. Flowers thus
in morphological and molecular phylogenetic analyses pretreated were temporarily preserved as above for
(Cetzal-Ix 2012a). further study and eventually returned to herbarium
The Cohniella ascendens complex includes C. sheets. Pictures of live and herbarium flowers were
aguirrei (Königer) Königer, C. ascendens (Lindl.) taken with a SONY Cybershot DSC-W120; others
Christenson, C. helicantha (Kraenzl.) Cetzal & were digitalized under an Epson Expression 1640
Carnevali, C. lacera (Lindl.) Cetzal, and C. nuda XL scanner. Digital images of flowers were captured
(Bateman ex Lindl.) Christenson (Table 1). Its at several resolutions, ranging from 600 to 1200 dpi.
species occur in humid to subhumid habitats, from Digital line drawings were produced with Canvas X,
low-statured inundated, semi-evergreen to evergreen using the digital images previously captured to provide
forests and, more rarely, in semideciduous forest at outlines. Cartography was produced by plotting the
elevations of 0-800 meters. Members of the Cohniella locality data cited here and previous studies of Cetzal-
ascendens complex share a habit featuring the semi- Ix & Carnevali (2010) and Cetzal-Ix (2012b) on an
pendulous or semi-erect leaves with rarely racemose image data “shaded and colored SRTM elevation
or paniculate inflorescences that usually do not exceed model” (NASA/JPL/NIMA 2002) using ArcView 3.2
the length of the leaf, more infrequently exceeding (ESRI 1999).
it; furthermore, the sepals are rounded whereas
the petals are subquadrate with subtruncate apex; Taxonomic treatment
the callus of the labellum presents a hemispherical
Cohniella amazonica Cetzal & Carnevali, sp. nov.
platform. Species are distributed from northern
(Figs. 1–4)
Tamaulipas and the central portion of Mexico to the
northern and northwestern Colombia and the northern Type: VENEZUELA. Amazonas: Puerto Ayacucho,
half of Venezuela. Cohniella ascendens and C. nuda flowered in cultivation in the collection of Carlos
present the widest distributions within the complex García Esquivel in Caracas, Venezuela; leaf terete;
(and the genus); other species, such as C. aguirrei and flowers yellow, Dec. 1991, C. García Esquivel s.n. sub.
C. lacera, are much more geographically restricted G. Carnevali 3080 (holotype: CICY; isotypes, AMES,
(Figure 1). VEN). .
Table 1. Morphological comparison of the Cohniella ascendens species complex.
Characters C. aguirrei C. amazonica C. ascendens C. helicantha C. lacera C. nuda
Leaf length (cm) 30-67 – (13-)15-86 35-62 24-70 27-69
Inflorescence length (cm) 14-50 25 (11-)14-65(-80) 25-48 (7-)13-63 60-165
Flower position Resupinate Resupinate Resupinate Non-resupinate Resupinate Resupinate
Flower size (mm) 16-18 15-18 15-22 10-15 18-25 13-16
Central lobe of the labellum (mm) 4.0-4.2 × 7-8 3-5 × 5-6 5-7 × 8.5-13.0 3-5 × 7-9 7-10 × (12-)14-16 3-5 × 6-10
Central lobe of the labellum (proportions not Wider than long About as long as Wider than long Wider than long Wider than long Wider than long
counting the isthmus) wide or longer than
wide
Lateral lobes of the labellum (position) Parallel to the Parallel to the Perpendicular to Parallel to the Parallel to the Parallel to the
central lobe central lobe the central lobe central lobe central lobe central lobe
Lateral lobes of the labellum (mm) 3-5 × 2-3 4-6 × 3.5-4.0 4-8 × 2-4 2-3 × 0.7-1.0 3-4 × 1.1-2.0 2.0-3.5(-5.0) ×
0.8-2.0
Lateral lobes of the labellum shape Triangular Oblong Oblong Triangular Linear Linear
Isthmus (mm) 0.8-2.5 × 0.5-3.0 2.0-2.2 × 0.5-4.0 × 1.2-3.0 × 4-6 × 1.5-1.8 2-4 × 0.5-1.4
2.5-3.0 1.3-3.0 2.7-3.0
Cetzal-Ix et al. — A new species of Cohniella
Labellar callus 5-partite 5-partite 5-partite 5-partite 1-partite 3-partite
Proximal teeth of the callus (shape) Cylindrical Conical Cylindrical Cylindrical Absent Absent
Distal teeth of the callus (shape) Conical Cylindrical Conical Conical Absent Conical
Lateral margins of labellum disc Rugose Smooth Rugose Rugose Rugose Smooth
Column wings (shape) Terete Bilobed Terete Terete Triangular Triangular

209
210 LANKESTERIANA
Figure 1. Distribution of the Cohniella ascendens species complex.
A Cohniella species belonging to the Cohniella thick. Sepals basally clawed, spreading or somewhat
ascendens complex and related to C. nuda from which reflexed. Dorsal sepal 6–7 × 5.5–6.5 mm, obovate,
it is different by the subquadrate-oblong lateral lobes apically obtuse and minutely apiculate, concave in the
of the labellum that are in the same plane as the central upper half, the claw 1.0–1.2 × 1.0–1.1 mm. Lateral
lobe, the 5-partite callus, the bipartite column wings, sepals partially fused at the very base, then free,
and distribution restricted to the northeastern portion similar to dorsal, 6.0–7.0 × 5.5–6.5 mm. Petals 6–7 ×
of Amazonas, Venezuela. 3–5 mm, oblong to oblanceolate, somewhat oblique,
the apex rounded. Labellum 3-lobed, 10–11 mm long
Plant epiphytic. Leaf terete, missing from the only from the base to the apex of the central lobe, 8–11 mm
specimen available. Inflorescences presumably solitary wide across the apices of the lateral lobes, the lateral
and borne from the base of the pseudobulbs, to 25 lobes in the same plane as the central lobe and more or
cm long, a 9-flowered raceme; peduncle erect, 1.5 less perpendicular to it. Central lobe 3–5 × 5–6 mm,
mm thick, terete, with 7 bracted internodes, peduncle oblong-spathulate in outline, apically rounded, basally
bracts 6.0–8.0 × 2.5–3.0 mm, the basal-most longest, produced into a long isthmus, 2.0–2.2 × 2.5–3.0 mm.
acuminate, tubular; floral bracts 2.0–2.5 × 0.5–1.0 mm, Lateral lobes 4.0–6.0 × 3.5–4.0 mm, patent, somewhat
narrowly elliptic, acuminate. Flowers resupinate, 15–18 reflexed in natural position, subquadrate to oblong,
mm diameter, ovary with pedicel 13–17 mm long, of apically truncate-rounded, the upper and lower margins
which 3–4 mm corresponds to the ovary, 0.8–1.0 mm of the lateral lobes entire. Disc 3.5–4.0 × 3.5–4.0 mm,
Cetzal-Ix et al. — A new species of Cohniella 211
Figure 2. Cohniella amazonica. A — Flower. B, C — Labellum front view. D — Labellum back view. E — Sepals and
petals. F — Disc and callus. G — Flower, lateral view. H — Column, front view. I — clinandrium, front view. Scale: A
= 2 cm. B–E. = 6 mm. F = 2 mm. G = 3 mm. H–I = 1 mm. Drawn by W. Cetzal-Ix.
in general outline oblong, with a well-developed callus, stigmatic surface obovate, ca. 0.8 × 0.6 mm. Column
ca. 2.2–2.5 × 2.5–2.8 mm, consisting of a large, more wings 1.0–1.2 × 0.7–0.8 mm, bilobed, oblate. Anther
or less elevated and flat, hemispherical platform ca. cap 1.5–1.6 × 1.2–1.3 mm, apically operculate, obovate.
1.0–1.2 × 2.5–2.6 mm, basally with two lateral smaller, Pollinarium and capsule not seen.
divergent, teeth that are conical and point upward, 1.0–
Etymology: The specific epithet refers to the
1.2 mm long, distally with two divergent, cylindrical
Amazonas state of Venezuela where the only known
lateral teeth, these 0.4–05 × 0.2–0.3 mm; the central
specimen was collected.
tooth 1.8 mm tall, laterally compressed, the lateral
sides of the callus with two small, conical teeth, 0.5 Distribution and ecology. Cohniella amazonica is
mm tall. Column 2.5–3.0 × 1.0–1.2 mm, the ventral only known from the vicinity of Puerto Ayacucho in
face perpendicular to the plane of the labellum lobes, Amazonas State, Venezuela (Fig. 1). It grows in tropical
ovate, subcylindric, tabula infrastigmatica subquadrate, humid forests, possibly in sympatry or parapatry with
212 LANKESTERIANA
Figure 3. Morphological comparison of the Cohniella ascendens species complex. A — Cohniella aguirrei [based on
Königer 95, M]. B — Cohniella amazonica [Carnevali 3080, CICY]. C — Cohniella ascendens [Cetzal 17, CICY].
D — Cohniella helicantha [Carnevali 7027, CICY]. E — Cohniella lacera [Carnevali 7311, CICY]. F — Cohniella
nuda [Carnevali 7283, CICY].
C. cebolleta (Jacq.) Christenson, C. croizatii Cetzal Cohniella amazonica, it is easy to distinguish from
& Carnevali, and C. ultrajectina Cetzal & Carnevali. related species in the Cohniella ascendens complex
However, these last three species are part of the such as C. aguirrei, C. ascendens, and C. helicantha
Cohniella cebolleta complex which is characterized by the narrow central lobe to the labellum (Fig. 3).
by the lateral margins of the disc convex with conical Furthermore, the callus features conical lateral teeth at
teeth, the column base conspicuous, 5-partite callus the base whereas distal calli are cylindrical; this pattern
(3-partite in C. croizatii), the disc covered by brown is reversed in the related taxa (Figs. 3-4).
or reddish spots only at base, and the platform of the IUCN Red List category. According to IUCN
callus rectangular (absent in C. croizatii) (Cetzal-Ix et (2004), Cohniella amazonica would be considered as
al. 2013a). The hemispherical platform of the callus Data Deficient (DD). The species in known a single
(Figs. 2F-4B) and relatively narrow central lobe, collection from the Puerto Ayacucho area, it is therefore
oblong-spathulate in outline and narrower than long suspected to be under no special threat, as this area is
renders this new species unmistakable among other largely uninhabited except for a few indigenous tribes,
Cohniella species of the area (Fig. 2A-C). primarily Yekuana. However, albeit the region around
Cetzal-Ix et al. — A new species of Cohniella 213
Figure 4. Comparison of the labellum callus of the Cohniella ascendens species complex. A — Cohniella aguirrei (based
on material type). B — Cohniella amazonica. C — Cohniella ascendens. D — Cohniella helicantha. E — Cohniella
lacera. F — Cohniella nuda. Drawn by W. Cetzal-Ix.
Puerto Ayacucho has been severely altered during the from the eastern portion of Panama and northern
past few decades, there are still abundant forested Colombia and Venezuela C. nuda
patches in this area (Cetzal-Ix & Carnevali 2011). 3. Central lobe of the labellum 5-6 mm wide;
lateral margins of the labellum smooth;
Key to the species of the Cohniella ascendens complex
column wings bipartite; plants from
1. Isthmus of the labellum much longer than broad Venezuela C. amazonica
(2-4 × 0.5-2.0 mm); callus consisting of 1 to 3 teeth 3. Central lobe of the labellum 7-13 mm wide;
or keels 2 lateral margins of the labellum rugose;
1. Isthmus of the labellum approximately as long as column wings terete; plants from Mexico to
broad (0.5-4.0 × 0.5-3.0 mm); callus consisting of 5 Colombia 4
teeth or keels 3 4. Flowers non resupinate; lateral lobes of
2. Flowers 18-25 mm diameter; labellum with the the labellum triangular, short and thin (2-3
lacerated margin; column wings conspicuous; × 0.7-1.0 mm); plants from Panama and
callus of the labellum 1-partite; plants endemic Colombia C. helicantha
to the central portion of Panama C. lacera 4. Flowers resupinate; lateral lobes of the
2. Flowers 13-16 mm diameter; labellum with the labellum various (obovate, oblong or
entire or slightly lacerated; column wings reduced triangular), lengths and widths (3-8 × 2-4
or absent; callus of the labellum 3-partite; plants mm); plants from Mexico to Colombia 5
214 LANKESTERIANA
5. Lateral lobes of the labellum erect, usually Oncidiinae). El Colegio de la Frontera Sur, Chetumal,
spathulate, broadly obovate; column Quintana Roo, 276 pp.
wings terete; plants of northwestern Cetzal-Ix, W. 2012b. Oncidium lacerum, an older and
ignored name for Cohniella stipitata (Orchidaceae,
Mexico to the southeast of Costa Rica
Cymbideae, Oncidiinae). Ann. Bot. Fenn. 49(1–2):
C. ascendens
137–143.
5. Lateral lobes of the labellum patent, not Cetzal-Ix, W. & G. Carnevali. 2010. A revision of Cohniella
spathulate, oblong-triangular; column Pfitzer (Orchidaceae) in Mexico. J. Torrey Bot. Soc.
wings subtriangular; plants from the 137(2–3): 180–213.
valleys between the central and eastern Cetzal-Ix, W. & G. Carnevali. 2011. A new Cohniella
Andean Cordilleras from Colombia Pftizer (Orchidaceae, Cymbidieae, Oncidiinae) from
C. aguirrei Amazonian Venezuela. Novon 21(2): 178–181.
Cetzal-Ix, W., G. Carnevali, E. Noguera-Savelli & G.A.
Romero-González. 2013a. Really, what is Cohniella
Acknowledgements. We thank Franco Pupulin (JBL) cebolleta? A recircumscription plus new and resurrected
for inviting us to participate in this special issue of
species and combinations. Syst. Bot. 38(3): 1–18.
Lankesteriana. Gustavo A. Romero-González (AMES) and
Cetzal-Ix, W., E. Noguera-Savelli, D. Jauregui & G.
Rodrigo Duno (CICY) commented on earlier drafts of this
Carnevali. 2013b. Anatomía foliar comparada y
article. Silvia Hernández Aguilar (CICY) helped us with the
sistemática del clado-Trichocentrum con énfasis en
management of herbarium loans.
Cohniella (Asparagales: Orchidaceae). Rev. Biol. Trop.
61(4): 1–20.
ESRI. 1999. ArcView gis 3.2, Environmental Systems
Research Institute, Inc. New York.
Literature Cited IUCN. 2004. Guidelines for using the IUCN red list
categories and criteria. Rapport IUCN. Gland,
Carnevali, G., W. Cetzal-Ix, R. Balam-Narváez & G.A. Switzerland and Cambridge, UK, 50 pp.
Romero-González. 2010. A synopsis of Cohniella NASA/JPL/NIMA. 2002. NASA, Jet Propulsion Laboratory.
(Orchidaceae, Oncidiinae). Brittonia 62(2): 153–177. NASA Earth Science Enterprise, Washington, D.C.
Cetzal-Ix, W. 2012a. Sistemática, Filogenia y Biogeografía Available from http://photojournal.jpl.nasa.gov/catalog/
de Cohniella Pfitzer (Orchidaceae: Cymbidieae, PIA03364 (accessed: 20 July 2013).

LANKESTERIANA 13(3): 215—227. 2014.
The Reverend Charles Samuel Pollock Parish -

plant collector & botanical illustrator of the
orchids from Tenasserim Province, Burma
Dudley Clayton
Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, United Kingdom
dudley.clayton@btinternet.com
Abstract. Charles Parish collected plants in Burma (now Myanmar) between 1852 and 1878. His orchid
collections, both preserved and living plants, were extensive. He sent plant material and watercolour sketches to
Sir William Hooker at Kew and living plants to the British orchid nursery of Messrs Hugh Low & Co. of Upper
Clapton. H.G. Reichenbach obtained examples of the Parish plant material from Hugh Low and he visited Kew
where he studied the Parish orchid specimens and illustrations and many of them were subsequently described
by Reichenbach. His beautiful and accurate watercolour paintings of orchids were bound in two volumes and
eventually came to Kew following his death. They have been extensively used by botanists such as Robert
Rolfe, Victor Summerhayes, Gunnar Seidenfaden and Jeffery Wood when working on the orchid floras of the
region. Parish’s life, collecting activities and collections are discussed here.
The name Parish as a collector of orchids in No record has yet been found, but it is most likely
Burma (Myanmar) will be familiar to those who that Charles Parish returned to England for his formal
study orchids but it is unlikely that many people education in 1832 or thereabouts, aged ten. On 12th
will know very much about him. Charles Samuel December 1837, aged fifteen, he was admitted to St
Pollock Parish (1822-1897) (Fig. 1), like many of his Edmund Hall, Oxford where he was awarded a Bachelor
contemporary clergymen in the 19th century, pursued of Arts degree on 2nd December 1841. Shortly after
his calling and combined this with the benefits of his leaving Oxford, he moved to Somerset and at the general
classical education. His abiding interest was in natural ordination held by the Lord Bishop of Bath and Wells
philosophy, which he pursued with considerable on 7th June 1846 (Bath Chronicle and Weekly Gazette,
vigour and specifically, botany and geology. He was 1846), he was ordained into Holy Orders as a deacon
born, the second son of the Reverend Henry Parish and then as a priest on 30th May 1847 (Sherborne
(1791-1873), on the 26th January 1822 at Dum Dum, Mercury, 1847). On 15th August 1846 he was appointed
a town about 4 miles northeast of Calcutta (Kolkata) curate at West Hatch, Somerset (Exeter and Plymouth
in India and the primary artillery cantonment for the Gazette, 1846) but he moved during December 1849 to
Bengal Army of the Honourable East India Company his second curacy at Bickenhall and Orchard Portman
(HEIC). Henry Parish was appointed Chaplain in the (Sherborne Mercury, 1849).
HEIC in 1820 and shortly after Charles was born, he Parish started collecting plants in 1844 in the
became Senior Chaplain, with the Garrison of Fort neighbourhood of Esher, Surrey, where he resided
William in Calcutta. This was followed by service with his parents who had, following their return from
at Agra from November 1826 and this is where he India, based themselves to be near Epsom, the Parish
remained until he retired in 1839 after completing family home. Charles Parish widened his search for
eighteen years’ service (McNally, 1976). A few plants to other parts of Surrey, Sussex and the London
months after their arrival at Agra, Henry Thomas, the area and by 1845 he extended his collecting to Kent,
eldest of three sons died, aged seven years. where the Parish family had connections. In 1845 he
* This paper was prepared in the framework of the celebration of Lankester Botanical Garden’s 40th anniversary.
216 LANKESTERIANA
“I was particularly taken by the description of a

certain volcanic island still active and standing
up, far from land, like a solitary sentinel, in the
Bay of Bengal, called ‘Barren Island’. Besides its
isolated position (for volcanoes are generally in
groups) the remarkable feature of it, as described,
was that the sea, entering by a gap in the outer
crater, completely surrounded the inner or
secondary crater, so that a boat could enter and be
rowed round between the two.
I thought, as I read the account, how much I
should like to see this strange island, not thinking
at the time that there was the remotest likelihood
of my ever doing so, situated as the place was on
the other side of the world and, moreover, very
much out of the ordinary trade vessels. But as it
is ‘the unexpected that always happens’ so this
extremely improbable thing, in course of time,
actually came about.”
Figure 1. Reverend Charles Samuel Pollock Parish (1822- In 1852, following in his father’s footsteps, he
1897). Reproduced with the kind permission of the
obtained an appointment with the HEIC and he was
Director and the Board of Trustees, Royal Botanic
placed under the authority of the Bengal Presidency,
Gardens, Kew.
effective from 19th May 1852. He arrived in Calcutta
visited Ayrshire, the Isle of Arran and Loch Lomond to be immediately dispatched to Burma, embarking on
in the west of Scotland. Specimens were collected in another vessel bound for Rangoon (Yangoon) where he
Somerset from 1845 and in 1846 he visited Ireland. arrived in late May or early June 1852 at the height of the
During the period 1846-1849, he collected more than 2nd Anglo-Burmese War (1852). Rangoon had just been
100 specimens each year, mainly from Somerset, captured after a sea assault by the forces of the HEIC.
neighbouring Wiltshire and Devon. He also made an Charles Parish was to remain at Moulmein
extensive collection in Wales; in Snowdonia, along (Mawlamyaing) for the next 25 years, apart from a
the west coast and in the north. His specimens were period of leave in England during 1872-73. He served
named and preserved to form a herbarium that includes initially as Assistant Chaplain, then as Chaplain from
a range of temperate terrestrial orchids (now deposited 1863 and finally, in 1873, after his return from leave,
with the Somerset Heritage Centre). as a Senior Chaplain. His duties were to look after the
To complement his botanical interest, he European officers and men of the growing Company
developed an understanding of geology and the garrison and their dependents at Moulmein and the
Blue Lias formations at Lyme Regis with their rich other smaller garrisons, with their dependents, in
source of fossils. With his keen scientific intellect, Tenasserim Province. Following the Indian Mutiny,
he explored the geology of Somerset and assembled the HEIC ceased to exist with the transfer of its
a large collection of fossils. Sadly, this no longer responsibilities to the Crown from 1st November 1858,
exists and it was possibly dispersed and absorbed into but life for the servants of the old Company did not
other collections. To gain a better understanding of change. As part of his duties, Parish was responsible for
geology, he purchased Lyell’s Elements of Geology the governance of the European School in Moulmein
and Principles of Geology and, as a result, he was and he also had to make periodic visits to the outlying
fascinated with the description of a volcanic island in stations at Tavoy (Dawei) and Mergui (Myeik), coastal
the Bay of Bengal (Parish, 1861): stations to the south, some 200 miles (320 km) and 300
Clayton — The Reverend Charles Samuel Pollock Parish 217
miles (480 km) from Moulmein and he had to travel by and another from 31st August 1855 were written to Dr
boat. After 1858, a prison was opened at Port Blair on Thomas Thompson in response to enquiries made by
the Andaman Islands and Parish had to make regular Thompson when he was the Director at the Calcutta
visit to the islands as part of his duties. Botanic Gardens. Parish’s letters were forwarded to
In 1854, two years after he arrived in Moulmein, Sir William Jackson Hooker (1785-1865), Director at
Charles Parish married Eleanor Isabella Sarah Johnson, the Royal Gardens Kew, because of the information
the daughter of an officer of the 18th Regiment Native they contained. Thompson identified Parish as a good
Infantry, Madras Army serving at Moulmein. They had contact for plant material from Tenasserim. Parish
seven children, four daughters and three sons, all born then began a regular correspondence with Sir William
in Moulmein, but their second daughter only survived until just two months before the latter’s death in
for one year. We know that Eleanor shared Charles’ August 1865. In addition to the letters, he sent regular
interest in botanical illustrating and a number of her consignments of plant material, mainly mosses, ferns
illustrations form part of the collection in the two and orchids, to Kew and orchids to Messrs Hugh Low
volumes donated to the Royal Botanic Gardens, Kew & Co. of Clapton. The first consignments sent in the
in 1898 by Eleanor, after the death of Charles Parish. summer of 1859 to Hugh Low included Cymbidium
Parish now had the opportunity in Tenasserim to parishii Rchb.f. and Vanda gigantea Lindl. (=
explore its forests and find a wide variety of plants, Vandopsis gigantea (Lindl.) Pfitzer), both discovered
not just orchids. He was particularly impressed by Parish during the expedition he made in February
with the remarkable limestone rocks which stood 1859 with Major (later Colonel) Samuel Tickell (1811-
perpendicularly out of a flat alluvial plain rising to 1875). Vanda gigantea was growing high up on a tree
1000-2500 ft (305-762 m), generally straight and and he never found it again, and the one plant he had
inaccessible. The pinnacles were worn by the rains brought down was so large it scarcely fitted on to
into needle like points and they were wonderfully rich his elephant. The specimen could be placed across a
in plants, but only one in twenty could be climbed. man’s shoulders but one man could not lift it! The first
His obvious desire to expand his botanical knowledge consignment of plants sent to Messrs Low & Co. was
had to take second place to his duties and it meant he lost when the steamer Cape of Good Hope was cut in
was unable to explore the region on a regular basis and half by the P & O steamer Nemesis, and sank in the
make a systematic appraisal of the region. At best, he Hooghly River. Various other trials and tribulations
could venture some 20 miles (32 km) from Moulmein. were suffered with plant material sent to England, with
The administration of the province was in the hands of ships foundering and packages delayed en-route by the
the district officers and they were required to tour their shipping companies. Eventually, he used with success
districts on a regular basis, including the exploration the Wardian case, a small sealed glasshouse.
of the unknown areas, surveying, recording the Colonel (later General) Robson Benson, who was
geographic features, agricultural practices, crops, based at Rangoon and collected for James Veitch &
indigenous plants and wildlife. Parish’s botanical Sons of Chelsea, was a friend of Parish. They met
knowledge made him a valuable companion to take on regularly and material was often exchanged. The
some of these expeditions. Even if he was unable to annual visits to the outstations at Tavoy and Mergui
make a particular journey, the district officers would were a highlight in Parish’s year and as the European
gather botanical material and Parish thus increased his populations at these stations were small, Parish found
overall knowledge. He initially collected mosses and he had sufficient spare time to explore the forests of
ferns, and some flowering, non-orchid, species, but Tavoy, Mergui and the Mergui Archipelago (Myeik
from 1859, orchids became a major interest and it is Kyunzu). His comments on these visits were a regular
mainly through the collecting and study of ferns and feature of his letters to Sir William. Letters to Sir
orchids that we know him. William’s son, Joseph Dalton Hooker (1817-1911),
The earliest preserved letter from Parish is in who became Director at Kew after his father’s death,
the Director’s Correspondence at the Royal Botanic were sporadic from 1862, but became regular again
Gardens, Kew and is dated 31st July 1855. This letter from 1865 until Parish retired in 1878. The memorable
218 LANKESTERIANA
Figure 2. Cleisostoma parishii (Hook.f.) Garay in Bot. Mus. Leafl. 23: 173. 1972. Sarcanthus parishii Hook.f., Bot. Mag.
86: t. 5217. 1860. Type: Burma, cult. Low, Parish s.n. (holo. K). Parish illustration vol. 2, p. 56, dated 1860. Reproduced
with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
record left by Parish concerning his visit to Barren and this coupled with earlier eruptions in the century,
Island, already alluded to, and now lodged with the changed the character of the island. Two or three officers
British Library (Parish, 1861), occurred during one of and Parish were rowed ashore and they explored the
the routine visits he made to the Andaman Islands. In island. The only orchid referred to in the article was
mid-October 1861, the local steamer made a straight encountered on their descent from the summit of the
course from the mouth of the Tavoy River to Port Blair volcano, when Parish caught sight of a pure white
and Barren Island lay in almost a direct line between speck in strong contrast with the background of black
the two places. As the island came into view and as ashes, near the bottom of the opposite slope, and he
Parish and a few others were anxious to land, the wanted to see what it was. It turned out to be a fine
master of the steamer agreed. Initially, the steamer healthy plant of Dendrobium formosum, a common but
was sailed around the island and then ‘hove to’ at a extremely beautiful orchid and known to the Burmese
convenient distance from the shore. Parish records as the ‘Silver Flower’. It was in full bloom and Parish
his disappointment at finding no intervening and thought it must have fallen off some overhanging tree
surrounding water, as described by Lyell. He may not on the ridge and slid or been washed down by the rain
have known that there had been an eruption in 1852 to its singular position.
Figure 3. Coelogyne parishii Hook.f. in Bot. Mag. 88: t. 5323. 1862. Type: Burma, Tenasserim, Moulmein, cult. Low,
Parish s.n. (holo. K). Parish Illustration vol. 1, p. 84, dated 1860. Reproduced with the kind permission of the Director
and the Board of Trustees, Royal Botanic Gardens, Kew.

220 LANKESTERIANA
Figure 4. Cymbidium parishii Rchb.f. in Trans. Linn. Soc. London 30: 144. 1874. Type: Burma, Parish s.n. (holo. W). Parish
illustration vol. 2, p. 19, dated 1867. Reproduced with the kind permission of the Director and the Board of Trustees,
Royal Botanic Gardens, Kew.

From 1859 Parish was writing articles and his among all these which, in any other order of
discoveries were being discussed, in botanical plants, would be reckoned sufficient for a specific
journals. He identified some 350 indigenous orchids, distinction. ….”
and grew about 150 species in his garden. Parish Parish retired after more than 25 years in Burma, on
used local knowledge as a means of obtaining 20th June 1878 but he remained an active clergyman in
material around Moulmein. A regular supply of the Taunton area. His wife Eleanor and their children
plants arrived which he would plant in his garden had remained at Taunton when Parish returned to
and watch them grow, and as he remarked ‘hardly a Moulmein after his period of leave in 1872-73. On
day passed on which I did not either draw or examine the 8th July 1885, it was reported that at the Orchid
microscopically one orchid or another’. Finding Congress held in London he was awarded a gold medal
suitable individuals to collect for him was not easy. from the Royal Horticultural Society, in recognition of
In 1864 he lamented the loss of his regular Burmese his exertions in connection with the importation of
collector who set a fire to drive a wild pig out of its Burmese orchids, of which he was an extensive and
lair, but died when the flames engulfed the tree that he enthusiastic collector when resident in the colony
had climbed to get out of the way. (Taunton Courier, and Western Advertiser, 1885). He
Parish’s 300 illustrations are bound in two volumes, died quietly in his sleep, on the 18th October 1897,
each comprising about 80 pages. The pages are often aged 75, at Roughmoor House, his home in Bishop’s
annotated with more than one name and Dendrobium Hull on the outskirts of Taunton.
is the most abundant species in the record. Many are
drawings of type material, including Cleisostoma Acknowledgments. I am grateful to the Director of
parishii (Fig. 2), Coelogyne parishii (Fig. 3), the Royal Botanic Gardens, Kew for enabling me to use
Cymbidium parishii (Fig. 4), Dendrobium parishii the facilities at Kew as an honorary research associate. I
particular wish to thank the staff of the Herbarium, Library
(Fig. 5), Hygrochilus parishii (Fig. 6), Paphiopedilum
and Archives for their valuable assistance with accessing
parishii (Fig. 7), Peristylus parishii (Fig. 8), Porpax
Parish’s illustrations and the Kew Director’s Correspondence
parishii (Fig. 9) and Phalaenopsis parishii (Fig. 10), in relation to my on-going research of Charles Parish and
were named in his honour by Reichenbach and Joseph his contribution to Orchidaceae. I also thank Dr Leonie
Hooker. Reichenbach (1874) listed most of the more Ryder of Brisbane, Queensland for providing me with her
than 200 orchid species collected by Parish around transcription of A Little Known Volcano. I also appreciated
Moulmein and described many novelties based on the opportunity to exchange information with her on the
Parish’s collections. Other Parish species were described genealogical aspects of the Parish family, to which she has a
maternal link back to a brother of Henry Parish. All images
by him in a variety of German and British journals.
reproduced by kind permission of the Director and Trustees
Following his retirement, Parish made a substantial of the Royal Botanic Gardens, Kew.
contribution on Orchidaceae in the third edition (1883)
of Francis Mason’s Burma, its people and productions;
Notes on the fauna, flora and minerals of Tenasserim, Literature cited
Pegu and Burma. Vol. II, Botany, rewritten and British Newspaper Archive, British Library, London;
enlarged by W. Theobald, who had just retired from accessed via a personal subscription:
Bath Chronicle and Weekly Gazette 1749-1950; 11th June
his post as Deputy-Superintendent Geological Survey
1846.
of India. A typical Parish entry concerns Vanda:
Exeter and Plymouth Gazette 1827-1950; 15th August 1846.
Sherborne Mercury 1789-1867; 12th June 1847 and 29th
“I come now to a very puzzling group of orchids.
December 1849.
I have lying on the table before me as I write,
Taunton Courier, and Western Advertiser 1833-1963; 8th
figures and illustrations of Vanda roxburghii, July 1885.
of V. roxburghii var. unicolor, V. bensonii, V. Kew Director’s Correspondence (KDCAS651-657;
denisoniana, and of a Vanda of my own finding, KDCAS1812; KDCAS2090-2112; KDCAS2114-2138;
which I have marked doubtfully, as V. bensonii. KDCAS2155; KDCAS2809-2812; KDCAS2814-2826).
Size and colour apart, I look in vain for anything Letters from CSP (Charles Samuel Pollock) Parish to

222 LANKESTERIANA
Figure 5. Dendrobium parishii Rchb.f. in Bot. Zeitung (Berlin) 21: 237 .1863. Type: Burma, Parish s.n. (holo. W). Parish
illustration vol. 1, p. 49, dated 11 March 1882. Reproduced with the kind permission of the Director and the Board of
Trustees, Royal Botanic Gardens, Kew.

Figure 6. Hygrochilus parishii (Veitch & Rchb.f.) Pfitzer in Engler & Prantl (eds.), Nat. Pflanzenfam., Nachtr. 1: 112. 1897)
Vanda parishii Rchb.f., Xenia Orchid. 2: 138. 1868. Type: Burma, Moulmein, Parish s.n. (holo. W). Parish illustration
vol. 2, p. 29, dated 5 April 1870. Reproduced with the kind permission of the Director and the Board of Trustees, Royal
Botanic Gardens, Kew.

224 LANKESTERIANA
Figure 7. Paphiopedilum parishii (Rchb.f.) Stein, Orchideen-Buch: 479. 1892. Cypripedium parishii Rchb.f., Flora 52:
322. 1869. Type: Burma, Parish s.n. (holo. W-RCHB; iso. K). Parish illustration vol. 2, p. 88, dated 1867. Charles and
Eleanor Parish are both identified as the artists. Reproduced with the kind permission of the Director and the Board of

Figure 8. Peristylus parishii Rchb.f. in Trans. Linn. Soc. London 30: 139. 1874. Type: Burma, Tenasserim, Moulmein, cult.
Dawson, Parish s.n. (holo. W-RCHB; iso. K). Parish illustration vol. 2, p. 81, dated 15 June 1868. Reproduced with the
kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.

226 LANKESTERIANA
Figure 9. Porpax parishii (Lindl. & Rchb.f.) Rolfe in Orchid Rev. 16: 8. 1908. Eria parishii Lindl. & Rchb.f., Trans. Linn.
Soc. London 30: 147. 1874. Type: Burma, Parish s.n. (holo. W). Parish illustration vol. 1, p. 55, dated 1856. Reproduced
with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.

Figure 10. Phalaenopsis parishii Rchb.f. in Bot. Zeitung (Berlin) 23: 146. 1865. Type: Burma, Tenasserim, Moulmein,
Parish s.n. (holo. W-RCHB). Parish illustration vol. 2, p. 70, dated 20 April 1869. Reproduced with the kind permission
of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
Sir William Jackson Hooker (1855-1865). James McNally, India Office clerk, 1922-1947. British
Kew Director’s Correspondence (KDCAS5360-5363; Library, London, Oriental and India Office Collection.
KDCAS5365-5371; KDCAS5373-5380; KDCAS5382- Parish, C.S.P. 1856-1874. Drawings (coloured) of
5410; KDCAS5412-5413). Letters from CSP (Charles Orchidaceae (executed chiefly at Moulmein) in 2
Samuel Pollock) Parish to Sir Joseph Dalton Hooker volumes. Royal Botanic Gardens, Kew Catalogue No.
(1862-1882). 114242.
Mason, F. 1883. Burma, its people and productions; Notes Parish, C.S.P. 1861. A Little Known Volcano, visited 19th
on the fauna, flora and minerals of Tenasserim, Pegu October 1861 (a copy donated to the British Library
and Burma. Vol. II, Botany, rewritten and enlarged by by G.M. Parish, Broadstone, 1953. British Library,
W. Theobald, Late Deputy-Superintendent Geological London, Oriental and India Office Collection, European
Survey of India. Published by Order of the Chief Manuscripts, MSS. Eur. D674 (transcription by Dr L.A.
Commissioner of British Burma. Stephen Austin & Ryder (2012), Brisbane, Queensland, Australia).
Sons, Hertford. Reichenbach, H.G. 1874. Enumeration of the orchids
McNally, S.J. 1976. The Chaplains of the East India collected by the Rev. (E.C.) C.S.P. Parish in the
Company. List of all Chaplains appointed to the service neighbourhood of Moulmein, with descriptions of the
of the East India Company 1601-1861 (transcript) with new species in Transactions of the Linnean Society of
biographical details, compiled 1935-1976 by Sidney London, 30: 133-155. London.

LANKESTERIANA
LANKESTERIANA 13(3): 229—250. 2014.
SLIPPER ORCHIDS IN ART AND SCIENCE
Phillip Cribb
Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, United Kingdom
P.Cribb@kew.org
Abstract. The lady’s slippers, orchids with showy and unusual flowers with considerable diversity in shape,
size and colour, are amongst the most popular of all orchids in science and horticulture. Consequently, the
botanical and horticultural literature on them is extensive. Artists and designers have also been intrigued by
them and they feature in many illustrated botanical and horticultural books and decorative items, from tapestries
to porcelain and stamps. In this article, the history of slipper orchids is illustrated by reference to illustrations of
them, mostly in the collections of the Royal Botanic Gardens. Kew.
Key words: Orchidaceae, Cypripedioideae, botanical illustration, Kew
“Be guided by nature”. “Do not depart from it, of the Emperor Anicius Olybrius in Constantinople
thinking that you can do better yourself” and preserved in the Austrian National Library in
Albrecht Dürer (1471-1528) Vienna. Amazingly, this copy of Dioscorides’ herbal
is illustrated in colour with life-like and recognisable
“Modern botanical drawing may … be said to
images of plants from the region. The significance of
date from the publication in 1530 of Brunfels’
illustrations can be traced to the ease with which they
Herbarum Vivae Eicones”
can be used for identification purposes when compared
Wilfred Blunt & William Stearn
with the written word. In essence, they make the
The Art of Botanical Illustration (1994)
process of identification and naming much quicker and
easier. Images of orchids do not appear in the Codex,
Introduction. Modern botany has its origins in Ancient but first appeared in the new herbals that began to be
Greece (Arber, 1986; Pavord, 2005). The first herbal, published in the Renaissance.
describing and naming plants of use to physicians was Botanical art made its greatest impact with the
prepared in the eastern Mediterranean by a student of publication of the first printed herbals. According to
Plato, the Greek physician Theophrastus of Lesbos Wilfred Blunt and William Stearn (1994), “Modern
(371-287 BC) (Arber, 1986). Much of the knowledge botanical drawing may … be said to date from the
in his Enquiry into Plants and On the causes of Plants publication in 1530 of Brunfels’ Herbarum Vivae
was distilled by Dioscorides (40-90 AD) in his De Eicones”. Otto Brunfels’ herbal was illustrated with
Materia Medica, a text that was copied and widely fine woodcuts based on original drawings by Hans
used by physicians for the following 1500 years. The Weiditz, a pupil of Albrecht Durer. Weiditz’s originals
earliest surviving copy is the Codex Julian Anicia of survive in the herbarium of Felix Platter (Figs 1, 2),
512 AD, prepared for Juliana Anicia, the daughter preserved in the City Library in Bern. Brunfels’ herbal
* This paper was prepared in the framework of the celebration of Lankester Botanical Garden’s 40th anniversary. Charles
Lankester formed a close association with Victor Summerhayes, Kew’s orchid specialist from 1928 until his retirement
in 1964. They he corresponded frequently and Lankester sent many living and preserved plants to Kew that he could not
identify. This relationship contributed many rarities to the Kew orchid herbarium and living collections over the years and
enabled Lankester to provide identities and names for his many discoveries which he grew on in his private garden which
is now the Jardin Botanico Lankester. The relationship between the botanists there and at Kew continues fruitfully to the
present day. It is a pleasure to contribute this article to the celebration of Charles Lankester’s legacy which is now a thriving
source of expertise on Costa Rica’s rich native flora
230 LANKESTERIANA
group within the family, distinguished by the flowers

which have lateral sepals joined to form a synsepal,
a slipper-shaped lip termed, two fertile lateral anthers
of the inner whorl, a sterile more or less shield-shaped
staminode at the apex of the column, and a stalked
trilobed stigma that lies ventrally on the column
behind the staminode. Consequently, they have been
considered to be “primitive” orchids. They represent as
small percentage of the family Orchidaceae, certainly
less than 1% in terms of numbers of species and
genera. Furthermore, many are rare and threatened
with extinction in their native habitats.
Slipper orchids are now recognised as a distinct
Figure 1. Felix Platter herbarium volume. Courtesy of the
Historical Museum of Bern.
subfamily, the Cypripedioideae, within the Orchidaceae
(Dressler 1981, 1993, Chase et al., 2003), comprising
five genera. All slipper orchids were included in the
genus Cypripedium for almost a century after the
name was established by Linnaeus (1737). Constantine
Samuel Rafinesque (1819, 1838), who knew the hardy
American species at first hand, was the first to recognise
the diversity within the slipper orchids, establishing
the genera Sacodon, Stimegas, Cordula, Menophora
and Criosanthes but his work was largely ignored by
his contemporaries because it was published in obscure
and little circulated works and he was less than clear
himself about the status of his taxa.. Of these names
Figure 2. Orchids in the Felix Platter herbarium. Courtesy Sacodon and Criosanthes refer to species now included
of the Historical Museum of Bern. in Cypripedium, while the rest refer to species now
included in Paphiopedilum which has been conserved
included orchids, although no lady’s slipper, a surprise
over Cordula and Stimegas (Farr et al. 1979).
because it is native and not uncommon in Germany.
H. G. Reichenbach (1854) established the genus Sele-
We have to wait until later in the 16th century for slipper
nipedium for the tropical American species which have a
orchids or lady’s slippers to make their first appearance
trilocular ovary. Blume (1858) discounted this character
in literature and illustration. Let us, first of all, consider
because he found unilocular ovaries of some species were
what distinguishes the lady’s slipper orchids.
trilocular towards each end. However, George Bentham
Slipper orchids. Lady’s slippers, comprising about 160 and Joseph Hooker (1883) followed Reichenbach in
species (Pridgeon et al., 1999), are found throughout dividing the slipper orchids into two genera.
Asia, Europe and the Americas as far south as Bolivia Ernst Pfitzer (1886, 1889, 1894) prepared the
and Brazil, but are absent from Africa, Madagascar and ground for the modern generic treatment of the slipper
Australia. They are among the most popular of orchids. orchids by recognising the correlation of leaf type
The earliest record we have of their cultivation is that by with perianth persistence. He established the genus
Philip Miller in 1731. He grew the native Lady’s slipper Paphiopedilum for the tropical Asiatic and American
orchid (Cypripedium calceolus) at the Chelsea Physic species with hard leaves and a deciduous perianth,
Garden. Nowadays, no collection is complete without leaving the plicate-leaved northern temperate species
its selection of slipper orchids. with a persistent perianth in Cypripedium and the
Lady’s slippers have features that set them apart tropical American ones in Selenipedium.
from other orchids, and form a distinct well-defined Robert Rolfe (1896) revised the slipper orchids. He
Cribb — Slipper orchids in art and science 231
Figure 3a. The Bischofzell tapestry, Basel City Museum, showing Cypripedium calceolus in the lower part. Courtesy of
the Basel City Museum.
restricted the genus Paphiopedilum (now c. 70 species) Mexipedium was basal in the Phragmipedium clade.
to the Old World hard-leaved species with imbricate Slipper orchids have also fascinated generations of
imbrications, but placed the New World hard-leaved botanists. Notably, their pollination biology was first
species in a new genus Phragmipedium (now ca. studied by Charles Darwin, the pre-eminent biologist.
21 species) based on their leaf type and valvate They have consequently featured prominently in
imbrication of the sepals. The use of Cypripedium botanical art. Here, the history of slipper orchids
(now 47 species) and Selenipedium (now 5 species) in art is considered and illustrated by some of the
followed that of Pfitzer. fine illustrations and representations that are in the
The monotypic Mexipedium, the fifth slipper orchid collections of the Royal Botanic Gardens, Kew
genus, was established by Albert and Chase (1992) to
accommodate a dwarf Mexican slipper orchid which Illustrations of slipper orchids
had morphological features intermediate between
Cypripedium —. “Cypripediums - The grandest and
those of the tropical American Phragmipedium and
most august of the Orchidaceae, one great race which
the tropical Asiatic Paphiopedilum. It was originally
is supreme alike in the open and under cover, deserves
included by Soto et al. (1990) in Phragmipedium on
full treatment by itself.”
account of its possession of the valvate aestivation
Reginald Farrer (1919) in The English Rock Garden
of its sepals, the absence of sinuous epidermal cells
in the perianth, the fusion of the side lobes of its lip In the subdued light in the basement of the
and the ventral synsepal being larger than the dorsal Historisches Museum Basel hangs a remarkable tapestry
sepal. Albert and Chase added a further character of which depicts a summer scene of the small walled
branched inflorescences in Phragmipedium but absent town of Bischofszell in north-eastern Switzerland just
from Paphiopedilum. Two years later, with the benefit south of the Bodensee (Lake Constance) (Fig. 3a).
of data from DNA analysis, Albert (1994) found that The tapestry dates from 1510 and, for the botanist,

232 LANKESTERIANA
Figure 4. Rembert Dodoens’ illustration of Cypripedium

calceolus in his Florum, et coronarium odoratarumque
Figure 3b The Bischofzell tapestry, Basel City Museum. nonnullarum herbarium historia (1568). Reproduced
Detail od Cypripedium calceolus. Courtesy of the Basel with the kind permission of the Director and the Board
City Museum. of Trustees, Royal Botanic Gardens, Kew.
its beauty is enhanced by the accurate depiction of a European C. calceolus and the North American species
number of native plants, including oxlip, columbine, now treated as C. parviflorum (var.b), C. acaule (var.g),
wild strawberry and a lady’s slipper orchid (Fig. 3b). and C. guttatum (var.d). The last is now considered to
This may well be its first depiction. The slipper orchid belong to the distinct and unrelated genus Calypso.
image is situated on the lower border slightly to the Linnaeus was by no means the first to describe
right of centre and shows a yellow-flowered plant, not slipper orchids. The earliest description and published
the normal form which has a yellow pouch and maroon illustration of a slipper orchid can be traced to the
sepals and petals. However, plants with pure yellow herbal of Rembert Dodoens (1568) entitled Florum, et
of almost yellow flowers do occasionally occur in coronarium odoratarumque nonnullarum herbarium
populations of more typical plants in Switzerland. historia. His wood-cut illustration of “Damasonium
Linnaeus first used the name Cypripedium in 1737 nothum” or “Papen schoen”, a one-flowered plant of
in his Flora Lapponica in describing the European C. calceolus complete with rhizome and roots (Fig.
species as “Cypripedium foliis ovato-lanceolatis”, 4), is simple but accurate and clearly identifiable. The
the name Cypripedium alluding to Cyprus, the island drawing was sent to him by Joannes Vreccomtus of
that was the mythological birthplace of Aphrodite Brussels who had flowered the illustrated plant in his
(Venus), and “pedilum” a shoe or slipper, in allusion garden, the earliest record of its cultivation.
to the popular name of “Lady’s slipper”. In 1753 he Mathias de L’Obel (1576) reproduced Dodoens’
named and described two species C. calceolus and C. illustration in his Plantarum seu stirpium historia while
bulbosum. The former concept included the well-known Dodoens (1583) used it again in his Stirpium historiae
and John Parkinson (1629) in his Paradisi in sole

paradisus terrestris.... Large chunks of Dodoens’ work
appear in Gerard’s Herbal in translation. However, this
was an accepted methodology of the day and Gerard
did add notes on plants with which he was familiar.
He calls Cypripedium calceolus “Our Ladies shooe or
slipper” and notes that it “groweth upon the mountains
of Germanie, Hungarie, and Poland”. He grew a plant
given to him by his friend the Apothecary Master
Garret and this is the earliest reference I can trace of
the cultivation of the species in the British Isles. It
is interesting that Gerard was unaware that it was a
native British species. Its recognition as such was left
to John Parkinson (1629) who called it “Helleborine
vel Elleborine maior, sive Calceolus Mariae”.
Parkinson recorded it as growing in “Lancashire,
neare the border of Yorkshire, in a wood or place called
the Helkes, which is three miles from Inglborough, the
higest Hill in England, and not farre from Ingleton, as
I am informed by a courteous Gentlewoman, called
Mistris Thomasin Turnstall, who dwelleth at Bull-
banke, near Hornby Castle...(she) hathe often sent mee
up the rootes to London which have faire flowers in my
Garden”. The Lady’s Slipper survived in that area until
Figure 5. Cypripedium calceolus from Dodoens’ herbal into the present century and Parkinson’s only mistake
Stirpium historiae pemptades (1583). Reproduced with is his suggestion that Ingleborough is the highest hill
the kind permission of the Director and the Board of
in England. Parkinson was indeed an astute observer
and noted that the seed of C. calceolus “is very small,
pemptades... together with a more refined illustration very like unto the seede of the Orchides or Satyrions,
of a plant with a branched rhizome with several shoots, and contained in such like long pods, but bigger.”
one of which bears two flowers and the other two seed As far as I can determine he was the first to connect
pods (Fig. 5). The latter originated in the contemporary Cypripedium with the orchids and to note their tiny
herbal Rariorum aliquot stirpium... of Charles de seeds. Michel Adanson (1763) was the first botanist to
L’Ecluse (1583), also known as Clusius. Dodoens used formally include slipper orchids in the orchid family.
the name “Calceolus Marianus”, “Pfaffen schuh”, The earliest known colour illustration of C. calceolus
“Papen schoen” and “Calceolus Sacerdotis”, while is that by Conrad Gesner (or Gessner) dating from 1541,
Clusius, “referring to it as “Marienschuh”, placed a watercolour of a plant from Mt. Saleu in the Swiss Jura
it next to the helleborines, “Elleborine “. Dodoens near Geneva (Fig. 6). It is an accomplished likeness, far
stated that it was found in “Helvetiorum, & Norici, ac superior to the later woodcuts in the L’Obel, Dodoens
Pannoniae superioris sive Austriae montibus”. Clusius and Clusius herbals, while in botanical accuracy and
had seen the plant in the wild in Austria and Hungary detail of the rhizome, fruit and column it was not matched
and it seems likely that his illustration was based on for another two hundred or more years. Gesner died
a wild plant seen on his travels. The wood-cut would from plague before he was able to publish his botanical
then have been produced for his own work but shared illustrations. Schmiedel (1754-1759) published part
with Dodoens who was a good friend (Arber,1986). of Gesner’s botanical work for the first time as Opera
Dodoens’ plate reappears in several later herbals, Botanica and included the coloured illustration and
notably those of John Gerard (1597) in his Herball account of C. calceolus as “Calceolus Mariae”. They
234 LANKESTERIANA
Figure 6. Conrad Gesner’s illustration of Cypripedium Figure 7. Leonard Plukenet’s plate of C. acaule and C.
calceolus, ca. 1540. Reproduced with the kind parviflorum var. parviflorum and var. pubescens from
permission of the Director and the Board of Trustees, his Amaltheum Botanicum (1700). Reproduced with
Royal Botanic Gardens, Kew. the kind permission of the Director and the Board of
have recently been reproduced in facsimile by Zoller, where he listed “Calceolus marianus canadensis”, a
Steinmann & Schmidt (1973-1980). A useful list of reference to C. acaule, the Moccasin flower.
early descriptions and illustrations of slipper orchids is Cypripedium reginae and three other North
included. American taxa, C. acaule and C. parviflorum var.
Another early colour illustration of C. calceolus is parviflorum (“Calceolus...flore luteo minore”) and
that by Daniel Rabel (1578-1638), recently reproduced var.pubescens, were described by Leonard Plukenet
in the second edition of Blunt & Stearn (1994). The (1700) in his Mantissa, the first two and the last
original is in the Bibliotheque Nationale in Paris and it being illustrated by him in 1705 in his Amaltheum
was probably painted in 1631 or 1632. Botanicum (Fig. 7). These line illustrations are the
Parkinson (1640) returned to the theme of “Our earliest representations of North American slipper
Ladyes Slipper or the great wilde Helleborine” in orchids. The earliest coloured illustration of a North
his Theatrum botanicum. There he recorded a North American species is that of “Calceolus flore maximo
American species, undoubtedly C. reginae, as a “sort rubente” (=C. acaule) (Fig. 8) by Mark Catesby (1754)
thereof.......brought from the North parts of America, in The Natural History of Carolina, Florida and the
differing onely in being greater both in stalkes, leaves Bahama Islands.
and flowers, which are not yellow but white, with reddish The first edition of Philip Miller’s Gardeners
strakes through the bellies of them”. An earlier reference Dictionary, published in 1731, included three
to a North American species, however, is that of J.P. species of hardy slipper orchid: the European species
Cornut (1635) in his Canadensium Plantarum Historia as “Helleborine; flore rotundo, sive Calceolus”;

Figure 8. Mark Catesby’s illustration of Cypripedium acaule from The Natural History of Carolina, Florida and the
Bahama Islands (1754). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic
Gardens, Kew.

236 LANKESTERIANA
Figure 9. Cypripedium parviflorum var. pubescens by Georg Figure 10. Plate of Cypripedium calceolus, C. macranthos
Dionysius Ehret, ca. 1758. Reproduced with the kind and C. x ventricosum from Gmelin’s Flora Sibirica
permission of the Director and the Board of Trustees, (1747-1749). Reproduced with the kind permission of
Royal Botanic Gardens, Kew. the Director and the Board of Trustees, Royal Botanic
Gardens, Kew.
and two North American species “Helleborine; but including Cornut and Morison’s names within C.
Virginiana, flore rotundo luteo”, one of the varieties calceolus, the European species which must have been
of C. parviflorum, and “Helleborine; Canadensis, familiar to him in his native Sweden.
sive calceolus mariae”, probably C. reginae. He William Aiton (1789) listed three species in his
commented that “all (are) Natives of Woody and shady Hortus Kewensis: the European C. calceolus, and
Places”. He provided a coloured illustration in his the North American C. reginae (as C. album) and C.
Figures of the most beautiful, useful and uncommon acaule as being grown at Kew. C. reginae had been
plants figured in the Gardeners Dictionary published introduced by William Hamilton in 1786 and C. acaule
in 1758. This illustration may, indeed, be the first of a by William Young in 1770.
British plant as Miller reiterates that it was “found in Johann Amman (1741) and Johann Georg
some Parts of England” and also mentions flowering Gmelin (1747-1749) published the first descriptions
it at Chelsea where, no doubt, the coloured illustration and illustrations of Asian slipper orchids (Fig. 10).
by R. Lancake was made. The German artist Georg The former illustrated Siberian C. macranthos as
Dionysius Ehret who worked at the Chelsea Physic “Calceolus purpureus speciosus”and C. guttatum as
Garden for Miller also illustrated a plant of the North “Calceolus minor flore vario” . The latter figured C.
American C. parviflorum var. pubescens (Fig. 9) which calceolus, C. ventricosum and C. macranthos, the last
Miller probably grew at Chelsea. as “Calceolus purpureis speciosus”. Swartz (1800)
Linnaeus (1753) apparently overlooked Parkinson’s based the names C. ventricosum and C. macranthos on
and Miller’s references to North American species Gmelin’s collections.
Figure 11. Carl Peter Thunberg’s illustration of Cypripedium japonicum from his Flora Japonica (1784). Reproduced with
the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
Linnaeus’s pupil Carl Peter Thunberg was the first Somoku Zusetsu of 1874. However, Ludovic Savatier’s
western botanist to visit Japan. Cypripedium japonicum watercolours of C. japonicum and C. macranthos made
and C. macranthos (as C. calceolus) were described in his between 1856 and 1866 survive in the Kew collection.
Flora Japonica (1784), the former also being illustrated Most of the species in the Far East remained unknown for
there (Fig. 11). The Japanese slipper orchids C. japonicum, nearly a century more until botanists began to penetrate
C. debile and C. macranthos figured in Yokusai Iinuma’s into the mountainous west of China.
238 LANKESTERIANA
Figure 12. Paphiopedilum insigne by an unknown Indian Figure 13. Samuel Curtis’s Paphiopedilum insigne drawn
artist for the Calcutta Botanic Garden, ca. 1820. for John Lindley’s Collectanea Botanica (1821).
Reproduced with the kind permission of the Director Reproduced with the kind permission of the Director
and the Board of Trustees, Royal Botanic Gardens, Kew. and the Board of Trustees, Royal Botanic Gardens, Kew.
The first hint of the rich array of western Chinese Paphiopedilum —. The increasing influence of
Cypripedium species was the collection in 1864 by Père the British in India opened up its rich tropical flora
Armand David of the yellow-flowered C. luteum (now to botanists and horticulturists. The establishment
C. flavum) at Moupin in what is now western Sichuan. of botanic gardens, initially to introduce crops for
However, the diversity of the Chinese cypripediums plantation culture, led to the flora being explored by a
was not apparent until the last few years of the 19th number of intrepid collectors and botanists, particularly
century. From 1894 onwards, the indefatigable French those associated with the Calcutta Botanic Garden
missionaries, Delavay, Soulie, Maire, Monbeig and which had been established in 1787. William Roxburgh
Farges, based in Yunnan and Sichuan, began to send collected orchids and employed Indian artists to draw
back large numbers of collections to Paris, many to them. Nathaniel Wallich, his successor, developed the
be described as new to science by the French botanist garden and started the herbarium of the East India
Franchet. By the turn of the century the British Company, the latter being the basis of our current
collectors Augustine Henry in Hubei, Sichuan and knowledge of the flora of India and neighbouring
Yunnan and Ernest Wilson in Sichuan and Hubei countries. He also employed native artists to illustrate
had added further species. New Chinese species novelties and these watercolour paintings are now held
have continued to be discovered and described this at Kew. Among these are some fine illustration of both
century (Tang & Wang, 1951; Cribb, 1992; Cribb & cypripediums and paphiopedilums. Two from 1826
Chen, 1994; Chen et al., 2013) and many have been are reproduced here, namely Paphiopedilum insigne
illustrated in Curtis’s Botanical Magazine, founded (Fig. 12) from the Khasia Hills and the Himalayan P.
in 1878 and the oldest surviving journal illustrated in venustum. The former had earlier been sent by Wallich
colour. to London where Samuel Curtis illustrated it for John
Figure 14. Hugh Low’s painting of his collection of Paphio- Figure 15. Lilian Snelling’s Paphiopedilum callosum.
pedilum lowii, drawn in Sarawak, Borneo, ca. 1847. Reproduced with the kind permission of the Director
Reproduced with the kind permission of the Director and and the Board of Trustees, Royal Botanic Gardens, Kew.
the Board of Trustees, Royal Botanic Gardens, Kew.
Lindley’s Collectanea Botanica (1821) (Fig. 13). Robert Warner’s Select Orchidaceous Plants (Lovell
Plant collectors occasionally illustrated the Reeve, London: 1862-1878) (Figs. 19, 20).
plants that they discovered. Several of these original Kew possesses many remarkable illustrations in its
paintings survive at Kew. Hugh Low’s original archives, none more so that John Day’s 53 scrapbooks,
watercolour of Paphiopedilum lowii (Fig. 14) also comprising over 2800 watercolour paintings of orchids
survives at Kew. The beautiful watercolours of (Cribb & Tibbs, 2004). Day cultivated and illustrated
Charles Parish, including his watercolour of the 44 species and 46 hybrid slipper orchids in three genera,
eponymous Paphiopedilum parishii, are dealt with Cypripedium, Paphiopedilum and Phragmipedium,
in an accompanying article (Clayton, 2013). Many of in his scrapbooks. His illustrations labelled as
their collections and those of other plant hunters ended Selenipedium and Uropedium are now considered to
up being sold by European nurseries, particularly belong to the genus Phragmipedium, while the South-
those in England, and were illustrated when they first east Asian and Indian species of Cypripedium belong
flowered in cultivation. to Paphiopedilum.
Over the past 226 years, many novelties have During Day’s lifetime many species new to science
been first figured in the pages of Curtis’s Botanical were discovered and described, including thirty species
Magazine. Walter Hood Fitch, Matilda Smith, of Paphiopedilum, almost half of the genus. When he
Lilian Snelling, Stella Ross-Craig, Margaret Stones, successfully flowered novelties he sent them to Professor
Pandora Sellars, Cristabel King and Carol Woodin H.G. Reichenbach for identification and naming. Hence
have all produced outstanding illustrations of slipper many of Reichenbach’s orchid names were based on
orchids for the journal (Figs. 15-18). Some of Fitch’s Day’s plants and his specimens and drawings form part
finest slipper orchid paintings were prepared for of the type materials of many species.

240 LANKESTERIANA
Figure 16. Stella Ross-Craig’s Paphiopedilum tonsum. Reproduced with the kind permission of the Director and the Board
of Trustees, Royal Botanic Gardens, Kew.
Some of John Day’s most prized orchids were slipper orchid in his collection was Paphiopedilum
slipper orchids. Paphiopedilum dayanum (Fig. 21) stonei var. platytaenium (Fig. 24) which was also
was named in his honour and P. stonei (Fig. 22) after probably the most valuable plant of the day and much
John Stone, his gardener. He was amongst the first to sought after by other growers who were willing to pay
illustrate Paphiopedilum sanderianum (Fig. 23), one of high prices for rarities and spectacular orchids. His
the world’s most desirable orchids. The most famous illustration of it is one of his finest watercolours.
Figure 17. Pandora Sellars’ Paphiopedilum superbiens. Figure 18. Carol Woodin’s Paphiopedilum vietnamense.
Figure 19. Walter Hood Fitch’s Paphiopedilum hirsutissi- Figure 20. Walter Hood Fitch’s Paphiopedilum callosum
mum for Robert Warner’s Select Orchidaceous Plants. for Robert Warner’s Select Orchidaceous Plants.

242 LANKESTERIANA
Figure 21. John Day’s Paphiopedilum dayanum. Reproduced with the kind permission of the Director and the Board of
Figure 22. John Day’s Paphiopedilum stonei. Reproduced with the kind permission of the Director and the Board of

Figure 23. John Day’s Paphiopedilum sanderianum. Reproduced with the kind permission of the Director and the Board of
Selenipedium and Phragmipedium —. The Spanish

botanists Hippolito Ruiz López (1754-1816) and
José Pavón Jiménez (1754-1840) were the first to
discover and collect tropical American slipper orchids.
Between 1777 and 1788, on behalf of the Spanish King
Carlos III, they undertook a botanical exploration of
Peru and Chile. The results of their expeditions, over
3000 collections of herbarium specimens and 2500
watercolour illustrations, formed the basis of their
proposed ten-volume Florae Peruviana et Chilensis
(1798-1802) of which only the first four appeared in
their life-times. The illustrations, made by the artists
Joseph Brunete and Isidro Gálvez, were deposited in the
collections of the Royal Botanical Garden in Madrid.
Amongst them are watercolours of Phragmipedium
caudatum and P. boissierianum. Unfortunately, neither
was described at the time by Ruiz and Pavón. John
Lindley saw a flower of each that had been brought
from the Ruiz and Pavón collection, still in Lima, by
Figure 24. John Day’s Paphiopedilum stonei var. platy- Matthews for Sir William Hooker. He described one as
taenium. Reproduced with the kind permission of the Cypripedium caudatum, but the second flower proved
Director and the Board of Trustees, Royal Botanic to be too badly preserved for description (Lindley,
Gardens, Kew. 1840).

244 LANKESTERIANA
Figure 25. Robert Schomburgk’s Phragmipedium lindleya- Figure 26. Everard Im Thurn’s illustration of Selenipedium
num, drawn on Mt Roraima, Guyana. Reproduced with palmifolium, ca. 1884. Reproduced with the kind
the kind permission of the Director and the Board of permission of the Director and the Board of Trustees,
Trustees, Royal Botanic Gardens, Kew. Royal Botanic Gardens, Kew.
Sesse and Mociño collected the first Central of Mr Schomburgk, to allow this plant to bear my name,
American Cypripedium species in Mexico between who have no title to the compliment”. Schomburgk’s
1787 and 1803. Their collections are in the herbarium original watercolour illustration (Fig. 25) remains in
of the Royal Botanic Garden, Madrid. They collected Lindley’s herbarium at Kew. Schomburgk’s adventures
two species to which they gave the manuscript names on Roraima were probably the inspiration for Sir Arthur
“C. turgidum” and “C. acuminatum”. The former Conan Doyle’s Lost World (1912). A watercolour of
name was eventually published posthumously in Selenipedium palmifolium, also drawn in situ by Everard
1890 (by which time it had already been described Im Thurn (1852-1932) who scaled the mountain some
by La Llave & Lexarza as C. irapeanum). The latter years later, also survives at Kew (Fig. 26).
name, referable to Lindley’s C. molle, has never been Friedrich Lehmann (1850-1893), the prolific orchid
published. Contemporary coloured illustrations of the collector in Colombia and Ecuador also painted his
two Sesse & Moçino species are preserved in the Hunt discoveries, probably to show European nurseries what
Institute collection in Pittsburg (Cribb & Soto, 1993). he had to offer when he occasionally visited Europe
Lindley described Cypripedium lindleyanum to solicit business. His paintings of phragmipediums
based on a specimen collected and named by Robert were published recently in this journal (Cribb, 2010).
Schomburgk (1804-1865) that had been collected by John Day’ watercolours of Phragmipedium species
him near Mt Roraima in Guyana. Lindley commented at include early depictions of P. boissierianum, P.
the time “I unwillingly consent, at the particular instance caudatum, P. schlimii (Fig. 27), and P. wallisii.
Figure 27. John Day’s Phragmipedium schlimii. Reproduced with the kind permission of the Director and the Board of
Artificial Hybrids —. John Day had access to, and

Thus, Day’s paintings of the early hybrids are an
illustrated in his scrapbooks, nearly all of the early invaluable record of English nurseries early ventures
slipper orchid hybrids raised by John Dominy and in orchid breeding. His pioneering work on illustrating
his successor John Seden for Messrs James Veitch hybrids was taken up by the Royal Horticultural
& Sons of Exeter and Chelsea. The significance of Society which has employed a series of artists to
these is considerable because systematic collections paint awarded orchids for over a century, a collection
of illustrations of hybrids, for example that of the that now includes many images of slipper and other
Royal Horticultural Society, did not start until the end orchids and a tradition that endures to the present day
of the 19th century when many of the early hybrids (Figs. 32). It seems likely that the idea for the RHS
had already disappeared. Although enthusiastic illustrations came from the common practice of orchid
about some, Day prophetically commented in nurseries equipping their salesmen who sold orchids
his appraisal of Cypripedium (Paphiopedilum) around the country with sets of watercolour paintings
Apiculatum, a hybrid between P. barbatum and of their best clones so that growers could order plants
P.villosum var. boxallii, that “I am afraid we shall based on the paintings. Some of these samples survive
be overcome with hybrids soon and orchids will at Kew, such as that of Paphiopedilum W.R. Lee and P.
gradually descend to the level of florist’s flowers Morganiae (Fig. 33).
and lose their interest” (Scrap Book 51, p. 95).
He also depicted all of the early Paphiopedilum Conclusion. Slipper orchids have been a popular
hybrids, including P. Harrisianum (Fig. 28) and P. subject for botanical artists for over four centuries
Morganiae (Fig. 29) and Phragmipedium hybrids, and remain so today. Their unusual and often showy
including P. Dominii (Fig. 30), P. Sedenii (Fig. 31), three-dimensional flowers are an artistic challenge, but
P. Cardinale and others in their first flowering at the the resulting images are often striking and far easier
Veitch nursery in Chelsea. to interpret than descriptions, thereby facilitating

246 LANKESTERIANA
Figure 28. John Day’s Paphiopedilum Harrisianum. Reproduced with the kind permission of the Director and the Board of
Figure 29. John Day’s Paphiopedilum Morganiae. Figure 30. John Day’s Phragmipedium Dominianum.

Figure 31. John Day’s Phragmipedium Sedenii. Reproduced with the kind permission of the Director and the Board of
Figure 32. Paphiopedilum lawrenceanum var. hyeanum Figure 33. Trade painting of Phragmipedium Morganiae
by Nellie Roberts for the Royal Horticultural Society. from the late Victorian period. Reproduced with the kind
Reproduced with the kind permission of the Director permission of the Director and the Board of Trustees,
and the Board of Trustees, Royal Botanic Gardens, Kew. Royal Botanic Gardens, Kew.

248 LANKESTERIANA
Figure 34. Mary Grierson’s Cypripedium calceolus for P. Francis Hunt’s Orchidaceae (Bourton Press, Bourton. 1973).

identification and naming. Nowadays, most species Amman, J. 1741. Quinque nova plantarum genera. Science
have been illustrated many times, occasionally Academy, St Petersburg.
inaccurately as in Mary Grierson’s painting of Arber, A. 1986. Herbals and their origin and evolution. 3rd
ed. Cambridge University Press.
Cypripedium calceolus (Fig. 34) for Peter Hunt’s
Blunt, W. & W. Stearn. 1994. The Art of Botanical
Orchidaceae which endows it with tubers!
Illustration. Antique Collectors Club, Woodbridge,
The history of their discovery and introduction Suffolk.
into cultivation can be traced through the chronology Blume, C. L. 1858. Collection des orchidées les plus
of their depiction. The archives also can be used to remarquable de l’Archipel Indien et du Japon. G.C.
trace the development of artificial breeding of slipper Sulpke, Amsterdam.
orchids for the horticultural trade, through collections Catesby, M. 1754. The Natural History of Carolina, Florida
of paintings by enthusiasts, for example, John Day and and the Bahama Islands.
by the artists employed to illustrate awarded plants by Chase, M. W., K. M. Cameron, R. L. Barrett & J. V.
the Royal Horticultural Society in London. Freudenstein. 2003. DNA data and Orchidaceae
systematics: a new phylogenetic classification. In
In recent years the popularity of botanical art has
Dixon, K.W., S. P. Kell, R. L. Barrett & P. J. Cribb
reached a level not previously seen since Victorian (eds.), Orchid Conservation: 69-89. Natural History
times. Watercolour paintings of slipper orchids are Publications, Kota Kinabalu, Sabah.
popular and fetch significant prices at art shows. Chen, S.C., Z. H. Liu, L. J. Chen & L. Q. Li. 2013. The
Slipper orchids have also been used to illustrate the genus Cypripedium in China. Science Press, Beijing.
cover of foodstuffs, such as ice cream and chocolates. Cornut, J. P. 1635. Canadensium Plantarum Historia. S. le
However, it is probable that the most lucrative line for Moyne, Paris.
slipper orchid illustration is for postage stamp issues. Cribb, P. J. 1992. The Chinese spotted-leaved cypripediums.
Cypripedium calceolus, the Eurasian lady’s slipper, Bull. Alp. Gard. Soc. 60, 2: 165-177.
Cribb, P. J. 2010. The life and travels of Friedrich Carl
has appeared on the stamps of numerous countries,
Lehmann. Lankesteriana 10, 2-3: 9-30.
including most European countries, the United Nations Cribb, P.J. & S. C. Chen. 1994. Further thoughts on the
and, surprisingly the Grenadines of St Vincent in the Chinese spotted-leaved cypripediums. Orchid Rev. 102:
Caribbean. Tropical slipper orchid species and hybrids 321-323.
are also popular subject for stamp issues. The small Cribb, P.J. & M. A. Soto. 1993. The genus Cypripedium in
island of Jersey, for example, has produced stamps Mexico and Central America. Orquidea (Mexico) 13,
featuring both Paphiopedilum hybrids and the Peruvian 1-2: 205-214.
Phragmipedium besseae. Cribb P.J. & M. Tibbs. 2004) A very Victorian passion. The
orchid paintings of John Day. Thomas Nelson, London.
Dodoens, R. 1568 Florum, et coronarium odoratarumque
Acknowledgements. I would like to thank Marilyn Ward
nonnullarum herbarium historia.
and Julia Buckley for their help in sourcing illustrations
Dressler, R.L. 1981. The Orchids. Natural History and
at Kew; Dr. Margret Ribbert, Curator of the Historisches
Classification. Harvard University press.
Museum Basel; and Samuel Sprunger and Werner Lehmann
Dressler, R.L. 1993. Phylogeny and classification of the
of the Swiss Orchid Foundation for alerting me to the image
orchid family. Cambridge University Press.
on the tapestry.
Farr, E. R., J. A. Leussink, & F. A. Stafleu. 1979. Index
nominum genericorum. Bohn, Scheltema & Holkema,
Utrecht; Junk, The Hague.
Literature cited Gmelin, J. G. 1747-1749. Flora Sibirica, sive Historiae
Aiton, W. 1789. Hortus Kewensis. G. Nicol, London. plantarum Sibiriae. Science Academy, St Petersburg.
Albert, V. A. 1994. Cladistic relationships of the slipper Iinuma, Y. 1874. Somoku Dzusetsu, ed. 2. Mino, Ogakai.
orchids (Cypripedioideae: Orchidaceae) from congruent Linnaeus, C. 1737. Flora Lapponica. Amsterdam.
morphological and molecular data. Lindleyana 9(2): Linnaeus, C. 1753. Species Plantarum. L. Salvius,
115-132. Stockholm.
Albert, V. A. & M. W. Chase. 1992. Mexipedium: a Miller, P. 1731. Gardeners Dictionary. C. Rivington,
new genus of slipper orchids (Cypripedioideae: London.
Orchidaceae). Lindleyana 7: 172–176. Parkinson, J. (1640). Theatrum botanicum. T. Cotes,

250 LANKESTERIANA
Parkinson, J. 1640. Theatrum botanicum. T. Cotes, London. Rafinesque, C. S. 1838. Flora telluriana. C. Rafinesque,
Pavord, A. (2005). The naming of names, the search for Philadelphia.
order in the world of plants. Bloomsbury, London. Reichenbach, H. G. 1854. Xenia orchidacea, vol. 1.
Pfitzer, E. (1886). Morphologische studien über die Brockhaus, Leipzig.
Orchideenblüthe. C. Winter, Heidelberg. Rolfe, R. A. 1896. The Cypripedium group. Orchid Rev. 4:
Pfitzer, E. (1889). Orchidaceae. In Engler, A., & Prantl, 327-334, 363-367.
C. eds. Die natürlichen Pflanzenfamilien 2, 6. W. Schmiedel, D. C. C. (ed.) 1754-1759. Conradi Gesneri...
Engelmann, Leipzig. Opera Botanica. J.M. Seligmann, Norimberg.
Pfitzer, E. (1894). Übersicht des natürlichen systems der Soto, M. A., G. A. Salazar & E. Hagsater. 1990.
Pflanzen. C. Winter, Heidelberg. Phragmipedium xerophyticum, a new species from
Pridgeon, A., P. J. Cribb, M. W. Chase & F. Rasmussen south-east Mexico. Orquidea (Mexico) 12, 1: 1-10.
(eds.). 1999. Genera orchidacearum vol. 1. Oxford Zoller, H., M. Steinmann & K. Schmidt. 1972-1980.
University Press. Conradi Gesneri Historia plantarum. Urs Graf,
Rafinesque, C. S. 1819. Prodrome des nouveaux genre des Dietikon, Zürich.
plantes. J. Phys. Chim. Hist. Nat., 89: 96-107.

LANKESTERIANA 13(3): 251—258. 2014.
THREE NEW MASDEVALLIA SPECIES (ORCHIDACEAE:

PLEUROTHALLIDINAE) FROM PERU
Stig Dalström1,3 & Saul Ruíz Pérez²
¹2304 Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A.

Lankester Botanical Garden, University of Costa Rica, Cartago, Costa Rica
and National Biodiversity Centre, Serbithang, Bhutan
²Allamanda 142, Surco, Lima 33, Peru
³Corresponding author: stigdalstrom@juno.com
Abstract. Three new Masdevallia species are described, illustrated and compared with similar species. A brief
taxonomic discussion is held about the justification for describing the new taxa as Masdevallia and not as
belonging to any of the recently proposed segregated genera. The first species is most similar to M. rimarima-
alba but differs in having a more tubular flower and a narrower lip, the second species is similar to M. dudleyi
and M. nunezii but differs in the richly pubescent sepals, and the third species is distinguished from other similar
and multiflowered Masdevallia species by the rugose lip.
Key words: Orchidaceae, Masdevallia, Pleurothallidiinae, Epidendreae, new species, Peru, taxonomy
In the most traditional circumscription, genus new genera, in addition to three already described
Masdevallia Ruíz & Pav., is a large genus in the segregates and the original Masdevallia (Luer 2006).
Pleurothallidiinae, distributed throughout the New Many growers and scientists have not accepted this
World tropics from Mexico in the north to southern proposition and maintain the genus more or less as it was
Bolivia, primarily along the Andes, but with a few circumscribed by Luer in 1986. For practical reasons, in
species occurring in Brazil as well. The systematic addition to strict taxonomic reasons, we chose to follow
classification of Masdevallia has changed considerably a broader concept of the genus and therefore describe
over the years, however, and many groups of species the species treated here as members of Masdevallia
have been transferred to new genera, such as, sensu Luer 1986, but at this time without placing them
Dracula Luer, Dryadella Luer, Porroglossum Schltr., in any particular subgenus or section.
Scaphosepalum Pfitzer and Trisetella Luer.
These transfers were to a considerable extent Masdevallia hortilankesteriani Dalström & Ruíz-
based on vegetative features in addition to flower Pérez, sp. nov.
morphology, which is user-friendly and makes the TYPE: Peru. Junín. Terrestrial along road Comas–
genera relatively easy to identify, even without the Cochas, S11°41.008’, W075° 04.22’, 2800 m. 13 Nov.
presence of flowers. A modern classification of the 2011, S. Dalström 3510 (holotype, USM). Figs. 1–4.
remaining about 350 species of Masdevallia (Luer
1986) included vegetatively rather similar plants, Diagnosis: Masdevallia hortilankesteriani is similar
which made it easy to spot a Masdevallia even without to the sympatric M. rimarima-alba Luer (Fig. 5.) but
flowers and from several meters distance. Recently, differs by a more compact vegetative habit, a more
however, molecular work with DNA sequencing has campanulate flower with longer and thicker sepaline
complicated the picture (Abele et al. 2005, Pridgeon tails and a narrower lip.
& Chase 2001), which led Luer to propose a division Geophytic or lithophytic herb. Plant medium
of the genus, by then about 500 species rich, into 16 in size, caespitose, root-thickness medium for the
252 LANKESTERIANA
Figure 1. Masdevallia hortilankesteriani. A — Plant habit, with a dissected flower. B — Flower lateral view. C — Column,
lip and petal views. Drawn from the holotype by Stig Dalström.

Dalström & Ruíz Pérez- Three new Masdevallia species 253
Figure 2. Masdevallia hortilankesteriani in natural habitat.

Photo by Stig Dalström.
genus. Ramicauls erect, slender, 1.0–2.5 cm long,

enclosed basally by 3 to 4 tubular sheaths. Leaf erect,
coriaceous, petiolate, blade basally conduplicate and
cuneate, elliptic, obtuse to acute, 6–10 × 0.8–1.1 cm, Figure 3. Masdevallia hortilankesteriani in natural habitat.
including the 1.5–3.0 cm long petiole. Inflorescence Photo by Stig Dalström.
erect, terete, single-flowered, with a to ca. 15 cm
long peduncle; peduncular bract 1, tubular, below
the middle of the peduncle, ca. 1.7–1.8 cm long;
floral bract appressed, tubular, ca. 1 cm long; pedicel
ca. 2.0–2.2 cm long; ovary smooth, ca. 0.4 cm long.
Flower attractive, campanulate; dorsal sepal white to
pale rose, with purple longitudinal stripes along the 3
veins, glabrous and carinate externally, glabrous to
microscopically pubescent internally, slightly concave,
cuneate, angulate-obovate and connate to the lateral
sepals for ca. 13 mm, acuminate into a dorsally rather
thick, frontally dull greenish yellow, ventrally purplish
tail, ca. 36 × 10 mm, including the ca. 16– 17 mm long
tail; lateral sepals similar in texture and coloration,
3-veined, connate for ca. 13 mm, angulate-ovate,
acuminate with apical, rather thick, slightly recurved
tails, ca. 30 × 16 mm, including the ca. 13–15 mm long
tails; petals white, cartilaginous, obliquely oblong and
apically truncate and obliquely bilobed, with a ventral Figure 4. Masdevallia hortilankesteriani flower. Photo by
fleshy ridge, extending from a lobed, or “toothed”, base, Stig Dalström.
continuing along the lower edge and diminishing near
low fleshy ridges, 5.0 × 2.5 mm; column white with
the apex, ca. 6 × 2 mm; lip whitish, heavily flushed with
brown-purple ventral stripes, semi-terete, straight, ca.
brownish purple, with darker longitudinal ventral stripes
4 mm long, with an equally long, curved foot that is
and a dark purple-brown apex, hinged on the column
slightly pubescent dorsally near the apex; anther cap
foot, with a basal swelling and shallowly notched,
white and campanulate; pollinia not seen.
cuneate, oblong-elliptic, apically truncate, recurved and
bluntly apiculate, dorsally slightly canaliculate between Paratypes: Peru. Junín. Terrestrial along road Comas—

254 LANKESTERIANA
of central Peru, but our new species is distinguished

from them all by the rich magenta sepaline pubescence.
Epiphytic herb. Plant medium to tall in size, caespitose,

root-thickness medium for the genus. Ramicauls stout
and erect, blackish in the wild, (presumably from a
benign fungus) 3.5–3.8 cm long, basally enclosed by
3 to 4 tubular sheaths. Leaf erect, coriaceous, petiolate,
blade basally conduplicate and cuneate, elliptic to
ovate, obtuse, 10–16 × 1.8–2.3 cm, including the to
ca. 5 cm long blackish-flushed petiole. Inflorescence
erect, slender, single-flowered, with a to ca. 13 cm long
peduncle; peduncular bract above the middle of the
peduncle, tubular ca. 0.9 cm long; floral bract tubular,
to ca. 1.3 cm long; pedicel ca. 2 cm long; ovary
smooth, ca. 0.8 cm long, densely covered by blackish
dots in the wild. Flower campanulate, attractive;
dorsal sepal basally dark yellow, then rich magenta
purple, and apically white with 3 greenish veins and
tail, minutely and scatteredly pubescent externally,
and richly covered internally above the middle by long
purple-magenta hairs, concave, cuneate, angulate-
obovate, connate with the lateral sepals for ca. 1.2
Figure 5. Masdevallia rimarima-alba, Huasahuasi. Photo by cm, then obtuse to acute with a slender, gently curved
Stig Dalström. tail, ca. 5.5 × 1.5 cm, including the 3.5 cm long tail;
lateral sepals similar in color and texture, connate
Cochas, S11°41.008’, W075° 04.22’, alt. 2800 m. 13 for ca. 1.4 cm, angulate-ovate, acute with a slender,
Nov. 2011, S. Dalström 3508 (USM). recurved apical tail, ca. 5.0 × 2.7 cm, including the
Distribution: Masdevallia hortilankesteriani is only ca. 3 cm long tail; petals white, shortly unguiculate,
reported from steep grassy and rocky slopes of the cartilaginous, oblong, truncate and obliquely bilobed
Andes near the town of Comas, in the region of Junín, apically, and with a large, incurved basal lobe, or
where it often grows in full sun along the road. tooth, continuing as a fleshy keel along the lower
edge, diminishing towards the apex, ca. 6 × 2 mm; lip
Etymology: Named in honor of Lankester Botanical whitish with magenta flush and specks, and a brownish
Garden and its staff, in recognition of their support apex, hinged on the column foot, with a basal swelling,
for orchid research in general and in the New World the hypochile cordate to truncate, ovate to pandurate,
tropics in particular. the epichile with down-folded edges, acute, dorsally
shallowly canaliculate between swollen longitudinal
Masdevallia karelii Dalström & Ruíz-Pérez, sp. nov.
ridges, ca. 5.0 × 2.7 mm; column white with brown-
TYPE: Peru. Puno, Sandia, along Rio Chullo in dense, purple ventral stripes, semiterete, straight, ca. 4.5 mm
mossy cloud forest, S14°20.769’, W69°26.836’, alt. long, with an equally long, curved foot; anther cap
ca. 2700 – 2800 m, 25 Nov. 2010, S. Dalström 3533 white, campanulate; pollinia not seen.
(holotype, USM). Figs. 6–8.
Distribution: Masdevallia karelii is only reported
Diagnosis: Masdevallia karelii is most similar to from a limited area near Sandia, Puno, Peru, where
species such as Masdevallia dudleyii Luer, M. nunezii it grows epiphytically on mossy trunks and branches,
Luer & Dalström, M. juan-albertoi Luer & M.Arias, commonly near and sometimes on the ground among
and M. terborchii Luer, all occurring in the highlands mossy debris, at 2600 – 2800 m.
Figure 6. Masdevallia karelii. A — Plant habit with a dissected flower. B — Column, lip and petal views. Drawn from the
holotype by Stig Dalström.

256 LANKESTERIANA
Figure 7. Masdevallia karelii in natural habitat (S. Dalström Figure 8. Masdevallia karelii flower (S. Dalström 3533).
3533). Photo by Karel Deburghgraeve. Photo by Stig Dalström.
Eponymy: Named in honor of Karel Deburghgraeve cm long petiole. Inflorescence dark purple, erect and
who participated in the discovery of this colorful slightly curved, successive flowered and producing
species. (at least) 2 nodding flowers, rather thin, with a to ca.
16 cm long peduncle and a to ca. 4 cm long rachis;
Masdevallia rugosilabia Dalström & Ruíz-Pérez, sp. peduncular bracts 3, below the middle, ca. 5–10 mm
nov. long; floral bracts tubular, ca. 1.5 cm long; peduncle
ca. 1.6 – 2.0 cm long; ovary ca. 0.4 cm long, weakly
TYPE: Peru. Huancavelica, Salcabamba, Tayacaja,
carinate. Flower nodding, campanulate; dorsal sepal
Huanca, alt. 2000 m, 8 June 2011, field-collected and
dark brownish purple externally, dark yellowish brown
flowered in cultivation by Perúflora 7 Dec. 2011, S.
Dalström 3491 (holotype, USM). Figs. 9, 10. covered by darker spots internally and with a dull, dark
yellowish tail, slightly concave, glabrous externally and
Diagnosis: Masdevallia rugosilabia is distinguished verrucose to rugose internally, connate with the lateral
from all other species in the genus by the combination sepals for ca. 6–7 mm, oblong and weakly angulate-
of a tall, slender, distantly successive- or bi-flowered, ovate, with a fleshy acuminate sepaline tail, ca. 20
terete peduncle bearing carnose, nodding flowers with × 4–5 mm, including the ca. 10 mm long tail; lateral
a concave and rugose epichile of the lip. sepals similar in color and texture, connate for ca. 10
Epiphytic herb. Plant slender but tall for the genus, mm, angulate-ovate, with a fleshy, slightly curved, short
caespitose, root-thickness medium sized. Ramicauls sepaline tail, ca. 15 × 10 mm, including the 5 mm long
erect 9.0–9.5 cm long, enclosed basally by 3 to 4 tubular tail; petals white, thickly cartilaginous, truncate oblong,
sheaths. Leaf erect, coriaceous, slender, petiolate, the apically weakly constricted, then truncate and weakly
blade basally conduplicate and cuneate, ovate to elliptic, trilobed, with a low, fleshy ridge emerging near the base
acute to obtuse, ca. 15.0 × 2.2 cm, including the 3.0 and diminishing near the middle, and with an additional
Figure 9. Masdevallia rugosilabia. A — Plant habit with a dissected flower. B — Column, lip and petal views. Drawn from
the holotype by Stig Dalström.

258 LANKESTERIANA
Distribution: Known only from the type locality in

central Peru.
Etymology: The name refers to the rugose lip of the

flower.
Acknowledgement. The authors thank the staff at the

Instituto Recursos Naturales (INRENA), and Betty Millán at
the Universidad de San Marcos, Museo de Historia Natural,
Lima, for aiding in providing the necessary collecting
permits. We also thank Wesley Higgins for commenting
on the manuscript, Steve Beckendorf, Guido and Karel
Deburghgraeve for stimulating company in the field, and
Manolo Arias together with his staff and family in Lima for
gracious logistic support.
Literature cited
Abele, C., B. Rudolph, J. Thiede & J. G. Rohwer. 2005.
Phylogeny of the genus Masdevallia Ruíz & Pav., based
Figure 10. Masdevallia rugosilabia flower (S. Dalström on morphological an molecular data. Proceedings of the
3491). Photo by Stig Dalström. 18th World Orchid Conference, Dijon, France, 111-115.
Luer, C. A. 1986. Icones Pleurothallidinarum 2, Systematics
fleshy ridge along the lower edge, emerging from near of Masdevallia (Orchidaceae). Monographs in
the middle up to the apex, ca. 3.5 × 1.2 mm; lip pale systematic botany from the Missouri Botanical Garden,
purple, hinged on the column foot, with a basal swelling, vol. 16.
truncate to cordate, the hypochile flattened ovate and Luer, C. A. 2006. Icones Pleurothallidinarum 28, A
weakly rugose, the epichile down-folded and convex reconsideration of Masdevallia, Systematics of
Specklinia and vegetatively similar taxa (Orchidaceae).
from above, rounded, rugose, dorsally canaliculate from
Monographs in systematic botany from the Missouri
near the base to the apex, ca. 3.5 × 2.0 mm; column white, Botanical Garden, vol. 105.
semiterete straight, ca. 4 mm long, with an equally long, Pridgeon, A. M. & M. W. Chase. 2001. A phylogenetic
curved foot; anther cap white, campanulate; pollinia 2, reclassification of Pleurothallidinae. Lindleyana 16(4):
flattened pyriform. 235-271.

LANKESTERIANA 13(3): 259—282. 2014.
New species and records of Orchidaceae from Costa Rica.

III
Melania Fernández1,2,4, Diego Bogarín1,2, Adam P. Karremans1,3 & Daniel Jiménez1

1
Jardín Botánico Lankester, Universidad de Costa Rica, P. O. Box 302-7050 Cartago, Costa Rica.
2
Herbario UCH, Universidad Autónoma de Chiriquí, 0427, David, Chiriquí, Panama.
3
Naturalis Biodiversity Center - NHN Universiteit Leiden, The Netherlands.
4
Corresponding author: melania.fernandez@ucr.ac.cr
Abstract. The establishment in Costa Rica of the great naturalist Charles H. Lankester in the 19th century
brought a tremendous increase in the knowledge of Costa Rican Orchidaceae. His desire to leave the collections
kept at his farm for a scientific and educational purpose was finally accomplished in 1973 with the foundation
of Lankester Botanical Garden (JBL). Since then, JBL has followed Lankester’s legacy with its consolidation as
a leading center for the study of Neotropical orchids, resulting among others in more than 180 new Costa Rican
species and records in the last 12 years. This manuscript includes the description of four new species and seven
new records, as part of JBL’s contribution to the completion of the Costa Rican orchid inventory.
Key words: Epidendrum jorge-warneri, Platystele tica, Platystele catiensis, Platystele sylvestrei, new species,
new records, Orchidaceae, Costa Rica
Costa Rica has witnessed the emergence and Botanical Gardens, Kew), with whom he shared his
consolidation of some of the finest botanists and many findings, product of his trips to botanically-rich
naturalists of the Americas at the beginning of the areas in the region of the Cartago province. Lankester’s
last century. Names like Alberto Manuel Brenes, tremendous passion for plants, great capacity to
Charles H. Lankester, Henri Pittier,Adolphe Tonduz, recognize details, and extraordinary horticultural skills
Karl Wercklé, can be found among those who made made a significant contribution to the foundation of
significant contributions to the knowledge of Costa Costa Rican orchid studies. His last dream to preserve
Rican flora. All but one of them shared a common the botanical collections held in his farm and to make
scientific background. Charles H. Lankester (1879- a contribution to conservation came true in 1973 with
1969) first arrived in Costa Rica at the end of the 19th the foundation of the Lankester Botanical Garden.
Century, hired for three years by the Sarapiqui Estates This paper is the third part of a series aimed towards
Ltd. coffee company. Captivated by the natural richness the completion of the Costa Rican Flora Orchidaceae.
of the country, he came back from England a few years In the last few years knowledge on the Costa Rican
later to build a life in Costa Rica His inclination and orchid flora has grown substantially (Bogarín et al.
acute observation of natural creatures and phenomena 2008; Karremans et al. 2012). Bogarín (2011) reported
in general, and of epiphytes in particular, soon brought 1519 species for the country, which meant up to 20
the attention of some of the greatest orchidologists and additions per year in the last decade. That trend
botanists of the time: Dr. Oakes Ames (University of was expected to be maintained by Karremans et al.
Harvard Herbarium), Paul C. Standley (Director of (2012), but even though the country already hit the
the United States National Museum) and Robert Allen 1600 species mark (Karremans & Bogarín 2013), the
Rolfe (curator of the orchid herbarium at the Royal novelties might increase rather than decrease in the
* This contribution was prepared as part of the special edition of Lankesteriana dedicated Lankester Botanical Garden´s
40th anniversary.
260 LANKESTERIANA
coming years. Here, we describe four new species and lip; lateral lobes hemi-rhomboid; mid-lobe triangular,
report the presence of six new records, illustrated with acute, apiculate. Column 3.5 mm long, straight, with
both photographs and detailed line drawings. Although two apical somewhat rounded wings. Clinandrium-
Sobralia bletiae Rchb.f. was previously known to hood short. Anther narrowly ovate with a prominent
occur in Costa Rica, an illustration and photograph central rib, 4-celled. Pollinia 4, obovoid, laterally
based on a Costa Rican specimen is also included. compressed, caudicles granulose. Rostellum apical,
slit. Nectary penetrating the ovary up to near the base.
1. Epidendrum jorge-warneri Karremans & Hágsater, Capsule not seen. Note: Description based only on
sp. nov. Karremans 5545.
TYPE: Costa Rica. Puntarenas: Buenos Aires, Buenos Distribution: known only from Costa Rica.
Aires, Olán, cumbre del Cerro Tinuk, 9°17’29.1”
N 83°10’11.2” W, 2417 m, bosque pluvial Eponymy: The name honors Jorge Warner, current
premontano, epífitas en bosque de páramo, 25 Director of the Lankester Botanical Garden of the
julio 2012, A.P. Karremans 5545, D. Bogarín, D. University of Costa Rica. With more than a decade in
Jiménez & V.H. Zúñiga (holotype, CR!; isotype, his position he has been paramount in the development
JBL-Spirit!; figs. 1, 14a). of the research center at the garden, and in the creation
and execution of the research projects, which allows
Epidendro anoglossoido Ames & C.Schweinf. for this and most other findings.
simile sed planta minore, caulis complanatis, folia
breviore, floribus majoribus, sepalis et petalis Habitat in Costa Rica: Known only from the plants
longiores, labello lanceolato longiore differt. found on the summit of Cerro Tinuk, Costa Rica. It
grows epiphytically and lithophytically in a small area
Epiphytic, sympodial, caespitose, erect herb, up to
of isolated “paramo”, at around 2400 m elevation.
20 cm tall. Roots from the base up to above half the
length of the stems, fleshy, filiform. Stem 15-20 cm tall, Phenology: flowering recorded at least in July.
branching conspicuously, cane-like, laterally flattened,
Epidendrum jorge-warneri belongs to the
erect. Leaves up to 5, distributed along the stem, mostly
Ramosum Group which is characterized by the
close to the apex as the basal ones fall off with time;
monopodial, branching stems, the spike-like, distichous
leaf sheath tubular, rugose, 1.5 cm long; blades 2.8-3.6
inflorescence, and the single callus, and the Rugosum
× 0.8-1.3 cm, elliptic to narrowly-ovate, obtuse bilobed,
Subgroup which has a branching habit with few-
articulate. Spathaceous bracts lacking. Inflorescence
flowered inflorescences from short, secondary stems,
apical, mostly from lateral branches, distichous,
the leaf-sheaths rugose. The species can be recognized
flowering only once; peduncle up to 2 cm long; rachis
by the laterally compressed stems, the laterally
curved, laterally flattened. Floral bracts equal to longer
compressed rachis and ovary, the 2-4, large, brownish-
than the ovary, acute, flattened, 1 cm long. Flowers 2-4,
yellow flowers and the lip which embraces the column
simultaneous, resupinate, brownish-yellow; fragrance
completely and the “Y” shapped callus of the lip..
sweet during the day. Ovary 8.0-8.5 mm, laterally
Epidendrum anoglossoides Ames & C.Schweinf. is the
compressed, prominently inflated throughout. Sepals
most similar species, but it has much smaller, up to 9,
free, spreading, the dorsal prominently bent inwards,
greenish-yellow flowers, sepals and petals 7.5-9.5 mm
narrowly-ovate to elliptic, acute, 9-veined, margin
long, lip 6 mm long, and callus of the lip tri-dentate.
entire; the dorsal sepal 15 × 3.5 mm; the lateral sepals
15 × 4.0-4.5 mm, oblique. Petals 13.0-13.5 × 1.5-2.0
2. Lepanthes ankistra Luer, Orquideología 16(3): 12.
mm, spreading, strongly bent backwards, ligulate to
1986.
narrowly-elliptic, obtuse, 3-veined, margin entire.
Lip 12.5 × 5.5-6.0 mm, united to the column, ovate- Type: Panama. Prov. of Chiriquí: epiphytic in cloud
lanceolate, slightly 3-lobed, margin wavy, embracing forest on Cerro Colorado, alt. 1500 m, 15 February
the column, completely covering it; callus Y-shaped, 1985, C. Luer, J. Luer, R.L. Dressler & K. Dressler
prolonged into a central rib extending to the apex of the 10534 (holotype, MO).
Fernández et al. — New species and records of Costa Rican Orchidaceae. III 261
E
B
Figure 1. Epidendrum jorge-warneri Karremans & Hágsater. A — Habit. B — Flower. C — Dissected perianth, flattened.
D — Column and lip, lateral view. E — Anther and pollinaria. Drawn by A.P. Karremans and J.M. Ramírez based on
A.P. Karremans 5545 (JBL-Spirit).

262 LANKESTERIANA
F
C
Figure 2. Lepanthes ankistra Luer & Dressler. A — Habit. B — Flower. C — Dissected perianth, flat. D — Column and
lip, lateral view. E — Lip, spread. F — Pollinarium and anther cap. Drawing by D. Bogarín and D. Jiménez based on
D. Bogarín 9698.

Distribution: endemic to the Cordillera de Talamanca and lower lobes, the lip lobes united and hiding
in southern Costa Rica and western Panama. the column and the variously pubescent, scaphoid
appendices may group all those species.
Etymology: from the Greek ankistra, “fish-hooks” in
allusion to the shape of the lower lobes of the petals.
3. Lepanthes otopetala Luer, Lindleyana 6: 76. 1991.
Habitat in Costa Rica: epiphytic in premontane wet
Type: Panama. Chiriquí, collected by A. Maduro,
forest, on the Pacific watershed of the Cordillera de
without locality, flowered in cultivation by J & L
Talamanca from 1500 to 2147 m of elevation. Plants
Orchids, Easton, CT, May 1990, C. Luer 14741
were found growing in primary oak forest.
(holotype, MO).
Phenology: Plants were recorded in flower in June and
Distribution: endemic to the Cordillera de Talamanca
July.
in southern Costa Rica and western Panama.
Costa Rican material studied: Puntarenas: Coto
Etymology: from the Greek otopetalon, “an ear-like
Brus, Sabalito, Zona Protectora Las Tablas, 13 km al
petal” in allusion to the ear-like upper lobes of the
noreste de Lucha, Sitio Coto Brus, Finca de la familia
petals.
Sandí-Hartmann, camino hacia la fontera Costa Rica
Panamá, 8°57’15.5” N 82°43’50.6” W, 2147 m, Habitat in Costa Rica: epiphytic in lower montane wet
floreció en cultivo de Daniel Jiménez, 12 julio 2012, forest, on the Pacific watershed of the Cordillera de
D. Bogarín 9698 (JBL-Spirit!; figs. 2, 14b). COSTA Talamanca at around 2400 m of elevation. Plants were
RICA-PANAMÁ. Puntarenas-Bocas del Toro: found growing on primary oak forest.
Coto Brus-Valle del Risco, línea fronteriza sobre la
Phenology: Plants were recorded in flower in April
divisoria de aguas ingresando por el camino de la
and May.
Finca Sandí-Hartmann “El Capricho”, 8°57’12.34”N
82°43’32.69”W, 2154 m, bosque pluvial montano Costa Rican material studied: Puntarenas-Chiriquí:
bajo, 11 Diciembre 2013, D.Bogarín 10741, A. Coto Brus-Renacimiento, línea fronteriza hacia el
Karremans, M. Fernández & L. Sandoval (JBL- Cerro Pando, después del mojón N.338, 8°55’11.22”N
spirit!). 82°43’18.18”W, 2446 m, bosque muy húmedo
montano bajo, epífitas en bosque primario, 19 abril
Among the Costa Rican Lepanthes, L. ankistra is
2011, D. Bogarín 8715, D. Jiménez & A.P. Karremans
recognized by the hanging, dark green-purple leaves
with mucronate apices. The inflorescences lie upon (JBL-Spirit!; figs. 3, 14c).
the surface of the leaves, within the central groove. This species shares features with the members of the
The flowers have pubescent petals with transverse Lepanthes disticha Garay & R.E. Schult. complex such
setiform lobes at the base of the upper and lower as the erect plants, blackish amplectent lepanthiform
lobes with sharply uncinate lower lobes. The lip bracts, the convex, elliptic leaves and inflorescences
lobes are hiding the column and the appendix is developed beneath the leaf. However, the matt dark
oblong, pubescent, scaphoid and conspicuous. This purple leaves, the whitish flowers, denticulate sepals,
species is closely related to L. brunnescens Luer, ciliate lip blades and the conspicuous ear-like upper
an endemic to Cerro Jefe in central Panama, but the lobe of the petals, which is longer and wider than the
latter species lacks the uncinate lobes of the lower lower lobe easily distinguish this species (Luer 1991).
lobes of the petals. These Lepanthes species are The voucher cited here was collected along the border
unusual in Costa Rica. They are indeed closely allied of Costa Rica and Panama.
to the South American L. mucronata Lindl., one of
the most frequent species of the genus in the Andes 4. Lepanthes truncata Luer & Dressler, Orquideología
(Luer 1996). Besides L. mucronata, there are at least 16(3): 9. 1986.
17 species from South America that may be related
to L. ankistra and L. brunnescens (Luer 1996). The Type: Panama. Prov. of Bocas del Toro: epiphytic in
transverse setiform lobes at the base of the upper wet forest between Fortuna and Chiriquí Grande,
264 LANKESTERIANA
B D
Figure 3. Lepanthes otopetala Luer. A — Habit. B — Flower. C — Dissected perianth, flat. D — Column and lip, lateral
view. E — Lip, spread. Drawing by D. Bogarín and D. Solano based on D. Bogarín 8715.

alt. 350 m, 17 February 1985, C. Luer, J. Luer, R.L. Plant minuscule, epiphytic, caespitose, erect,
Dressler & K. Dressler 10618 (holotype, MO). up to 2.0 cm tall, including the inflorescence. Roots
basal, flexuous, filiform. Ramicauls erect, slender, 1-2
Distribution: endemic to the Caribbean lowlands of
mm long, enclosed by tubular, imbricating, slightly
Costa Rica and Panama.
compressed, membranous sheaths, becoming brownish
Etymology: from the Latin truncatus, “truncate” in and papery with age. Leaf elliptic, erect, conduplicate,
allusion to the truncate apex of the upper lobes of the subacute, emarginate, abaxially keeled and terminating
petals. in a short apiculus, 5-8 × 2-3 mm, narrowed at the base
into a conduplicate petiole. Inflorescence racemose,
Habitat in Costa Rica: epiphytic in premontane rain distichous, successively flowered, with one flower
forest, on the Caribbean watershed of the Cordillera de open at a time, up to 1.2-1.3 cm long, peduncle to 6-8
Talamanca below 400 m of elevation. mm long, pedicels 1.0-2.0 mm long. Floral bracts
Phenology: Plants were recorded in flower from May acute, conduplicate, to 0.5 mm long. Ovary terete,
to October. smooth, to 0.4 mm long. Flowers sepals and petals
transparent yellowish-green, lip and column reddish-
Costa Rican material studied: Cartago-Limón: orange, about 4.5 mm in diameter. Dorsal sepal
Turrialba y Siquirres, Pacuarito-Tayutic, Parque narrowly lanceolate-elliptic, spreading widely, acute
Nacional Barbilla, sendero hacia el Río Dantas to shortly acuminate, marginally glandulose, 2.2-2.3 ×
(Venado), 9°58’27.35”N 83°27’00.33”W, 382 m, 0.7 mm. Lateral sepals subequal to the dorsal sepal,
bosque pluvial premontano, epífitas en bosque primario lanceolate-elliptic, spreading widely, acute to shortly
y secundario, 25 mayo 2012, D. Bogarín 9652, A.P. acuminate, marginally glandulose, 2.0-2.1 × 1.0 mm.
Karremans & J. Sharma (JBL-Spirit!; figs. 4, 14d–e). Petals spreading widely, narrowly elliptic-lanceolate,
acute to shortly acuminate, margins glandulose,
This species is recognized by the pendent plants
1-veined, 2.1 × 0.4 mm. Lip ovate-elliptic, shortly
with satiny leaves, the inflorescence is developed
acuminate, glandular-hirsute, especially at the apex,
above the leaf, the flowers have entire, yellowish
with a small glenion at the base, 1.5 mm x 0.7 mm.
sepals and petals and the lip is reddish-pink with
Column short, sub-cylindrical, 0.4 mm long. Anther
the blades separated, not hiding the column, and the
apical, stigma subapical, transversely bilobed at each
appendix is minute, pubescent. As noted by Luer &
side of the anther. Pollinia 2, ovoid. Note: Description
Dressler (1986), the most distinctive character of L.
based on Karremans 30, 5442, 5443 and Bogarín
truncata is the broadly truncate apex of the upper lobe
9661.
of the petals.
Paratypes: Costa Rica. Cartago: Turrialba, Turrialba,
5. Platystele catiensis Karremans & Bogarín, sp. nov. CATIE, río Reventazón, tramo Bajo del Chino–
Espaveles. 9°53’44” N 83°39’27” W, 600 m, 30 de
Type: Cartago: Turrialba, Turrialba, Campus del
enero del 2004, A.P. Karremans 30 & J. Velásquez
Centro Agronómico Tropical de Investigación y
(JBL-Spirit!). Turrialba, Turrialba, Campus del Centro
Enseñanza (CATIE), orillas del Río Reventazón,
Agronómico Tropical de Investigación y Enseñanza
9°53’38”N 83°38’55.5”W, 639 m, bosque muy
(CATIE), orillas del Río Reventazón, 9°53’38”N
húmedo premontano, epífitas bosque secundario
83°38’55.5”W, 639 m, bosque muy húmedo premontano,
detrás del edificio principal, 24 Mayo 2012, A.
epífitas bosque secundario detrás del edificio principal,
P. Karremans 5442, D. Bogarín & J. Sharma
24 mayo 2012, A. P. Karremans 5443, D. Bogarín &
(holotype, JBL-Spirit!; isotype, JBL-Spirit!; figs.
J. Sharma (JBL-Spirit!). Cartago-Limón: Turrialba y
5, 14f).
Siquirres, Pacuarito-Tayutic, Parque Nacional Barbilla,
Species haec P. oxyglossa (Schltr.) Garay similis, sed sendero hacia el Río Dantas (Venado), 9°58’27.35”N
floribus minoribus, petalis et labello quam sepalis 83°27’00.33”W, 382 m, bosque pluvial premontano,
aequilonguis, minutissime glandulosis, acutis, labello epífitas en bosque primario y secundario, D. Bogarín
ovato-elliptico glanduloso differt. 9661, A.P. Karremans & J. Sharma, 25 Mayo 2012
266 LANKESTERIANA
D
B
E
F A
Figure 4. Lepanthes truncata Luer & Dressler. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip,
lateral view. E — Lip, spread. F — Pollinarium and anther cap. Drawing by D. Bogarín and D. Solano based on D.
Bogarín 9652.

E A
Figure 5. Platystele catiensis Karremans & Bogarín. A — Habit. B — Flower. C — Dissected perianth. D — Column and
lip, lateral view. E — Lip, spread. F — Pollinarium and anther cap. G — Sepal margin. Drawing by D. Bogarín and
J.M. Ramírez based on A.P. Karremans 5442 (JBL-Spirit).

268 LANKESTERIANA
(JBL-Spirit!). Heredia: Sarapiquí, Puerto Viejo, Finca that grows up to 2 cm including the inflorescence (vs. 6
La Selva, 3 km SE of Puerto Viejo de Sarapiquí, 50- cm tall), a denser and shorter inflorescence which is up to
150 m, 22 Nov. 1979, C. Todzia 1035 (CR!). Sarapiquí, 1.3 cm long (vs. a stingy inflorescence up to 5 cm long),
Puerto Viejo, Estación Biológica La Selva, OTS field with 1.0-2.0 mm long pedicels (pedicels 2.5-7.0 mm
station near junction of Puerto Viejo and Sarapiquí long), with less than 5 mm between each one (distance
rivers. Elevation 40-100 m. Camino Circular Lejano between pedicels 2.0-5.0 mm long), and smaller flowers
(CCL) 950. 11 Mar. 1991, K. Richardson (CR!). with sepals and petals up to 2.3 mm long (vs. up to 3.5
Sarapiquí, Puerto Viejo, Estación Biológica La Selva, at mm long), and the lip up to about 1.5 mm long (vs.
the confluence of Río Sarapiquí and Río Puerto Viejo, 2.5 mm long). From the Guatemalan type material of
Atlantic slope. 10°26’00”N 84°01’00”W, 50-100 m, P. oxyglossa, P. catiensis can be distinguished by the
growing on twigs near major treefall along Camino shorter (2.2-2.3 mm), shortly acuminate and marginally
Circular Lejano, 12 Oct. 1990, M. Grayum 9994 (INB!). glandular sepals (vs. sepals 2.5 mm, long acuminate,
Limón: shores of Caño Perreira; periodically inundated glabrous), the petals and lip are longer, subequal to
swamp forest, Priora dominant. 20 Mar. 1897, W.D. the sepals, the petal margin is glandular, while the lip
Stevens, G. Herrera & O.M. Montiel 25151 (INB!; MO). is elliptic, and completely glandular-hirsute, especially
near the apex (vs. sepals and lip 1.5 mm, much shorter
Other Records: Costa Rica. Heredia: Sarapiquí, than the sepals, and are glabrous, the lip is ovate-
Puerto Viejo, Estación Biológica La Selva, O. Vargas lanceolate). It might well turn out that none of the Costa
2148 (Digital Photograph!). Rican material can be referred to P. oxyglossa. In that
Distribution: known only from Costa Rica. case the larger species found in the Central Cordillera
should be referred to as Platystele schulzeana (Schltr.)
Etymology: the name honors the Centro Agronómico Garay, described from La Carpintera. For the time
Tropical de Investigación y Enseñanza (CATIE), where being we only segregate the easily distinguished and
this species was first observed by the authors. CATIE morphologically constant P. catiensis, and point out
is, like Lankester Botanical Garden, celebrating its that the name P. oxyglossa has been applied to two
40th Anniversary in 2013. different species in Costa Rica. A few Brazilian species
Habitat in Costa Rica: epiphytic in primary and and have been placed under synonymy of P. oxyglossa, but
mature secondary humid premontane forest, at around from what we have seen they are most likely not the
300-650 m elevation. It is known from the Caribbean same species, and certainly are not the same as those
found in Costa Rica. The recently described Platystele
lowlands, especially the Sarapiquí, Siquirres and
paraensis Campacci & da Silva has the typical general
Turrialba areas. The species grows on the protected
flower morphology of the P. oxyglossa complex, and
dense mature vegetation right behind the main building
is as tiny as P. catiensis. It can be distinguished by the
of CATIE, where it is found on small branches that fall
single flowered inflorescence, the sepals that are long
from the large trees in the “Espaveles” path, which
caudate, that have an orange mid-vein and are much
descends to the Turrialba-Reventazón river. Likewise
longer than the lip, which is apically yellow-orange.
on the path that descends to Dantas river in the Barbilla
Flower morphology and size is similar to Platystele
National Park.
psix Luer & Hirtz, however the Ecuadorian species has
Phenology: flowering recorded from January to cellular-pubescent sepals and petals. Another similar
October, however it is likely it flowers all year round. species occurs in Panama and Ecuador, Platystele
taylorii Luer can be however recognized by the lip that
Platystele catiensis has been confused in Costa Rica
is long acuminate and exceeds the glabrous sepals.
with the apparently widely distributed and variable P.
oxyglossa. The latter is also found in the country (Luer
6. Platystele sylvestrei Karremans & Bogarín, sp. nov.
1990), but P. catiensis is typically found growing below
elevations of 650 m in the Caribbean lowlands (vs. Type: Costa Rica. Cartago: Paraíso, Orosi, Tapantí,
growing at an elevation of 1000-2500 m in the Central Parque Nacional Tapantí, camino entre el portón
and Talamanca Cordillera), it has a much smaller plant del Mirador hacia el Río Humo, Proyecto
Hidroeléctrico Tapantí, 9°41’32.9”N 83°47’03.2” Continental Divide, premontane cloud forest, 24

W, 1650 m, bosque pluvial premontano “supra March 2005, F. Pupulin 5595, E. Salas-Pupulin, D.
arbores et ad truncos prostratos vetustos ad Bogarín & A.C. Rodríguez (JBL-Spirit!). Puntarenas:
sylvarum versuras ad viam flumen Humo in Reserva Biológica Monteverde, Ojo de Agua,
Tapanti”, 18 Noviembre 2010, D. Bogarín 8240, Finca de Leonel Hernández. Bosque pantanoso
R. Gómez, A.P. Karremans, B. Klein, G. Meza & F. semiachaparrado. Lado Pacífico de la reserva.
Pupulin (holotype, JBL-Spirit!; fig. 6, 7). 10º15’N 84º46’W, 1600 m. 14 nov. 1987. W. Haber &
E. Bello 7808 (INB!; Illustration-INB!). Puntarenas:
Species haec P. oxyglossa (Schltr.) Garay similis, Puntarenas. Monteverde Cloud Forest Reserve. Pacific
sed planta majore, floribus autogamus albus, sepalis slope and continental divide, road to divide, swamp
petalisque angustissimis, labello angusto-ovato along Sendero Pantanoso and Sendero Chomogo.
lanceolato differt. 10º18’N 84º47’W, 1550-1600 m. Epiphyte. 14 Mar.
Plant medium for the genus, epiphytic, caespitose, 1990. W. Haber & W. Zuchowski 9798 (INB!).
erect, up to 12-13 cm tall, including the inflorescence. Costa Rica - Panama: Puntarenas-Bocas del Toro:
Roots basal, flexuous, filiform. Ramicauls erect, Coto Brus-Valle del Risco, línea fronteriza sobre la
slender, 5-8 mm long, enclosed by tubular, divisoria de aguas ingresando por el camino de la
imbricating, slightly compressed, membranous Finca Sandí-Hartmann “El Capricho”, 8°57’12.34”N
sheaths, becoming brownish and papery with age. 82°43’32.69”W, 2154 m, bosque pluvial montano
Leaf narrowly obovate-elliptic, erect, conduplicate, bajo, 11 diciembre 2013, A.P. Karremans 6130, D.
obtuse, emarginate, 20-35 × 5-7 mm, narrowed at Bogarín, M. Fernández & L. Sandoval (JBL-Spirit!;
the base into a conduplicate petiole. Inflorescence fig. 7A). Same locality and date, D. Bogarín 10744,
racemose, distichous, successively flowered, with A.P. Karremans, M. Fernández & L. Sandoval (JBL-
one flower mature (not necessarily open) at a time, Spirit!; fig. 7b).
up to 12 cm long, peduncle to 7 cm long, pedicels Distribution: known only from Costa Rica and
1.0-1.5 cm long. Floral bracts acute, conduplicate, Panama.
to 1 mm long. Ovary terete to suborbicular, smooth,
to 2 mm long (fertilized). Flowers cleistogamous or Etymology: El Silvestre (the uncultivated) was the
autogamous (at least in the material at hand), sepals name of Charles H. Lankester’s farm before becoming
and petals transparent whitish, with a violet blotch on Lankester Botanical Garden in the hands of the
the base of the lip and violet markings on the column, University of Costa Rica. This species honors the
about 4 mm in diameter. Dorsal sepal narrowly ovate, garden’s 40th anniversary.
spreading widely, acute, glabrous, 2.3-2.4 × 0.5 mm. Habitat in Costa Rica: epiphytic in mature humid
Lateral sepals subequal to the dorsal sepal, narrowly premontane forest, between 1410 and 1650 m
ovate, spreading widely, acute, glabrous, 2.3 × 0.6- elevation. It is known from a few but distant localities,
0.7 mm. Petals spreading widely, linear to narrowly
Tapantí National Park in Cartago, close to San Ramón
lanceolate, acute, margin somewhat irregular,
in Alajuela, the Monteverde area in Puntarenas, and on
1-veined, 2.0 × 0.2-0.3 mm. Lip very narrowly ovate-
both sides of the continental divide close to the Costa
lanceolate, shortly acuminate, glabrous, without an
Rica - Panama border.
evident glenion at the base, 1.6-1.7 × 0.5 mm. Column
short, thick due to autogamy, sub-cylindrical, 0.5 mm Phenology: flowering recorded at least in March
long. Anther not noted, stigma deformed, apical. and November and December, considering the
Pollinia not observed. Note: Description based only successiveness of the inflorescence it is likely found
on Bogarín 8240. flowering-fruiting all year round.
Paratypes: Costa Rica. Alajuela: San Ramón, Platystele sylvestrei probably belongs to the P.
Piedades, unpaved road from Piedades Norte to oxyglossa species complex, however, it has a relatively
Piedades Sur, San Antonio de Zapotal, 10º09’51.9”N large habit, reaching above 10 cm when including the
84º35’36.5”W, 1410 m, Caribbean watershed of the inflorescence. The species can be easily recognized by
270 LANKESTERIANA
B D
Figure 6. Platystele sylvestrei Karremans & Bogarín. A — Habit. B — Flower. C — Dissected perianth. D — Column and
lip, lateral view. E — Fruit with persistent perianth, lateral view. Drawing by D. Bogarín and J.M. Ramírez from D.
Bogarín 8240 (JBL-Spirit).

Figure 7. Platystele sylvestrei Karremans & Bogarín. A — A rare case of a fully opening flower, already pollinated
(Karremans 6130) . B — Plant habit showing the long lax inflorescences with the characteristic fruiting (Bogarín
10744). Photographs by A.P. Karremans (A) and D. Bogarín (B).
the lax inflorescence, the long pedicels, the whitish- slightly compressed, membranous sheaths, becoming
transparent, autogamous/cleistogamous flowers and brownish and papery with age. Leaf elliptic, erect,
the narrow, glabrous flower segments, with a narrowly fleshy, coriaceous, conduplicate, subacute, emarginate,
ovate-lanceolate lip. abaxially keeled and terminating in a short apiculus, 5-7
× 1.5-2.5 mm, narrowed at the base into a conduplicate
7. Platystele tica Karremans & Bogarín, sp. nov. petiole. Inflorescence racemose, distichous, successively
Type: Costa Rica. Puntarenas: Buenos Aires, flowered, with one flower open at a time, up to 1.5 cm
Volcán, 09°13’N, 83°26’W, ca. 450 m, bosque long, peduncle to 1.2 cm long, pedicels 1.5-2.0 mm
muy húmedo premontano transición a basal en long. Floral bracts acute, conduplicate, to 0.5-0.8 mm
bosque secundario muy alterado a orillas de un long. Ovary terete, smooth, to 0.3 mm long. Flowers
riachuelo, 17 de abril 2012, A.P. Karremans 5315, monochrome yellow, about 1.8 mm in diameter. Dorsal
J. Cambronero & J. Geml (holotype, JBL-Spirit!; sepal narrowly ovate-elliptic, spreading widely, acute,
isotype, JBL-Spirit!; figs. 8, 9, 14g–h). glabrous, 0.9 × 0.5 mm. Lateral sepals subequal to the
dorsal sepal, broadly elliptic, spreading widely, acute,
Species haec P. oxyglossa (Schltr.) Garay similis, sed
glabrous, 0.9 × 0.7 mm. Petals spreading widely,
planta minutissima, floribus minutissimis flavis, sepalis
narrowly elliptic-lanceolate, acute, margins irregular,
petalisque acutis latiores, labello ovato acuto differt.
1-veined, 0.9 × 0.3 mm. Lip ovate, shortly acuminate,
Plant minuscule, epiphytic, caespitose, erect, glandular, especially at the apex, margin irregular,
up to 2.0 cm tall, including the inflorescence. Roots with a small glenion at the base, 0.8-0.9 × 0.4-0.5 mm.
basal, flexuous, filiform. Ramicauls erect, slender, Column short, sub-cylindrical, 0.3-0.4 mm long. Anther
1-2 mm long, enclosed by 2-3 tubular, imbricating, apical, stigma subapical, transversely bilobed at each
272 LANKESTERIANA
Figure 8. Size comparison of Platystele tica Karremans & Bogarín: A — The specimen that served as type material, in
situ, compared with a pencil. B — On the left Platystele microtatantha (Schltr.) Garay (Bogarín 10241), on the right
Platystele tica (Karremans 5929A). Photographs by A.P. Karremans.

Figure 9. Platystele tica Karremans & Bogarín. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip,
lateral view. E — Column, front view. F —Pollinarium and anther cap. G — Sepal margin. Drawing by D. Bogarín and
J.M. Ramírez based on A.P. Karremans 5315 (JBL-Spirit).

274 LANKESTERIANA
side of the anther. Pollinia 2, ovoid. Note: Description Platystele tica is without obvious close relatives in
based on Karremans 5315, 5829A and Pupulin 2928. Costa Rica. General plant morphology would suggest
affinity with the P. oxyglossa group, as does the lip
Paratypes: Costa Rica. Puntarenas: Buenos
shape. The new species, however, lacks the typical
Aires, Volcán, Cacao, orillas del Río Cacao en
caudate sepals and the reddish-purplish coloring of
bosque secundario bajo el puente de la Carretera
the lip. Flower coloration and size are somewhat
Interamericana, 9°13’10.441”N 83°28’19.002”W, 449
reminiscent of Platystele minimiflora (Schltr.) Garay,
m, bosque muy húmedo premontano transición a basal,
however that species has a creeping habit. P. tica
20 marzo 2013, A.P. Karremans 5829A, D. Bogarín, J.
has one of the smallest flowers in the genus rivaled
Cambronero & F. Pupulin (JBL-Spirit!; figures 8 & 9).
only by that of P. enervis Luer, P. ornata Garay and
San José: Pérez Zeledón, El Brujo, road to El Llano,
P. umbellata P.Ortiz. It makes the previous Costa
along the boarder of río División, 320 m, 9°25’40”N
Rican famous dwarfs, P. jungermannioides (Schltr.)
83°54’58”W, epiphytic on tall trees along the river
Garay and P. microtatantha (Schltr.) Garay, look large.
shore, 21 Jan. 2001, F. Pupulin 2928, D. Castelfranco
This species might not necessarily be rare, we have
& L. Elizondo (JBL-Spirit!).
observed at least a couple of specimens more in the
Other records: Costa Rica. San José: Tarrazú. No field and photographed by enthusiasts, but considering
protegida. Cuenca del Naranjo y Paquita. Valle del the minuscule size of the plant and flower, the lack
General, Longo May. Río Sonador, 1400-1800 m, of herbarium collections and habitat loss in the area
9°36’30”N 84°06’00”W, epífita, 16 may 2006, J. F. it grows, it is not unsurprising that it had escaped
Morales 13937 (INB!; INB-Spirit). Geographical description.
distribution, plant habit and size, and flower coloration
suggests that this specimen is P. tica, however, the 8. Ponthieva villosa Lindl., Pl. Hartw. 155. 1845.
flowers on the dried specimen are too damaged to tell
with certainty and we were not able to locate the spirit Type: Ecuador. In montibus Paccha rarissima, T.
specimen. Hartweg s.n. (holotype: K). Syn. Ponthieva crinita
A text and its accompanying photographs by Pontus Garay, Fl. Ecuador 9: 214. 1978 (AMES!).
Aratoun featuring a Platystele species from Mecana Distribution: Costa Rica, Colombia, Ecuador and
beach, Choco, Colombia (available through http:// Peru.
miniorchids.wordpress.com), possibly represents the
same species. Etymology: from the Greek κυστις, “bladder”, “cyst”
in reference to the prominent ventral vesicle behind the
Distribution: known only from Costa Rica. It may also
perianth.
be present southwards into Colombia.
Habitat in Costa Rica: the only known specimen was
Eponymy: the name honors Costa Rica, country where
found growing as an epiphyte on a roadside close to
this minuscule species was found, and the people of
Tapantí National Park, in sub montane wet forest, at
which are known as tico and tica. The nickname tico
about 1500 m.
or tica comes from the Costa Rican linguistic custom
of using it as a diminutive suffix, alluding thus as well Costa Rican material studied: Cartago: Paraíso,
to the small size of this Platystele. Orosi, Tapantí, sobre el camino a Tausito, unos 4 km
Habitat: epiphytic in secondary forest in premontane del cruce al Parque Nacional Tapantí, 9°46’27.82”N
wet forest, between about 300 and 450 m (1400-1800 83°46’54.57” W, 1513 m, epífitas sobre árboles al lado
m?) elevation. It is known only from the Costa Rican de la calle, bosque pluvial premontano, 12 de febrero
south-Pacific, in the Valle de El General area. 2012, A.P. Karremans 5040 (CR!; figs. 10, 14i).
Phenology: flowering recorded at least from April The specimen here cited was collected singly, in
to June, however considering the slowly successive bloom, on a roadside of a frequented collecting site,
inflorescences, each is likely to flower continuously and was initially thought to be a novelty. However,
for months at a time. the illustrations of Ponthieva villosa from Ecuador
B D
A
E
Figure 10. Ponthieva villosa Lindl. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip, lateral view.
E — Lip. F — Capitate hairs of the sepal margins. Drawn by A. P. Karremans and J. M. Ramírez from A.P. Karremans
5040 (JBL-Spirit).

276 LANKESTERIANA
in Dodson and Dodson (1989) and from Colombia the lateral sepals partially connate with erect sides
in Ortiz (1991), and the type specimen of P. crinita towards the base, the parallel petals slightly widened
(which has been considered a synonym of P. villosa), at the apex, the trilobed lip with the lateral lobes erect,
are so similar to the Costa Rican plant that we are oblique, and two inner, erect blades; the column is half
unable to distinguish them with the material and the length of the lip, widened towards the apex.
information at hand. Unfortunately not much is known The specimen here cited was found growing in the
about P. villosa in general, the original description is premontane wet forest of La Marta Wildlife Refuge,
quite superficial and we have not been able to see the located in the Costa Rican Atlantic lowlands. Based
holotype. The specimen collected close to Tapantí is on the available literature, the only specimen known
in any case a species morphologically quite distinct before this record was that of the type specimen, which
to any previously reported species of Ponthieva from was coincidentally found in the Atlantic lowlands
Costa Rica, and for now will bear the name P. villosa. of western Panama, near the border with Costa
It can be recognized by the epiphytic plants that are Rica. Opposed to the type specimen, no evidence of
completely hirsute, from the leaves to the back of the cleistogamy was observed in the Costa Rican plant.
sepals. The leaves are quite narrow, with the margins Likewise, the lateral sepals of the latter remained
undulate. The sepals are greenish, while the petals almost entirely connate until the flower decayed.
are yellowish-green with a large white spot above the
middle. The lateral sepals are almost entirely free. The 10. Sobralia bletiae Rchb.f., Bot. Zeitung (Berlin) 10:
lip is prominently concave and glossy. 713. 1852.
Type: : “Chiriqui” Panama, Warszewicz s.n. (holotype,

9. Restrepia aberrans Luer, Orquideología 20(2): 117.
W).
1996.
Distribution: Venezuela, Ecuador, Panama, Costa
Type: Panama. Bocas del Toro, epiphytic in forest
Rica and Nicaragua.
above Chiriquí Grande, alt. 350 m, 17 Feb 1985,
collected by C. Luer, J. Luer, R. Dressler & K. Etymology: most probably refers to the similarity of
Dressler, flowered in cultivation by A. & P. Jesup the flower with those of Bletia.
in Bristol, CT., 26 Apr 1987, C. Luer 10612
Habitat in Costa Rica: Known from the tropical wet
(holotype, MO).
forests of the Osa peninsula in southern Costa Rica,
Distribution: Costa Rica and Panama. growing at low elevations in secondary forests.
Etymology: from the Latin aberrans, “aberrant”, Costa Rican material studied: Puntarenas: Osa,
referring to unusual floral features that occur in no Sierpe, camino a Bahía Drake, entre Rincón y Rancho
other species of the genus (Luer 1996). Quemado, 8°40’52.3”N 83°32’57.5”W, 214 m, en
bosque secundario y cercas a orillas del camino, bosque
Habitat in Costa Rica: Known only from the
muy húmedo tropical “sylvas ad peninsula Osa regione
premontane wet forests of Costa Rican Atlantic
sinus Dulce versus Drake prope Rancho Quemado”,
watershed between 350 m to 790 m of elevation,
13 marzo 2011, D. Bogarín 8497, A.P. Karremans & J.
growing on branches of Ficus sp.
Sharma (JBL-Spirit!; figs. 12, 14k); Puntarenas: Osa,
Costa Rican material studied: Cartago: Jiménez, P.N. Piedras Blancas, 8.69 -83.23, Estacion Rio Bonito,
Pejibaye, La Marta, laderas del río Gato. Reserva 100 m, E. Fletes 424 (INB, MO); Puntarenas: Osa,
Biológica La Marta, sendero Tepemechines, creciendo Rincón de Osa. Streams and slopes adjacent to airfield,
en ramas de Ficus sp. 9º46’52”N 83º41’15”W, 790 m, 08°42’N 083°31’W, 20 - 300 m, epiphytic in disturbed
colectada por Daniel Jiménez en mayo del 2012, A.P. primary forest, 6-7 Feb. 1974, R. L. Liesner 1817 (MO).
Karremans 5069 (JBL-Spirit!; figs. 11, 14j).
The habit of S. bletiae is similar to that of several
Restrepia aberrans can be recognized by the other Sobralia, such as S. decora Bateman and S.
narrowly triangular dorsal sepal, concave at the base, mucronata Ames & C.Schweinf. It can be recognized
B E
Figure 11. Restrepia aberrans Luer. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip, lateral view.
E — Column, front view. F — Lip, spread. G —Pollinarium and anther cap. Drawing by D. Bogarín & M. Fernández
based on A.P. Karremans 5069 (JBL-Spirit).

278 LANKESTERIANA
B
C
E D
Figure 12. Sobralia bletiae Rchb.f. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip, lateral view.
E — Column, front view. F — Lip, spread. G —Pollinarium and anther cap. Drawing by D. Bogarín and M. Fernández
based on D. Bogarín 8497 (JBL-Spirit).

B D
F C
Figure 13. Trichosalpinx caudata Luer. A — Habit. B — Flower. C — Dissected perianth. D — Column and lip, lateral
view. E — Column, front view. F — Lip, spread. G —Pollinarium and anther cap. Drawing by M. Fernández based on
M. Fernández 546 (JBL-Spirit).

280 LANKESTERIANA

by the small, tubular flower with creamy, parallel Carretera Interamericana, La Ese, km 114-122, orilla de
sepals and petals, the trilobed lip with five to seven, la carretera, 9°26’N 83°35’W, 1200-1400 m, 12 julio
red-to-brown keels, and a mucronate apex. The column 2005, A. Rojas 6474 & H. Kennedy (JBL-Spirit!).
narrows towards the base, and the pollinia are dorsally
Trichosalpinx caudata and T. orbicularis (Lindl.)
flattened. Luer are vegetatively almost indistinguishable.
Although several authors had reported this species Nevertheless, the long, caudate sepals of the first are
as present in Costa Rica (Ames 1937, Williams 1956, the most conspicuous differentiating character. The
Mora & García 1992, Dressler 1993, García et al. 1993), sepals can reach up to 8.5 mm long (vs. 3.5-6.5 mm),
the existence of two Costa Rican herbarium specimens the dorsal sepal is narrowly triangular (vs ovate),
was unknown until relatively recently (Pupulin 2002, while the lateral sepals are connate only at the base,
Dressler 2003): R. L. Liesner 1817 (MO), and E. long-attenuate, and have a widened and fleshy apex.
Fletes 424 (INB, MO), both from the lowlands of the The petals are narrowly acute to acuminate (vs. acute
Península de Osa. This species is illustrated for the first to obtuse), densely fimbriate. The lip is usually twice
time based on Costa Rican material. longer than the column (vs. one-third longer than
column).
11. Trichosalpinx caudata Luer & R.Escobar, Monogr.
Syst. Bot. Missouri Bot. Gard. 64: 20. 1997. Acknowledgements. We are thankful for the scientific
services of Costa Rican Ministry of Environment and
Type: Colombia. Antioquia: La Tebaida, collected by
Energy (MINAE) and its National System of Conservation
E. Valencia, July 1988, flowered in cultivation at Areas (SINAC) for issuing the Scientific Passports under
Colomborquídeas, 16 May 1993, C. Luer 16907 which wild species treated in this study were collected. To
(MO). the Vice-Presidency of research of the University of Costa
Rica for providing support under the projects “Inventario y
Distribution: Costa Rica, Panama and Colombia.
taxonomía de la flora epífita de la región Mesoamericana”
Etymology: from the Latin caudatus, “caudate”, (814-A7-015), “Flora Costaricensis: Taxonomía y Filogenia
referring to the tails of the lateral sepals (Luer 1997). de la subtribu Pleurothallidinae (Orchidaceae) en Costa
Rica” (814-BO-052), “Filogenia molecular de las especies
Habitat in Costa Rica: T. caudata has been found de Orchidaceae endémicas de Costa Rica” (814-B1-239)
growing epiphytically at low elevations in disturbed and “Hacia una moderna flora de orquídeas de Panamá”
areas close to water bodies along the northern Atlantic (814-B2-161). We are also grateful to the personnel at
plains and in open areas of the Osa Peninsula, mostly CR, INB, JBL and USJ for granting full access to their
at 100–250 m [to 1200-1400 m] . collections. Finally, we are grateful to Joan M. Ramírez and
Darha Solano, illustrators at JBL, who prepared some of the
Costa Rican material studied: Alajuela: San Carlos, plates included in the article.
Boca Tapada, alrededores del Hotel Laguna de río
Lagarto, en jardín del hotel Arenal Paraíso, 100 m, 10 Literature Cited
oct 2004, C. Ossenbach 368 & P. Casasa (JBL-Spirit!). Ames, O. 1937. Orchidaceae. Orchid Family. In P. C.
Puntarenas: Osa, Cortés, fila Dominicalito, 250 m, D. Standley (ed.) Flora of Costa Rica. Vol. 18. Field
Museum of Natural History – Botany, p. 292.
Jiménez invenit, M. Fernández 546 (JBL-Spirit!; figs.
Bogarín, D. 2011. How many orchid species in Costa Rica?
13, 14l). Puntarenas: Osa, San Juan, cuenca media del A review of the latest discoveries. In: A. M. Pridgeon
río San Juan, siguiendo el curso aguas arriba, 200 m, flor & H. G. Navarrete Zambrano (eds.). Proceedings of the
morada de ápice anaranjado, conspicuo, 5 noviembre Third Scientific Conference on Andean Orchids, Quito.
1990, G. Herrera 4568 (CR!). San José: Pérez Zeledón, Lankesteriana 11(3): 185—205.
Left, Figure 14. A ⎯ Epidendrum jorge-warneri, (A.P. Karremans 5545). B ⎯ Lepanthes ankistra (D. Bogarín 9698). C
⎯ Lepanthes otopetala (D. Bogarín 8715). D & E ⎯ Lepanthes truncata (D. Bogarín 9652). F ⎯ Platystele catiensis
(A.P. Karremans 5442). G & H ⎯ Platystele tica (A.P. Karremans 5315). I ⎯ Ponthieva villosa (A.P. Karremans 5040).
J ⎯ Restrepia aberrans (A.P. Karremans 5069). K ⎯ Sobralia bletiae (D. Bogarín 8497). L ⎯ Trichosalpinx caudata
(M. Fernández 546). Photographs by D. Bogarín (B, C, D, E), M. Fernández (J, K), D. Jiménez (L), A. Karremans (A,
F, G, I) and F. Pupulin (H).

282 LANKESTERIANA
Bogarín, D. & A. P. Karremans. 2010. Un nuevo Platystele Luer, C.A. 1996a. Icones Pleurothallidinarum XIV.
(Orchidaceae: Pleurothallidinae) de la región central Systematics of Draconanthes, Lepanthes subgenus
de Costa Rica/A new Platystele (Orchidaceae: Marsipanthes, and subgenus Lepanthes of Ecuador
Pleutothallidinae) from central Costa Rica. (Orchidaceae). Part Three: The genus Lepanthes
Orquideología 27: 208—220. subgenus Lepanthes in Ecuador. Monogr. Syst. Bot.
Bogarín, D., A. P. Karremans & F. Pupulin. 2008. New Missouri Bot. Gard. 61:1—255.
records and species of Orchidaceae from Costa Rica. Luer, C.A. 1996b. Nuevas especies de Restrepia – New
Lankesteriana 8(2): 53—74. species of Restrepia. Orquideología 20(2): 117—120.
Dodson, C.H. & P.M. de Dodson. 1989. Icones Plantarum Luer, C.A. 1997. Systematics of Trichosalpinx. Monogr.
Tropicarum 2(6): Orchids of Ecuador. Missouri Syst. Bot. Missouri Bot. Gard. 64: 20.
Botanical Garden. Luer, C. A. 2003. Platystele. Pp. 216—255 in: B. E.
Dressler, R. L. 1993. Field Guide to the Orchids of Costa Hammel, M. H. Grayum, C. Herrera & N. Zamora
Rica and Panama. Cornell University Press, p. 319. (eds.). Manual de plantas de Costa Rica – Volumen
Dressler, R. L. 2003. Sobralia. Pp. 506—516 in: B. E. III, monocotiledóneas (Orchidaceae-Zingiberaceae).
Hammel, M. H. Grayum, C. Herrera & N. Zamora Monogr. Syst. Bot. Missouri Bot. Gard. 93.
(eds.). Manual de plantas de Costa Rica – Volumen Luer, C.A. & R.L. Dressler. 1986. Nuevas especies de
III, monocotiledóneas (Orchidaceae-Zingiberaceae). Lepanthes de Panamá. Orquideologia 16(3): 3—26.
Monogr. Syst. Bot. Missouri Bot. Gard. 93. Mora-Retana, D.E. & J.B. García. 1992. Lista actualizada
García Castro, J. B., D. E. Mora de Retana & M. E. Rivas de las Orquídeas de Costa Rica. Brenesia 37: 79—124.
Rossi. 1993. Lista de Orquídeas Comunes a Costa Rica Ortiz, P. 1991. Ponthieva R.Br. Pp. 444—447 in: R. Escobar
y Panamá. Brenesia 39—40: 106. (ed.). Orquideas Nativas de Colombia – Volumen 3:
Karremans, A.P. & D. Bogarín. 2013. Costa Rica, land of Maxillaria-Ponthieva. Compañía Litográfica Nacional
endless orchids. Orchids (West Palm Beach) 82(7): S.A. Medellín.
408—411. Pupulin, F. 2002. Catálogo revisado y anotado de las
Karremans, A.P., D. Bogarín, M. Fernández, C.M. Smith & M. Orchidaceae de Costa Rica. Lankesteriana 4: 1—88.
Blanco. 2012. New species and records of Orchidaceae Sánchez, S. L. & E. Hágsater. 2007. Epidendrum
from Costa Rica. II. Lankesteriana 12(1): 19-51. anoglossoides Ames & C.Schweinf. In Hágsater. E. &
Luer, C.A. 1990. Icones Pleurothallidinarum VII: L. Sánchez S. (eds.) Icon. Orchid. 9. pl. 907.
Systematics of Platystele (Orchidaceae) Monogr. Syst. Williams, L.O. 1956. An enumeration of the Orchidaceae of
Bot. Missouri Bot. Gard. 38: 1—115. Central America, British Honduras and Panama. Ceiba
Luer, C.A. 1991. New species of Lepanthes (Orchidaceae). 5(1): 25.
Lindleyana 6(2): 64—83.

LANKESTERIANA 13(3): 283—290. 2014.
El Grupo Epidanthus, Subgrupo Selaginella de Epidendrum
Eric Hágsater & Elizabeth Santiago Ayala
Herbario AMO, Montañas Calizas 490, México, D.F. 11000, México

herbamo@prodigy.net.mx, www.herbarioamo.org
Resumen. La revisión de una gran cantidad de ejemplares de herbario determinados como Epidendrum
selaginella Schltr. que mostraban diferencias foliares evidentes comparadas con el ejemplar tipo que sirvió para
describir esta especie ampliamente distribuida en Costa Rica y Panamá así como el análisis de los segmentos
florales de los mismos permitieron reconocen 2 nuevas especies muy cercanas a Epidendrum selaginella y
por mucho tiempo confundidas con esa especie centroamericana: Epidendrum astroselaginella y Epidendrum
stenoselaginella. Se presenta una clave ilustrada.
Abstract. The revision of a large number of herbarium specimens determined as Epidendrum selaginella Schltr.
and which had evident foliar differences compared to the type served to prepare a detailed description of this
widely distributed species in Costa Rica and Panama, and an analysis of the floral segments led to the recognition
of two new species closely allied to Epidendrum selaginella, and confused with that Central American species:
Epidendrum astroselaginella, and Epidendrum stenoselaginella. An illustrated key is provided.
Key words: Epidendrum selaginella, astroselaginella, stenoselaginella, Epidanthus, Costa Rica
Epidendrum, es considerado uno de los géneros también evaluaron este grupo, el primero opinando que
más grandes de orquídeas neotropicales. Está efectivamente debía tratarse como género separado,
constituido por unas 1500 especies distribuidas y el segundo estableciéndolo como un subgénero de
desde el sur de los Estados Unidos hasta el norte de Epidendrum, y agregando una especie nueva. Con
Argentina (Hágsater 1985). En el transcurso de los el estudio de las numerosas especies que integran el
años, muchos autores han intentado dividirlo en género Epidendrum, se ha demostrado que el número
subgéneros (Barringer 1991), los cuales han llegado a de polinios no representa una característica exclusiva
reconocerse, en varios casos, como géneros (Williams del grupo Epidanthus. En el género Epidendrum,
1940), basándose en características como el número existen especies que tienen 2, 4 y hasta 8 polinios
de polinios, la presencia de tallos engrosados y/o la (Hágsater & Santiago 2010).
posición en la que se produce la inflorescencia. Con El grupo Epidanthus, es de pocas especies y se
cerca de 300 especies secuenciadas en su ADN, hemos caracteriza por tener plantas pequeñas, escandentes
llegado a la conclusión de que se trata de un género con tallos muy delgados, hojas cortas y angostas, algo
monofilético en donde se pueden reconocer diversos carnosas con una lígula diminuta opuesta a la lámina
grupos y sub grupos con características vegetativas foliar, inflorescencia apical, usualmente secundiflora con
similares (Hágsater & Soto 2005). flores pequeñas. Está ampliamente distribuido desde el
En 1940, Williams, tomando en cuenta básicamente sur de México hasta Ecuador, con particular diversidad
en el número de polinios, propuso al grupo Epidanthus en Centro América. Actualmente, consideramos que está
como un género: Epidanthus L.O. Williams y formado por 11 especies divididas en dos subgrupos:
transfirió a este género 3 especies de Epidendrum: el subgrupo Epidanthus (que incluye a las especies
E. paranthicum Rchb.f., E. muscicolum Schltr. y E. que tienen hojas semiteretes, 2 polinios y el labelo
goniorhachis Schltr. Garay (1977) y Barringer (1991) generalmente 3-lobado, (con excepción de Epidendrum
* Este artículo fue preparado en el marco de las celebraciones del 40 Aniversario del Jardín Botánico Lankester.
284 LANKESTERIANA
Figura 1. Epidendrum selaginella Schltr. basado en E.Hágsater 6537, Panamá: Cerro Horqueta, testigo: AMO A-589. Foto
E. Hágsater.
goniorhachis que tiene el labelo entero), y el subgrupo de forma distinta. La lámina foliar de estas plantas era
Selaginella, que incluye a las especies con hojas planas, claramente linear lanceolada y de una anchura menor a
4 polinios y de labelo entero, en el cual ésta incluido las hojas de E. selaginella (Santiago y Hágsater 2007;
Epidendrum selaginella Schltr. Fig. 4). Estudiando detenidamente éstos ejemplares,
Revisando detenidamente una gran cantidad del rehidratando flores e ilustrando los segmentos florales
material de herbario determinado bajo el nombre de de varias de éstas plantas, encontramos además, que
Epidendrum selaginella (Fig. 1 y 4), encontramos 2 había diferencias también con respecto a las flores.
nuevas especies relacionadas, y por mucho tiempo En algunos ejemplares, las flores estaban laxamente
confundidas con ésta especie bastante común y distribuidas a lo largo del raquis y la mecánica de
ampliamente distribuida en Costa Rica y Panamá. la antesis de los segmentos florales también era
Epidendrum selaginella fue descrita por Rudolf notoriamente distinta (la posición de los mismos
Schlechter en 1906 a partir de un ejemplar colectado era casi totalmente extendida). Notando que éstas
por J. Cooper en Costa Rica: Se reconoce fácilmente características se mantenían de forma constante
por sus plantas pequeñas (de no más de 12 cm de alto, entre éstas plantas, en el año de 2007 procedimos a
incluyendo la inflorescencia) con tallos tipo caña, describir dos especies nuevas. Una bajo el nombre de
hojas cortas y planas, generalmente ovadas con el Epidendrum astroselaginella Hágsater & E.Santiago
ápice bilobado, con inflorescencias secundifloras de 5 (Hágsater y Santiago 2007a; Fig. 2 y 5); la etimología
a 7 pequeñas flores verdes o amarillo verdosas. Uno del epíteto de ésta especie, hace referencia a la posición
de los detalles que llamó nuestra atención cuando extendida de los segmentos florales y que recuerda a
revisamos el material herborizado fue precisamente la una estrella. Había otro pequeño grupo de ejemplares,
forma de las hojas en algunos ejemplares determinados de hojas angostas también, con la inflorescencia
bajo el nombre de ésta especie, los cuales tenían hojas similar a Epidendrum selaginella, pero con diferencias
Hágsater & Santiago — El subgrupo Epidendrum selaginella 285
a nivel floral. A éste segundo grupo de colectas, de una

distribución más amplia que va desde Nicaragua hasta
Panamá (Fig. 7), lo describimos como Epidendrum
stenoselaginella Hágsater & E. Santiago (Hágsater y
Santiago. 2007b; Fig. 3 y 6); el epíteto hace referencia
a las hojas más angostas, comparada con E. selaginella.
Clave de identificación de las especies del grupo

Epidanthus, subgrupo Selaginella
El subgrupo Selaginella se caracteriza por sus

hojas aplanadas, semejantes en tamaño y forma,
generalmente cortas (2.7-10.5 mm de largo), el labelo
entero y la antera con 4 polinios.
1 Hojas ovadas a oblongo ovadas, hasta 3.4 mm de

ancho, flores distribuidas densamente hacia el ápice
de la inflorescencia, ovario y dorso de los sépalos
densamente papilosos; Costa Rica y Panamá
E. selaginella Schltr.
Figura 2. Epidendrum astroselaginella Hágsater & 1’ Hojas linear lanceoladas, hasta 1.9 mm de ancho,
E.Santiago basado en E.Hágsater s.n., Jardín Botánico flores distribuidas laxamente en la inflorescencia,
Lankester, Costa Rica. Foto E. Hágsater. ovario y sépalos glabros 2
Figura 3. Epidendrum stenoselaginella Hágsater & E.Santiago basado en E.Hágsater 11115; Costa Rica: Volcán Poás-San
José, testigo: AMO 15886, holotipo. Foto: E. Hágsater.
286 LANKESTERIANA
Figura 4. Epidendrum selaginella Schltr. basado en R.L.Dressler 5730; Panamá, Coclé, 8 km N of El Copé; testigo: AMO
2329. Dibujo de R. Jiménez Machorro.
Figura 5. Epidendrum astroselaginella Hágsater & E.Santiago basado en L.D.Gómez P. 23814, Costa Rica, Cordillera de
Talamanca; testigo: MO 3586978, holotipo. Dibujo de R. Jiménez Machorro.
288 LANKESTERIANA
Figura 6. Epidendrum stenoselaginella Hágsater & E.Santiago basado en E.Hágsater 11115, Costa Rica, Volcán Poás-San
José; testigo: AMO 15886, holotipo. Dibujo de R. Jiménez Machorro.
Figura 7. Mapa de distribución de Epidendrum selaginella, E. stenoselaginella y E. astroselaginella.
2 Segmentos florales extendidos, sépalos 3.5-4.2 Hágsater, E. y M.A. Soto. 2005. Epidendrum. En A.M.
mm de largo, labelo proporcionalmente más largo Pridgeon, P.J. Cribb, M.W. Chase y F.N. Rasmussen
que ancho, columna con un par de dientes laterales (eds.). Genera Orchidacearum 4: Epidendroideae, part
one: 236-251. Oxford University Press, Cambridge, U.K.
prominentes; Costa Rica y Panamá
Hágsater, E. y E. Santiago. 2007a. Epidendrum
E. astroselaginella Hágsater & E.Santiago
astroselaginella. En Hágsater, E. & L. Sánchez Saldaña
2’ Segmentos florales entreabiertos, sépalos 2.5-3 mm (eds.), The Genus Epidendrum, Part 6, Species New and
de largo, labelo proporcionalmente tan largo como Old in Epidendrum. Icon. Orchid. 9: t. 917.
ancho, columna con un par de dientes laterales Hágsater, E. y E. Santiago. 2007b. Epidendrum
incipientes; Nicaragua, Costa Rica y Panamá stenoselaginella. En Hágsater, E. & L. Sánchez Saldaña
E. stenoselaginella Hágsater & E.Santiago (eds.), The Genus Epidendrum, Part 6, Species New and
Old in Epidendrum. Icon. Orchid. 9: t. 991.
Hágsater, E. y E. Santiago. 2010. Epidendrum peristerium.
En Hágsater, E. & L. Sánchez Saldaña (eds.), The
Literatura citada Genus Epidendrum, Part 9, Species New and Old in
Barringer, K. 1991. A revision of Epidendrum subgenus Epidendrum. Icon. Orchid. 13: t. 1370.
Epidanthus (Orchidaceae). Brittonia 43(4): 240-252. Santiago, E. y E. Hágsater. 2007. Epidendrum selaginella.
Garay, L.A. 1977. The Subtribe Epidanthinae L. O. Wms. En Hágsater, E. & L. Sánchez Saldaña (eds.), The
The Orchid Digest, 41(1): 19-22. Genus Epidendrum, Part 6, Species New and Old in
Hágsater, E. 1985. Towards an understanding of the genus Epidendrum. Icon. Orchid. 9: t. 984.
Epidendrum. En K.W. Tan, (ed.), Proceedings of the Williams, L.O. 1940. A new genus of the Orchidaceae from
11th World Orchid Congress: 195-199. Miami, U.S.A. Central America. Bot. Mus. Leafl. 8: 148-151.
290 LANKESTERIANA
Apéndice. Clave ilustrada de identificación de las especies del grupo Epidanthus, subgrupo Selaginella.
1 Hojas ovadas a oblongo ovadas, hasta 3.4 mm 1’ Hojas linear lanceoladas, hasta 1.9 mm de ancho,
de ancho, flores distribuidas densamente hacia flores distribuidas laxamente en la inflorescencia,
el ápice de la inflorescencia, ovario y dorso de ovario y sépalos glabros 2
los sépalos densamente papilosos; Costa Rica y
Panamá E. selaginella Schltr.

2 Segmentos florales extendidos, sépalos 3.5-4.2 2’ Segmentos florales entreabiertos, sépalos 2.5-3
mm de largo, labelo proporcionalmente más mm de largo, labelo proporcionalmente tan largo
largo que ancho, columna con un par de dientes como ancho, columna con un par de dientes
laterales prominentes; Costa Rica y Panamá laterales incipientes; Nicaragua, Costa Rica y
E. astroselaginella Hágsater & E.Santiago Panamá
E. stenoselaginella Hágsater & E.Santiago

LANKESTERIANA 13(3): 291—317. 2014.
What is in an orchid name: a tribute

to the early naturalists in Costa Rica
Rudolf Jenny
Moosweg 9, 3112 Allmendingen, Switzerland

rjorchid@gmx.ch
Abstract. The early history of Costa Rican orchidology was deeply influenced by a number of naturalists,
mainly European by birth, who dedicated themselves to explore a still virgin country, bringing back from their
trips a treasure of species to be apprehended by science. While some of them where just occasional voyagers
and explorers, other establish themselves in Costa Rica in a long and fecund relationship, that raised to the
birth of a new generation of national naturalists in the first decades of the nineteenth century. Even if their faces
are sometimes unknown, their names are linked forever to the orchid that helped to reveal to science and to
humanity. What follows, and using as an excuse the name of some orchids, is a brief overview of the life and
deeds of some of these early naturalists, as a tribute to their contribution to the development of Costa Rican
orchidology.
Key words: History of botany, Costa Rica, Orchidaceae
Pablo Biolley and Telipogon Biolleyi as teacher and was a victim of criticism from colleagues
and staff; this was certainly one of the reasons why he
Paul (Pablo) Auguste Biolley (Fig. 1a) was started to drink. Alcohol finally was the reason of his
born as son of a teacher on 16th of February 1862 in early death on 16th of January 1908 at the age of only
Neuenburg, Switzerland. He studied in Neuenburg 46. Only a few publications by Biolley are known,
and became member of the Société des Sciences beside the one about the molluscs mentioned above,
Naturelles de Neuchatel and the Société Neuchatelois his main works are “Elementos de Historia Natural”
de Géographie. After graduating, he went as teacher from 1887 and “Costa Rica et son avenir” (Costa Rica
for 2 years to the Netherlands. In 1885 Biolley was and its future), published in 1889 in Paris (Fig. 1b).
invited as teacher and scientist by the Costa Rican Telipogon bolleyi (Fig. 1c) was described in 1910
government of Bernardo SOTO, he arrived in San Jose by Rudolf Schlechter in “Feddes Repertorium”, the
in 1886. Together with Henri Francois Pittier, Biolley plant was collected in August 1889 in flower by Biolley
undertook a number of expeditions through Costa in forests on the slope of the volcano Barba (no.1340)
Rica, in 1902 he joined the expedition to the Coco- (Schlechter 1910). Schlechter’s drawing of the flower
island and in 1907 he published results of this trip in was published by Mansfeld in “Feddes Repertorium” in
the book “Mollusques de la Isla del Coco”. His main 1931, the type of the species was lost in the fire of the
interest was entomology, but beside insects he also herbarium in Berlin in 1943 (Mansfeld 1931) (Fig. 1d).
collected plants and made important contributions to From the same collection of Biolley a second, unnamed
the knowledge of the flora of Costa Rica. Biolley was specimen with the same number 1340 is in the United
a quiet man, beside his duties as teacher he spent all his States National Herbarium (Fig. 2a), originally from the
free time collecting animals and plants. He married a herbarium of the Instituto Fisico-Geografico National
Costa Rican and got the Costa Rican nationality, for a Costaricensis, selected first by Calaway H. Dodson in
short period in 1904 he became director of the Instituto 1983 as neotype and again by Robert L. Dressler in
Fisico-Geografico. Biolley was not very well accepted 1999 as the lectotype of Telipogon biolleyi.
292 LANKESTERIANA
Figure 1. A — Portrait of Pablo Biolley. B — Frontispiece of Biolley’s “Costa Rica and son venir”, Paris 1889.
C — Telipogon biolleyi, illustrated by Lothar Braas. D — Telipogon biolleyi, from the original sketch by R. Schlechter.

Jenny — Costa Rican orchid names 293
A B
C D
Figure 2. A — Lectotype of Telipogon biolleyi (US). B — Drawing of T. biolleyi by A. R. Endrés (W-R).

C — Isotype of T. endresianum (AMES). D — Telipogon endresianum, from the Orchid Journal, 1953.

294 LANKESTERIANA
Figure 3. Telipogon biolleyi. A — habit. B — flower. Photographs by D. Bogarín.
Telipogon endresianum was described by problem is known from many small twig-epiphytes.
Friedrich Wilhelm Ludwig Kränzlin in 1919 in These plants are producing seeds in their second or third
“Annalen des Naturhistorischen Hofmuseums Wien”, year, the generation-succession is fast and due to the
Kränzlin dedicated the species to August R. Endrés, fact that their typical habitat is changing fast, they do
his description was based on a perfect drawing and not survive long in nature. The only way to keep them
material collected by Endrés (Kränzlin 1919) (Fig. for a longer time in culture is artificial pollination and
2b). The type and the drawing are in the herbarium propagation from seed. In nature, species of Telipogon
of Reichenbach in Vienna. Kränzlin also mentioned a are apparently pollinated by pseudocopulation of male
specimen collected by Huebsch, this specimen is also Tachinid-flies. The males are attracted by the hairs
in Vienna. Another Endrés’ specimen, determined as and bristles around the column of the flowers, perhaps
an isotype of Telipogon endresianum is in the AMES imitating a female fly.
herbarium at Harvard (Fig. 2c). A detailed drawing
of Kränzlin’s species was published by Paul H. Allen Alberto Manuel Brenes and
1952 in Alex D. Hawkes’ “Orchid Journal” (Allen Campylocentrum brenesii
1952) (Fig. 2d). It was Dodson who first stated that
Telipogon endresianum would be a synonym of the When Rudolf Schlechter published 1923 his
older Telipogon biolleyi. “Beiträge zur Orchideenkunde von Zentralamerika”
Telipogon biolleyi (Fig. 3a—3b) is one of the most in “Feddes Repertorium Beihefte”, more than half
common species of the genus in Central-America. Like of the new species he described have been collected
most other species it is a fast growing twig-epiphyte. by Alberto Manuel Brenes in Costa Rica. Schlechter
Most species of Telipogon are very difficult to keep (1923) dedicated a series of orchid species to Brenes:
alive in cultivation for more than 2 or 3 years, this Barbosella brenesii, Campylocentrum brenesii,
Catasetum brenesii, Dichaea brenesii, Elleanthus elevations. Before 1924 the primary set of Brenes‘
brenesii, Encyclia brenesii, Epidendrum brenesii, collections was deposited in Costa Rica, although
Habenaria brenesii, Lepanthes brenesii, Maxillaria the unicates of many groups were sent to specialists.
brenesii, Microstylis brenesii, Notylia brenesii, Rudolf Schlechter in Berlin received most of
Oncidium brenesii, Pleurothallis brenesii, Ponthieva Brenes‘ orchid collections during this period. After
brenesii, Spiranthes brenesii, Stelis brenesii, and Schlechter’s time most of the orchids have been sent
Trichocentrum brenesii. to Oakes Ames at Harvard and to the Field Museum
At least in part Alberto Manuel Brenes (Fig. in Chicago. Brenes also made a number of pencil-
4a—3b) also belongs to the Swiss connection like drawings of the plants he collected, these drawings
J.F. Adolphe Tonduz and Henry François Pittier. are kept at the Departemento de Proteccion del
Brenes was born in San Ramon in Costa Rica on Patrimonio Historico, Museo Nacional de Cost Rica.
September 2th, 1870. He studied in Costa Rica until We don’t know how many drawings Brenes made,
1890, when he left Central America for Europe. the drawing of Gongora armeniaca is carrying
He stayed in Paris for a short time and then went the number 115 (Fig. 6d) the one of Catasetum
to Lausanne in Switzerland where he studied at macrocarpum the number 272. Seven of them have
the university for one year, followed by a time in been printed in the biography of Brenes by Alberto
Geneva where he stayed until 1898, taking botany H. Salazar Rodríguez in 2009.
and natural history courses with Professors Renvier, Rudolf Schlechter received trough Tonduz several
Dufour, Chodat and Briquet. collections of orchids from Costa Rica, including
During the time when Brenes was in Europe, some specimens collected originally by Brenes. It was
Henry François Pittier founded the Instituto Fisico- Tonduz who told Schlechter to get in direct contact with
Geografico Costarricense, a government department Brenes. Schlechter wrote 1919 to Brenes, asking him
devoted to the natural sciences, a part of this institute about the possibility to collect orchids for the planned
was the Herbario Nacional de Costa Rica and grew orchid flora of Costa Rica. 1922 Schlechter received
under the strong influence of Pittier. When Pittier left a very large collection of specimens from Brenes, the
Costa Rica in 1903, the herbarium was taken over by collection was extremely rich in small species from
the Museo Nacional. Brenes returned to Costa Rica in the subtribe Pleurothallidinae and Schlechter decided
1898 and started teaching at the Escuela de Farmacia to publish 1923 the results in an own treatment under
(School of Pharmacy) in San Jose. In his spare time the title “Orchidaceae Brenesianae“. All species
he collected plants together with Henry François named after Brenes and also the genus Brenesia have
Pittier, Pablo Biolley and J.F.Adolphe Tonduz. For been published in this article in “Feddes Repertorium
health reasons Brenes left this appointment in 1903 Beihefte”. Schlechter’s herbarium in Berlin was
and returned to San Ramon. In this time he worked destroyed during the war in 1943 and all the
for a few years at the Colegio de San Luis Gonzaga specimens collected by Brenes were lost. Fortunately
and changed to the Escuela Normal in 1911. In 1920 Oakes Ames was interested in Schlechter’s Central
he became the head of the section of botany at the American Orchidaceae and so he paid first an artist
Museo Nacional, a position he held until 1935. In and later on Schlechter’s wife Alexandra to make
1921 Brenes began a series of collections that would drawings of this material for his own herbarium So
eventually total more than 23’000 numbers of plant at least a larger part of Schlechter’s collection from
specimens. He usually collected in the very rich Costa Rica survived in form of drawings.
forests around San Ramon. The vegetation in this Brenes died in San Ramon in 18. May 1948. Still his
area is extremely rich not only in orchid species but name is present in Costa Rica, the journal “Brenesia”,
also in other plants because it forms a gap between published by the Departemento de Historia Natural,
the Cordillera Central and the Cordillera de Tilaran. Museo Nacional de Costa Rica is named after him, the
Moisture-laden winds from the Caribbean plain are first number was published in 1972. In the seventies a
forced up to the eastern slope and across this gap, stamp with Brenesia costaricensis was issued by Costa
creating areas of cloud forest at unusually low Rica, in the same series with some other Orchids also a
296 LANKESTERIANA
A B
Figure 4. A, B — Two portraits of Alberto Manuel Brenes. C — Drawing of Campylocentrum brenesii by A. R. Endrés
(W-R), from Bogarín & Pupulin 2010.

A B
C D
Figure 5. A, B — Two modern illustrations of Campylocentrum brenesii by D. Bogarín (from Bogarín & Pupulin 2010).
C, D — Inflorescences of Campylocentrum brenesii.

298 LANKESTERIANA
A B
C D
Figure 6. A — Lectotype of Campylocentrum brenesii (AMES). B — Holotype of Campylocentrum calcaratum (AMES).

C — Drawing and photograph of the type of Campylocentrum calcaratum (AMES). D — Drawing of Gongora
armeniaca by A. M. Brenes (Museo Nacional de Costa Rica).
stamp with a portrait of Brenes was included. 5d). The plant was collected in July 1925 by Charles
The genus Campylocentrum was mentioned the H. Lankester near La Estrella, Costa Rica, and was
first time by George Bentham in 1881 in “Journal described by Oakes Ames and Charles Schweinfurth
of the Linnean Society”. The genus belongs in fact in 1930 in “Schedulae Orchidianae”. Also
to the Angraecinae and includes about 60 species Campylocentrum parvulum is defined as synonym of
distributed from Mexico to Brazil and Bolivia and Campylocentrum brenesii., the species was described
in the West Indies. Campylocentrum is a sister genus by Schlechter 1923 in “Feddes Repertorium Beihefte”
of Dendrophylax and includes both leafy and leafless after a collection by the brothers Alexander Curt Brade
species. The genus Todaroa, described in 1844 in and Alfred Brade near La Palma, Costa Rica, in 1400
“Comptes Rendus Hebdomadaires des Seances de m altitude.
l’Academie des Sciences” by Achille Richard and
Henri Galeotti1, is today considered as synonym of Richard (Ricardo) Pfau and Trichocentrum pfavii
Campylocentrum. Richard and Galeotti were not
aware that the generic name Todaroa was already used We have only little information and details
for a genus of the Umbelliferae by Parlatore in 1844. about the life of Richard (Ricardo) Pfau. The family
Although Bentham agreed with the concept of Todaroa Pfau (Fig. 7a) was very famous in Winterthur near
he could not use this name and proposed instead Zurich in Switzerland, 5 generations of Pfau’s lived
Campylocentrum as generic name (Bentham 1881). there, they where stove setters and stoves from their
Campylocentrum brenesii was described by Rudolf business where distributed all over Switzerland and
Schlechter in 1923 in “Beiträge zur Orchideenkunde southern Germany. Some members of the family
von Zentralamerika” in “Feddes Repertorium where also active in politics and became members
Beihefte” (Schlechter 1923). The plant Schlechter used of the town council. Ricardo’s father Matthäus Pfau
as type was collected in 1921 by Brenes at San Pedro (13.1.1820 – 27.7.1877) was merchant, officer, banker
de San Ramon, Alajuela, Costa Rica. Schlechter’s and politician in Winterthur, and was in 1862 one
herbarium in Berlin was destroyed in 1943 and the of the 13 founding members of the precursor of the
type-specimen of Campylocentrum brenesii was bank which should become 150 years later the largest
lost (Fig. 6c). Another specimen of the species, also bank in Switzerland. In 1865 Matthäus had to retire
collected by Brenes in September 1921 in Costa for health reasons. He bought the Kyburg-Castle
Rica was selected by Barringer in 1984 in “Fieldiana and used his fortune to open 1866 the first museum
Botany” as the lectotype (Barringer 1984) (Fig. 6a). in a historical castle in Switzerland. He moved with
Another specimen of the species was collected by family and his art-collection to the Kyburg. Ricardo
A.R. Endrés in the second half of the 19th century. The was the youngest of the three sons of Matthäus Pfau,
specimen remained undescribed in the herbarium of born in 1856 and grown up at least in part in the
Heinrich Gustav Reichenbach in Vienna, together with Kyburg. The elder brothers where Jakob Pfau (born
two very accurate pencil-drawings by Endrés (Fig. 4c). 1846) who became architect and later Professor at the
Brenes collected the species again between 1925 and Technikum in Winterthur, and Eduard (born 1851)
1927 in the area of La Palma de San Ramón and at La who became merchant in Milan, Italy. Ricardo seems
Paz de San Ramón. Following the most recent revision to have been the “black sheep of the family”. In 1887
of the genus Campylocentrum in Costa Rica, published he tried to publish a novel and asked Gottfried Keller,
by Diego Bogarín and Franco Pupulin in “Harvard famous author in Zurich, for an expertise. However,
Papers in Botany” from 2010, Campylocentrum the result was not as good as expected, the novel
longicalcaratum Ames & Ch.Schweinfurth (Fig. 6b) was never published. When Robert Keller, botanist
is a synonym of Campylocentrum brenesii (Fig. 5a– and high school teacher in Winterthur, published in
1Index Kewensis is defining Richard and Galeotti’s publication in “Annales des Sciences Naturelles (ser.3,3:28.1845)”
as the valid first description of Todaroa, but the publication in “Comptes Rendus Hebdomadaires des Seances de l’Academie
desSciences” is one year older. If the first description of the genus Clynhymenia in the same publication of 1844 is accepted
as valid, the same must be true for Todaroa.

300 LANKESTERIANA
A B
C D
Figure 7. A — The family Pfau; Richard is the boy with a gunon the right. B — Catalogue of Pfau’s nursery in Costa
Rica, ca. 1895. C — Pfau’s illustrated manual for the tropical apiculturist (1895). D — Modern illustration of
Trichocentrum pfavii, from Pupulin 1997.
1891 his “Flora von Winterthur” he mentioned in the Medina, Ohio, USA and offered on demand “an
introduction also a small collection of plants given to illustrated manual for the tropical apiculturist” (Fig.
him by his friend Richard Pfau. Obviously Richard 7c). Although Richard was as collector mainly active
had collected plants around the Kyburg. in Costa Rica it is – based on the plants he sent to
We don’t know when Richard left Europe for Europe – probable that he also collected in Colombia,
Costa Rica the first time but it seems to be around Panama and even Mexico. Richard Pfau died with 41
the year 1880. Following some of the articles years on 14th of March 1897.
he published in 1883 and 1884 in “Gardeners’ A few orchids carry his name as epithet (species
Chronicle” he already had been in Costa Rica but not name), but interestingly all are written as pfavii and not
permanently, he also cultivated Orchids and lived in as pfauii. In the Latin alphabet the letter U is written
Chiswick, England. Remarks in the publications like: as V, most probably this was the reason for Rolfe,
“…but on experience in my own culture of Orchids Reichenbach and Schlechter to write pfavii.
in Chiswick, which I began only a few months ago” Trichocentrum pfavii (Fig. 7d, 8c) was described
(Pfau 1883a), “….I discovered this species last year by Reichenbach in “Gardeners’ Chronicle” in 1881
in a locality difficult to get at” (Pfau 1883b) and based on material collected 1880 by Pfau in Chiriqui,
“….in my houses at Chiswick they seemed to do best Costa Rica. Reichenbach got living material, dried
in baskets” (Pfau 1883c). In Kew there is a business- specimens and a sketch, the type specimen in the
card from Pfau, written in 1895 or 1896 with the herbarium of Reichenbach (no. 42179) includes two
following note: “Richard Pfau who thanks to the drawings of the species by Reichenbach himself and a
presentation of the Consul General of Switzerland few dried flowers (Fig. 7a).
has had the honor of paying Sir Joseph Hooker a Trichocentrum pfavii var. zonale (Fig. 8d),
visit 2 years ago before starting for Central-America, described in 1883 by Reichenbach in “Gardeners’
begs the favour an interview to show him some Chronicle” is a synonym of Trichocentrum pfavii
new plants he has found”. Obviously Richard made (Reichenbach 1883). The commentary of Reichenbach
several trips to Costa Rica when he lived in England is interesting: “Mr. Pfau appears to be an excellent
and sometime around 1885 he settled in San Jose, correspondent and collector, but his Trichocentrum is
Costa Rica. He returned for a visit in 1893 and again an abdominable plant, quite a crux Orchidologorum.
1896. In “Gardeners’ Chronicle” we find a note that It defies all laws, and is polymorphous in the shape of
Richard succeeded to bring in 1896 a small number the flowers and nature of the lip.” He had got a fresh
of Epidendrum endresii and Miltonia endresii alive inflorescence from Veitch and continued: “A fresh
to England. Richard founded a nursery in San Jose in inflorescence just sent by Mr. Harry Veitch proves
Costa Rica, he published – most probably in 1895 – a this once more. An unpublished species with much
catalogue of Orchids he had for sale and export (Fig. larger flowers and tomentose teeth at the base of the
7b). In the catalogue he also gave advice about the lip, turns out as belonging to this species, though it
cultivation and exportation of Orchids and he made looked widely distinct. I would not quote this name,
comments like: “Cattleya skinneri, some ten years Trichocentrum zonale, were it not engraved on an
ago, was a common orchid all over Central America; unpublished lithographic plate belonging to one of
but in the last few years it has been exported by my unpublished pamphlets. I can only regard it now
shiploads; and today – at least in Costa Rica – it has as a variety”.
almost become rare”. He sent plants to Europe and Trichocentrum pfavii subsp. dotae (Fig. 9a, 9b,
sold them like other collectors – e.g. Benedict Roezl 9d) was described by Franco Pupulin in 2001 in
and Gustav Wallis – through Eduard Ortgies from “Selbyana” (Pupulin, 2001). The plant was collected in
the Botanical Garden in Zurich. Richard also had an April 1999 by A. Flores (San José, Dota, Santa María,
apiary in his nursery, he wrote: “In 1893 I introduced road to San Joaquín) and flowered at Gaia Botanical
into Costa Rica the Italian Bee and modern Langstroth Garden in 1999, the type specimen is at the herbarium
bee-keeping system, with the latest American of the Escuela de Biologia, Universidad de Costa
inventions”, he sold the honey via a company in Rica (USJ) (Fig. 9b). In the same publication Pupulin
302 LANKESTERIANA
A B
C D
Figure 8. A — The holotype of Trichocentrum pfavii at W–R. B, C — Endrés sketches of the species he intended to describe
as Trichocentrum saundersii (W-R). D — Unpublished plate of Trichocentrum zonale, from Reichenbach’s Xenia
Orchidacea.

A B
C D
Figure 9. A, B — Trichocentrum pfavii subsp. dotae. Original illustration by F. Pupulin (2000), and the holotype in the
Herbarium of the University of Costa Rica (USJ). C — Trichocentrum pfavii. D — Trichocentrum pfavii subsp. dotae
(photographs by F. Pupulin).
created a section Lobulatae for the group of species Henry François Pittier and Oncidium pittieri
around Trichocentrum pfavii.
Trichocentrum saundersianum and Trichocentrum Henry François Pittier (Fig. 10a-10d) also came
saundersii are names on several sheets in the from Switzerland. He was born in Bex, Canton
Reichenbach herbarium, the material was collected Waadt, on 13th of August 1857. He graduated as a civil
and illustrated by Endrés (Fig. 8b, 8c), but never engineer from the University of Lausanne. After the
validly published; it belongs to Trichocentrum pfavii. years at the university he started a map survey of the
304 LANKESTERIANA
alpine flora of Switzerland. An accident ended with a Mexico, Guatemala, El Salvador, Colombia and in
broken leg and in the following period, immobilized Venezuela. Pittier’s collections in Panama have been
by the accident, Pittier started to read intensively about very important for the Flora of Panama.
natural sciences. He got into contact with the work of At the age of 62 he left Washington and went to
Haeckel and was so fascinated by Haeckel’s ideas that Venezuela as director of the Commercial Museum in
he decided to go to Jena,and a short time later started Caracas. Again and in spite of his age he travelled
doctoral studies at the University of Jena in Germany. extensively in Venezuela and published the famous
The information about the academic titles of Pittier “Manual de las Plantas usuales de Venezuela” in 1926
are not consistent; following Tobias Lasser, Pittier and its first supplement in 1939. Pittier also founded
had a doctorate in philosophy from Jena and from the National Herbarium in Caracas and published some
Lausanne a doctorate of science. Following John D. 300 books and articles in different journals. He died
Dwyer, he never finished his studies and remained a in Venezuela at the age of 93 in 1950.3 There are still
bachelor. Following his interests in the tropics, Pittier discussions about the final number of plants collected by
immigrated in October 1887 to Costa Rica2, and never Pittier, but without any doubt he made a very important
should come back to Switzerland. From 1887 to 1903 contribution to the knowledge of the floras especially
he organized and directed the Physico-Geographical of Panama, Costa Rica and Venezuela. Several orchids
Institute of Costa Rica, one of the objectives was to are dedicated to this important botanist, mainly by
make a map survey of the republic of Costa Rica. It Rudolf Schlechter in Berlin, who got Pittier’s orchids
was there that Pittier met Adolphe Tonduz for the first for identification. Some of them are Oncidium pittieri
time. Pittier was also involved in the organisation of Schltr., Maxillaria pittieri Schltr., Scaphosepalum
a National Herbarium in San Jose. Between 1887 and pittieri Schltr., Pleurothallis pittieri Schltr., Lockhartia
1904 Pittier collected in Costa Rica, often together pittieri Schltr., Vanilla pittieri Schltr., and Epidendrum
with Adolphe Tonduz. One result of those collections pittieri Ames
was the “Primitiae Florae Costaricensis”, which he Unfortunately most of Pittier’s orchids have been
published in three volumes between 1891 and 1901 destroyed during the second world war in Berlin,
in collaboration with Theodore Durand from the together with almost the entire herbarium of Schlechter.
Botanical Garden in Brussels. Some of the species have been illustrated in 1931 in
In 1904 Pittier went to Washington D.C. to work “Feddes Repertorium”, based on the original drawings
for the United States Department of Agriculture under of Schlechter and published by Rudolf Mansfeld.
the very promising title “Special agent in botanical Oncidium pittieri was described by Rudolf
investigation in tropical agriculture in the Bureau of Schlechter in 1910 in “Feddes Repertorium”
plant industry”. The title was changed to Botanist (Schlechter 1910). The plant was collected by Pittier
in 1912. Between 1905 and 1919 he worked in near La Palma in Costa Rica in September 1896. The
Washington in his office and travelled extensively in type specimen was destroyed in 1943 but a copy of it
Central and South America, he collected in Panama, is still in the AMES herbarium (Fig. 10a). The flower
2
Pittier come to Costa Rica hired by the government. See Ossenbach 2009: “However, the last two decades of the
century showed for the first time the development of a ‘national science’ in Central America. In Costa Rica, “as part of an
educational reform aimed at secularizing public education, the government of president Bernardo Soto (1885-1889) hired
a group of European academics to staff the two new public high schools in the capital, San José (The ‘Liceo de Costa Rica’
for boys and the ‘Colegio Superior de Señoritas’ for girls, both founded under Soto’s administration). The arrival of these
academics marks the beginning of a small scientific renaissance in Costa Rica. Two institutions symbolize this renaissance:
the Instituto Físico-Geográfico (IFG) (=‘Physical-Geographical Institute’) and the National Museum, founded in 1887 and
1889, respectively.” Among the hired teachers were Pablo Biolley (1861-1908) and Henri Francois Pittier (1857-1950), who
arrived in 1886 and 1887.
3
Henri Pittier National Park is the oldest national park in Venezuela, originally created in 1937 under the name of
Rancho Grande by decree of President Eleazar López Contreras. The park was renamed in 1953 with the name of Henri
Pittier, who arrived in Venezuela in 1917, classified more than 30,000 plants in the country and devoted many years studying
the flora and fauna in the park.
A B
C D
Figure 10. Portraits of Henry Francois Pittier. A — In 1880. B — In 1903. C — In 1914. D — In 1946.

306 LANKESTERIANA
A B
C D
Figure 11. A — Oncidium pittieri, copy of Schlechter’s drawing of the holotype. B — O. pittieri, Schlechter’s sketch of the
flower, published by Mansfeld (1931). C — Type of Oncidium luteum (K). D — Type of Oncidium cheirophoroides (W).

A B
C D
Figure 12. Oncidium luteum. A, B — Sketches by A. R. Endrés (W–R). C — Illustration from Icones Plantarum Tropicarum
(pl. 1572). D — Photograh of the flower, by D. Bogarín..

308 LANKESTERIANA
dissection on this drawing is exactly the same as left Geneva and arrived in Costa Rica on June 17th.
published by Mansfeld in 1931 (Fig. 11b) in “Feddes A short time after his arrival he got into contact with
Repertorium Beihefte” (Mansfeld 1931). Obviously Henry Francois Pittier de Fabrega, another Swiss
Schlechter was not aware of the existence of Oncidium active as botanist in Costa Rica. Soon they became
luteum, described by Robert Allen Rolfe in 1893 in good friends and together they travelled between
“Bulletin of Miscellaneous Information” (Rolfe 1893a). 1889 and 1903 through Costa Rica. In 1889 Tonduz
Rolfe’s description was based on a plant cultivated in became collector for the Instituto Fisico-Geografica
the collection of Trevor Lawrence in Burford Lodge Nacional, founded by Pittier. Both collected some
and sent in summer 1892 to Kew for determination 20’000 specimens. Most of the herbarium specimens
(Fig. 11c). It is not known from where Lawrence had have been distributed by T. Durand, director of the
the plant. Following descriptions, drawings and type- Botanical Garden in Brussels, to different institutes.
material, it is clear that – unfortunately – Oncidium Almost complete sets are kept at the Conservatoire
pittieri has to be declared as synonym of the older Jardin Botanique in Geneva and at the Smithsonian
Oncidium luteum (Fig. 12d, 12d). Institution in Washington. Between 1903 and 1920
Oncidium cheirophoroides is another synonym Tonduz was employed at the Costa Rican Museo
of Oncidium luteum, it was described by Friedrich Nacional. In 1920 he went to Guatemala and worked
Kränzlin in “Das Pflanzenreich” in 1922 (Kränzlin there as plant pathologist for the Agricultural Service.
1922). The material Kränzlin used was collected in He died in Guatemala on 20th of December 1921 at the
Costa Rica by Endrés, the type specimen is in the age of 60. In one of his biographies his life is described
herbarium of Reichenbach in Vienna (no.45055) as very eventful, changing from poorness to times
(Fig. 11d). Two drawings by Endrés of an un-named of no financial problems, he himself is described as
Oncidium in the Reichenbach herbarium (no.33448 cultivated, generous and friendly. When Tonduz was
and 33732) (Fig. 12a, 12b) are showing also Oncidium not travelling he lived in San Francisco de Guadalupe,4
luteum (determinated by Dressler in 2001). where a road is named after him.
The last orchid collection from Tonduz reached
Jean François Adolphe (Adolfo) Tonduz and Rudolf Schlechter in Berlin in 1921. After the war
Masdevallia tonduzii Rudolf Schlechter tried to find contact to collectors
in Central America in order to finish his orchid flora
Jean François Adolphe Tonduz (Fig. 13a, 13b) was of Central America. He got positive answers from
born as the youngest of 7 children of Paul Gustave several people, among them Don José C. Zeledón
Tonduz on 18 September 1862 in Pully, Canton of and his wife Doña Amparo de Zeledón in Costa Rica.
Waadt, Switzerland. Between 1876 and 1881 he Doña Amparo owned a large collection of orchids,
studied at the Technical School in Lausanne, after mainly from Costa Rica and she allowed Tonduz
this he started to study medicine at the University of and also Wercklé to select interesting material from
Lausanne from 1881 to 1885. During this time he got her collection, she herself also paid Wercklé for his
into contact with botany, and influenced by two of his work. The genus Amparoa, Habenaria amparoana,
teachers, J.B. Schnetzler and L. Favrat, he got more Sobralia amparoana and Gongora amparoana are
and more interested in natural history and especially dedicated to her. Most of the species described by
botany. This was the reason why in 1885 he moved as Schlechter in his article Orchidaceae Amparoanae
Conservator to the Botanical Museum of the Botanical in “Feddes Repertorium Beihefte” (Schlechter 1923)
Institute of the same University in Lausanne. In 1889 had been sent to him by Tonduz and were from plants
William Barbey offered him to become Conservator from Doña Amparo’s collection. Together with his
at the Herbarium Boissier in Geneva, and it was own material, Tonduz sent a few plants collected by
Boissier himself who helped Tonduz in the same year Alberto M. Brenes and helped Schlechter to get into
to get an employment from the government of Costa direct contact with Brenes. During his time in Costa
Rica to study coffee-diseases. In May 1889 Tonduz Rica, Tonduz kept the contact to the Botanical Garden
5
Popular name in Costa Rica for a small grocery store.

A B
C D
Figure 13. A, B — Portraits of Adolphe Tonduz when in Costa Rica. C — The holotype of Masdevallia tonduzii at G.
D — Protologue of Masdevallia tonduzii, from Bulletin de l’Herbier Boissier (1906).
310 LANKESTERIANA
A B
C D
Figure 14. A — Masdevallia tonduzii, illustration from Icones Pleurothallidinarum 22 (2001). B — Frontispiece of Tonduz’
“Exploraciones botánicas en Talamanca” (1895). C, D — Masdevallia tonduzii, habit and flower. Photographs by R. Jenny.

in Geneva and sent from time to time living material to Beside this he had also skills as cartographer and as
Geneva. There are only a few known publications by philosopher. We don’t know whether the story about
Tonduz, one is “Exploraciones botanicas efectuadas en his German manuscript “The Philosophy of the
la parte meridional de Costa Rica” in 1893, two others Absolute” which he planned to publish and which was
are “Exploraciones botanicas en Talamanca” in 1895 stolen from his home and used in a local pulperia5
(Fig. 14b) and “Herborisations au Costa Rica” in 1895 to wrap soap and candles, is entirely true. Although
– 1897. The latter was published in several parts in the French by birth Carlos always insisted to be German.
“Bulletin de l’Herbier Boissier”, it is a very detailed Sometime around 1892 Wercklé – most probably
diary of some of his travels in Costa Rica. with his oldest sister Julia – left Europe for the USA
Three genera are dedicated to Tonduz, Tonduzia and worked for the company of John Lewis Childs
Pittier (1908, Apocynaceae), Tonduzia F.L.Stevens (Fig. 15b) of Long Island, New York. Childs (1856 –
(1927, invalid) and Tonduzia Boeck. ex Tonduz 1921) was selling seeds and bulbs and was founder of
(Cyperaceae, 1895). Several orchid species are Floral Park (Fig. 15c). The only photograph of Wercklé
dedicated to Tonduz (Schlechter 1923), unfortunately we know shows him together with his boss John Lewis
only a few of them have been illustrated: Elleanthus Childs and Anastasio Alfaro visiting an exhibition in
tonduzii, Stelis tonduziana, Camaridium tonduzii, 1893 in Chicago (Fig. 15a). Wercklé was sent to Costa
Restrepia tonduzii, Cycnoches tonduzii, and Rica to collect plants and seeds for Childs, he arrived
Masdevallia tonduzii (Woolward 1906). for the first time in Costa Rica in 1897; following
Masdevallia tonduzii (Fig. 14a, 14c, 14d) was some sources he had his sister Julie with him. He had
described by Florence Woolward in “Bulletin de Theophile Brune, another plant collector, with him or
l’Herbier Boissier” (Woolward 1906) (Fig. 13d), he met him for the first time in Costa Rica. We know
the plants had been collected by Tonduz and were that because some of Wercklé’s collections of orchids
incorporated in 1894 in the orchid collection of the were dated November 1897, and there are specimens
Conservatoire Jardin Botanique in Geneva. Under of the fern Loxomopsis costaricensis in the herbarium
cultivation of Paul Simmler Masdevallia tonduzii of Hermann Christ, described in 1904 and collected by
flowered every year, but only in 1900 Florence Wercklé and Brune. Carlos’ sister got pneumonia and
Woolward realized that it was a new species when went back to the USA where she died a short time later.
she got some plants in her hands. Unfortunately it Carlos went with her and was 1898 employed by the
was too late to include the species in her famous book Rose Hill Nursery of Henry A. Siebrecht and Albert
The Genus Masdevallia and she did not publish an Wadley of New Rochelle, a company specialized in
illustration together with the first description. The tropical plants, ferns, palms and orchids. The company
plants remained in cultivation in Geneva at least until published catalogues in regular intervals and set up
1910, the type specimen is in the herbarium Boissier in own orchid shows in New York. Obviously Wercklé
Geneva (Fig. 13c). also had relations to the New York Botanical Garden,
he tried to find help to finance another trip to Costa
Karl (Carlos) Wercklé and Kefersteinia wercklei Rica from the company and from Nathaniel Lord
Britton, at this time director of the New York Botanical
Karl (Carl, Carlos) Wercklé (Fig. 15a) was born Garden. He had no success and so he returned on his
on 18th of July 1860 in the village Wiebersweiler own resources to Costa Rica, he reached Puerto Limon
(Vivverville) in the department Alsace-Lorraine in on 7th July 1902.
France as son of Carl Wercklé and Christine Deher. We Rudolf Schlechter, orchidologist in Berlin, was
don’t know much about his early years, but obviously trying to get contact to collectors in Central America
he visited the secondary school in Nancy. It is said that in order to complete his planned orchid flora of Central
Wercklé was a man of extraordinary education, he was America. He got positive answers from several
fluent in Spanish, German, French and English and it people, among them also Don José Castulo Zeledón
is also said that he understood enough of Latin, Greek and Doña Amparo de Zeledón (Fig. 15d). Doña
and even Hebrew to read books in those languages. Amparo owned a large collection of orchids, mainly
312 LANKESTERIANA
A B
C D
Figure 15. A — Carlos (Karl) Werckle (on the right) with Anastasio Alfaro (on the left) and John Lewis Child (center) in 1893.
B — John Lewis Childs. C — Advertisement of Floral Park. D — Doña Amparo de Zeledón.

A B
C D
Figure 16. A, B — Copies of Schlechter’s original sketches of the type of Kefersteinia warcklei. B — An unpublished
plate from Reichenbach’s Xenia Orchidacea, illustrating K. wercklei (as Zygopetalum umbonatum). C — A modern
illustration of K. wercklei, from Pupulin 2001.

314 LANKESTERIANA
Figure 17. Kefersteinia wercklei, habit and flower.
from Costa Rica and based on recommendation of of the Museo Nacional. Beside all those activities,
Alfred Brade, head-gardener of the town San Jose, Wercklé seems to have had his own “jardineria” first
she allowed Wercklé and Adolfo Tonduz to select in Cartago and later in San Jose. He published a series
interesting material for Schlechter. She herself also of articles, the first one in 1901 in “Torreya”, and in
paid Wercklé for his work and sent him on collecting 1913 “the first scientific article ever written in Costa
trips. Wercklé and Tonduz together collected almost Rica about the orchids of this country” (Ossenbach
15’000 specimens for the herbarium of the Museo 2003) in “Boletin do Fomento”. His main work was
Nacional, although Wercklé’s way to collect plant “La Subregion Fitogeografica Costarricense” in
material was not state of the art: “…..his favourite 1909. Some of his articles were published in German
way of preserving an interesting plant was to roll it periodicals like ”Monatsschrift für Kakteenkunde”
into a bundle and stuff it in a pocket, where it remained and “Der Tropenpflanzer”.
indefinitely, it is thus only too easy sometimes to From a letter of Henry Nehrling to Theodor
recognize in the herbarium his specimens, without Luqueer Mead from December 1918 we learn that
even looking at the label” (Standley 1926). The Wercklé was also collecting and selling Bromeliads.
plants they collected alive went first to the garden Nehrling (1853–1929) started “Nehrling’s Tropical
of Doña Amparo and where subsequently prepared Garden and Arboretum” in 1917 in Naples, Florida
by Tonduz for the herbarium. Based on Wercklé’s and was in close contact with Mead (1852–1936) who
collections, Schlechter described later 4 new orchid had a collection of tropical plants – including orchids
genera and more than 80 new species. Besides – in Oviedo, Florida. Nehrling wrote to Mead: “Do
orchids, Wercklé was also very interested in ferns you know a good book on the flora of Costa Rica?
and bromeliads, he had an extremely good trained Carlos Werckle wrote me some time ago that he has
eye for them, and collected hundreds of species discovered a number of new Bromeliads rivalling in
studied and described later by Hermann Christ in beauty with Caraguata zahnii, Massangea musaica
Basel, Switzerland. In 1906 the National Society and others and still very distinct. He intends to send me
for Agriculture sent Wercklé to southern Colombia, a fine collection of the Costa Rican species, about 300
obviously he collected several Cacti and Bromeliads distinct kinds. He says that the center of distribution
and took them home to Costa Rica. In 1911, Wercklé of Bromeliads in Costa Rica is found in the mountains
was employed for a few months by the herbarium around Cartago. Says that his wife “is in many respects
an ideal, but she is extremely nervous, and not at all costaricensis and included also Kefersteinia
healthy”. In another letter from November 1925 we wercklei. They also mentioned the unpublished taxon
read: “Carlos Werckle, an old friend of mine and now Kefersteinia umbonata as synonym of Kefersteinia
dead, discovered some most beautiful new species wercklei (Senghas et al. 1992). Kefersteinia umbonata
in the mountains of Costa Rica. They all have been is based on a drawing by Endrés named Zygopetalum
described by Dr. Mez (Professor at the University of umbonatum in Reichenbach;s herbarium in Vienna
Königsberg). He sent me a consignment about 6 years (W-R no.336). Of the same drawing a lithograph was
ago – 50 species, mostly new. They came as far as made, planned to be published in “Xenia Orchidacea“
Jacksonville but were returned by the man who acted and named Zygopetalum umbonatum (Fig. 16c). On a
for the Federal Plant Board and Werckle never could second sheet (W-R no.34708) we find the handwritten
be induced to send me another lot, even after I had sent description as “Zygopetalum (near Kefersteinia)” and
him special permits”. Wercklé was not married, the a drawing of the flower parts by Endrés. The binomial
remark about “his wife” is wrong, most probably he Kefersteinia umbonata is not mentioned on any of
talked about his sister. the sheets of the Endrés-material in Vienna. In the
In 1922 Oakes Ames was looking for a collector German journal “Journal für den Orchideenfreund”
in Central America and contacted Charles Lankester in of 2003 Dariusz Szlachetko described the new
Costa Rica in order to get his opinion about Wercklé, genus Senghasia based on the section Umbonata
Lankester’s answer from 11th of October 1922 was very of Kefersteinia with 12 species (Szlachetko 2003).
clear: “Wercklé is a dipsomaniac, an appalling wreck He recombined Kefersteinia wercklei to Senghasia
of a fine intelligence, but has still some good local wercklei. The genus is named after Karlheinz
knowledge and might be of use yet” (Ossenbach 2003). Senghas, orchidologist, longtime-director at the
In his later years Wercklé started to develop a passion Botanical Garden Heidelberg and co-author of the
for alcohol, he drank and this was most probably the third edition of Rudolf Schlechters “Die Orchideen”.
reason for his early death on 24th of November 1924.
Kefersteinia wercklei (Fig. 16d, 17) was Literature cited
described in 1923 by Rudolf Schlechter in “Feddes Allen, P. H. 1952. Telipogon endresianum Kraenzlin. Orchid
Journal (A.D.Hawkes) 1: 292–293
Repertorium, Beihefte” based on a plant collected
Ames, O. & C. Schweinfurth. 1930. New or noteworthy
by Wercklé in June 1921 near La Palma. The article Orchids. Schedul. Orch. 10: 1–112.
was dedicated to Doña Amparo de Zeledón as Anonymous. 1897a. Gardeners’ Chronicle ser.3,21: 241.
“Orchidaceae Amparoanae” (Schlechter 1923), the Anonymous. 1897b. Orchid Review 5:109
specimens were collected by Tonduz and Wercklé, Anonymous. 1923. Berichte der Schweizerischen
cultivated first in the garden of Doña Amparo, dried Botanischen Gesellschaft 32: ix–x.
by Tonduz and sent in several consignments to Barringer, K. 1984. Typification of Schlechter’s Costa Rican
Schlechter. Again, the type specimen of Kefersteinia Orchidaceae, types collected by A. Brenes. Fieldiana
Bot. new series 17: 1–24.
wercklei was lost in 1943, but a copy of Schlechter’s
Beauverd, G. 1922. M. Adolphe Tonduz. Bulletin de la
drawing and the type specimen is in the AMES Societe Botanique de Geneve, ser.2, 14: 12–13.
herbarium in Harvard (Fig. 16a, 16b). In 1944 Bentham, G. 1881. Notes on Orchideae. Journal of the
Charles Schweinfurth described in “American Orchid Linnean Society 18(110): 337.
Society Bulletin” Chondrorhyncha pusilla from Peru Bogarín, D & F. Pupulin. 2007. El genero Campylocentrum
and recombined in a footnote the “allied” species en Costa Rica: algunas preguntas criticas y unas pocas
Kefersteinia wercklei Schltr. to Chondrorhyncha respuestas. The genus Campylocentrum in Costa Rica:
wercklei (Schltr.) C. Schweinfurth (Schweinfurth some critical questions and a few answers. Proc. of the
Second Scientific Conference on Andean Orchids: 12.
1944). The part about the subtribe Huntleyinae for
Bogarín, D. 2010. Revisión taxonómica del género
the 3rd edition of Schlechters “Die Orchideen” was Campylocentrum (Orchidaceae: Angraecinae) en Costa
written by Karlheinz Senghas, Helga Dietrich and Rica. Dissertation. Universidad de Costa Rica. Pp.
Günter Gerlach. The authors defined the new section 39–122.
Umbonata for the species-group around Kefersteinia Bogarín, D. & F. Pupulin. 2010. The genus Campylocentrum
316 LANKESTERIANA
(Angraecinae) in Costa Rica: a revision. Harvard Papers Ossenbach, C. 2003. History of Orchids in Central America,
in Botany 15(2): 353–414. from prehispanic times to the new millennium 2: 131–
Cogniaux, A. C. 1897. Orchidees nouvelles ou recement 132, 135. Unpublished manuscript.
introduites. Chronique Orchidéenne 1(4): 32. Ossenbach, C. 2006. Orchids in Costa Rica, part I : The era
Dressler, R. L. 1993. Field Guide to the Orchids of Costa of Rudolf Schlechter. Orchids (West Palm Beach) 75:
Rica and Panama. Comstock Publishing. 38–47.
Gómez, L. D. 1977. Contribuciones a la pteridologia Ossenbach, C. 2008. Adolphe Tonduz (1862–1921). Revista
Costarricense XII: Hermann Christ, su vida, obra e Biocenosis 21(1-2): 13–19.
influencia en la botanica nacional. Brenesia 12–13: 57–59. Ossenbach, C. 2009. Orchids and Orchidology in Central
Gómez, L. D. 1978. Contribuciones a la pteridologia America: 500 years of history. Lankesteriana 9(1–2):
Costarricense XII: Carlos Wercklé. Brenesia 14–15: 149–157.
361–393. Pfau, R. 1883a. The climate of Central America, orchid
Häsler, B. & T. W. Baumann. 2000. Henri Pittier, 1857– culture. Gardeners’ Chronicle, new ser. 20: 558–560.
1950, Leben und Werk eines Schweizer Naturforschers Pfau, R. 1883b. Hints on the culture of some rare Central
in den Neotropen. Reinhardt Verlag Basel. American orchids. Gardeners’ Chronicle, new ser 20:
Harding, P. 2008. Huntleyas and related orchids. Timber 658.
Press, Oregon. Pfau, R. 1883c. Cypripedium caudatum. Gardeners’ Chro-
Jiménez, J. A. 1945. Un Costarricense ilustre. Revista del nicle, new ser. 20: 722.
Instituto de defensa del Café de Costa Rica 15(131): Pfau, R. 1884a. Cypripedium roebbeleni. Gardeners’ Chro-
523–525. nicle, new ser. 21: 16.
Königer, W. 2007. Oncidium, eine Monographie, 3. Verlag Pfau, R. 1884b. Trichocentrum pfavii. Gardeners’ Chronicle,
Helga Königer. Pp. 89–92. new ser. 21: 50.
Kränzlin, F. 1919. Beiträge zur Kenntnis der Gattung Pfau, R. 1894. Notes on the fertilisation of orchids in the
Telipogon H.B.K. Annalen des Naturhistorischen tropics. Orchid Review 2: 295–296.
Hofmuseums Wien 33: 29–31. Pfau, R. 1895. New, rare, and beautiful orchids of Costa
Kränzlin, F. 1922. Orchidaceae-Monandrae, Tribus Onci- Rica and how they grow at home. San José, Costa Rica.
diinae - Odontoglosseae Pars II. Das Pflanzenreich Pp. 1–12.
IV.50(2): 199. Pfau, R. 1896. Costa Rica and its Orchids. Gardeners’
León, J. 1945. Notas sobre la labor botanica de don Alberto Chronicle, ser.3, 19: 548–549.
M. Brenes. Revista del Instituto de defensa del Café de Pittier, H. 1922. Gazette de Lausanne 154(55): 2
Costa Rica 15(131): 526–527. (24.2.1922).
Lobo, S. 2004. Tipos de Orquidaceas Brenesianas, descritas Pupulin, F. 1995. A revision of the genus Trichocentrum
por R.Schlechter, en el herbario nacional de Costa (Oncidiinae). Lindleyana 10(3): 183–210.
Rica. Lankesteriana 4(1): 37–45. Pupulin, F. 1997. The Trichocentrum pfavii group. Caesiana
López, G.D. 2009. La Nación (Costa Rica). 8 March 2009. 8: 1–14.
Luer, C. A. 1986. Thesaurus Masdevalliarum 7: sub. t.13. Pupulin, F. 2001. Miscellaneous new taxa in neotropical
Luer, C. A. 2001. Icones Pleurothallidinarum 22. Orchidaceae. Selbyana 22(1): 14–26.
Monographs in Systematic Botany from the Missouri Pupulin, F. 2005. Vanishing Beauty. Native Costa Rican
Botanical Garden, 86 :769–770. Orchids. Vol. 1: Acianthera–Kegeliella. Editorial de la
Mansfeld, R. 1931. Bluetenanalysen neuer Orchideen, Universidad de Costa Rica, San José. P. xxi.
II. Mittelamerikanische Orchideen. Repertorium Pupulin, F. 2010. Orchidaceae werckleanae: typification of
Specierum Novarum Regni Vegetabilis Beihefte 59(2): Costa Rican orchid species described from collections
t.74; 78, fig. 295; 309. by K.Wercklé. Botanical Journal of the Linnean Society
Mirenda, T. 2010. Telipogons, the ultimate orchids. Orchids 163: 111–154.
(West Palm Beach) 79: 552–554 Pupulin, F. & D. E. Mora de Retana.1994. A revision of the
Mora de Retana, D. E. & J. T. Atwood. 1993a. Masdevallia Costa Rican species of Trichocentrum. Selbyana 15(2):
tonduzii Woolward. Sub. pl. 1558 in: Orchids of Costa 87–103.
Rica, part 3. Icones Plantarum Tropicarum 16. Reichenbach, H.G. 1881. New garden plants: Trichocentrum
Mora de Retana, D. E. & J. T. Atwood. 1993b. Oncidium pfavii, Cirrhopetalum abbreviatum, Cirrhopetalum
luteum Rolfe. Sub. pl. 1572 in: Orchids of Costa Rica, trigonopus. Gardeners’ Chronicle, new ser. 16: 70.
part 3. Icones Plantarum Tropicarum 16. Reichenbach, H.G. 1883. New garden plants: Calanthe
Ortiz, F. 2002. Perfil de Don Alberto Brenes Mora. Brenesia Lentiginosa, Trichocentrum pfavii, Trichocentrum
57-58: 19–24. pfavii zonale, Odontoglossum hebraicum lineoligerum,

Dendrobium chrysanthum anophthalmum. Gardeners’ Stevens, F. B. 1977. Epidendrum pfavii (Rolfe). Orchid
Chronicle, new ser. 19: 44. Review 85(1008): 176–177.
Rolfe, R. A. 1893. New Orchids: Decade 6. Bulletin of Szlachetko, D. L. 2003. Senghasia, eine neue Gattung der
Miscellaneous Information (Kew) 1893: 172. Zygopetaleae. Journal für den Orchideenfreund 10(4):
Salazar Rodríguez, A.H. 2009. Alberto Manuel Brenes, el 332–344.
naturalista. Editorial de la Universidad de Costa Rica, Todzia, C. A. 1980. Revision of the Costa Rican species of
San José. Campylocentrum. Brenesia 18: 117–136.
Sánchez Porras, R. 2002. Pionero de la biologia en Costa Wercklé, C. 1903. Gemüsepflanzen von Costarica. Der
Rica, Manuel Alberto Brenes. Brenesia 57-58: 7–18. Tropenpflanzer 7: 425–439.
Schlechter, R. 1910. Orchidaceae novae et criticae, Decas Wercklé, C. 1904. Heteromorphismus epiphytischer Cereen.
XI. Repertorium Specierum Novarum Regni Vegetabilis Monatsschrift für Kakteenkunde 14: 62–63.
9: 30, 293. Wercklé, C. 1905. Cactaceae in Costa Rica. Monatsschrift
Schlechter, R. 1923. Beiträge zur Orchideenkunde von für Kakteenkunde 15: 3–4, 165–168, 179–181.
Zentralamerika. Repertorium Specierum Novarum Wercklé, C. 1907. Cacteen in Zentral-Columbien.
Regni Vegetabilis Beihefte 19: 1–75; 157; 268–269. Monatsschrift für Kakteenkunde 17: 18–20.
Schweinfurth, C. 1944. A genus and species unrecorded Williams, L. 1956. Enumeration of Orchidaceae of Central
for Peru. American Orchid Society Bulletin 12(11): America, British Honduras and Panama. Ceiba 5(1):
384–385. 195.
Senghas, K., H. Dietrich & G. Gerlach. 1992. 689. Woolward, F. H. 1906. Masdevallia tonduzii spec. nov.
Chaubardiella. In: R.Schlechter, Die Orchideen Ed.3, Bulletin de l’Herbier Boissier ser.2,6:82.
1B(26): 1646–1647.
Standley, P. C. 1926. Carlos Wercklé. Science 63(1626):
221–223.

LANKESTERIANA
LANKESTERIANA 13(3): 319—332. 2014.
Lankesteriana, a NEW GENUS IN THE PLEUROTHALLIDINAE

(ORCHIDACEAE)
Adam P. Karremans
Lankester Botanical Garden, University of Costa Rica, P.O. Box 302-7050 Cartago, Costa Rica.
Naturalis Biodiversity Center - NHN Universiteit Leiden, The Netherlands
adam.karremans@ucr.ac.cr
Abstract. We estimated phylogenetic relationships within Anathallis and related genera using Bayesian analyses
of nrITS sequence data. The genus is biphyletic in the molecular trees. A novel generic concept, Lankesteriana,
is proposed for the species Anathallis barbulata and 19 close relatives. The genus is more closely related to
some species of Trichosalpinx and Zootrophion than to Anathallis s.s. Species previously transferred from
Pleurothallis subgen. Acuminatia sect. Acuminatae to Anathallis, are here transferred to Stelis, to which they
are related phylogenetically. A few additional transfers to Anathallis are made. Lankesteriana is described and
characterized, and the necessary taxonomic transfers are made.
Key words: Anathallis, Lankesteriana, Specklinia, Stelis, phylogenetics, systematics
Introduction. The most recent reorganization of the However, Pridgeon’s data set included only species
generic classification of the Pleurothallidinae proposed of Pleurothallis subgen. Acuminatia sect. Alatae Luer
by Pridgeon and Chase (2001) was largely based on and did not include representatives of sect. Acuminatae
the results of the molecular phylogenetic studies of the Lindl. had been initially analyzed. Karremans (2010)
subtribe (Pridgeon et al. 2001). The initial analyses noted that species belonging to sect. Acuminatae were
were made on a representative set of species and their not related to those of sect. Alatae, but instead were
results were extrapolated to the whole subtribe by found embedded within Stelis Sw. (sensu Pridgeon
correlation with the classification previously proposed 2005), and suggested that, based on morphology, the
by Luer (1986), based on morphological similarities. same would be true for all other species in the section.
The circumscription of each genus was discussed and The studies by Chiron et al. (2012) and Karremans et
refined by Pridgeon (2005). al. (2013a) confirmed that additional species of the sect.
Subsequent molecular studies have shown that Acuminatae belonged in Stelis. The first set of authors
several of the genera of Pleurothallidinae still require even proposed a new combination for Anathallis rubens
a modified circumscription in order to comply with (Lindl.) Pridgeon & M.W.Chase in Stelis, but neglected
the monophyly criterion. Anathallis Barb.Rodr. is to transfer all other species of the section.
no exception. In the phylogenetic trees of Pridgeon Luer (2006) later segregated species of Pleurothallis
et al. (2001), species of Pleurothallis R.Br. subgen. subgen. Specklinia (Lindl.) Garay sect. Muscosae Lindl.
Acuminatia Luer (Luer 1999), including the type into Panmorphia Luer resulting in a genus of 73 highly
species of genus Anathallis, formed a clade together heterogeneous species with “Specklinia-like habit and
with species of Pleurothallis subgen. Specklinia sect. Anathallis-like flowers”. Luer later decided that the
Muscosae Lindl. The clade was found sister to a clade variation within Panmophia graded into the concept of
which includes Trichosalpinx Luer and Lepanthes Anathallis, and he reduced his Panmophia as a synonym
Sw., among others, and a broad concept of genus of the latter (Luer 2009). Analyses of molecular data by
Anathallis was re-established (Prodgeon & Chase Stenzel (2004) demonstrated that species of Panmorphia
2001; Pridgeon 2005). (including the type) were embedded within Anathallis.
320 LANKESTERIANA
This conclusion was confirmed by Chiron et al. (2012), taken using a DFC295 Leica digital microscope color
who included a broad representation of Anathallis camera with Leica FireCam version 3.4.1 software.
species in their analyses. Scanning electron microscope (SEM) micrographs
One Anathallis species, the broadly distributed were taken from flowers fixed in FAA (formalin 10%,
and highly variable Anathallis barbulata (Lindl.) glacial acetic acid 5%, water 35%, ethanol 50%).
Pridgeon & Chase, was shown to be distinct from all The floral samples were then dehydrated through a
the other species (Chiron et al. 2012). It is probably series of ethanol steps and subjected to critical-point-
the most well known species of the group here drying using liquid CO2. Dried samples were mounted
discussed. In Luer’s subgeneric classification of and sputter-coated with gold and observed with a
genus Pleurothallis R.Br., A. barbulata and a few JEOL JSM-5300 scanning electron microscope at an
close relatives were placed in Pleurothallis subgen. accelerating voltage of 10kV.
Specklinia sect. Muscosae Lindl. (Luer 1986). Later
Phylogenetic analysis —. The data matrix included
on, they were transferred to Anathallis by Pridgeon
56 individuals (Table 1), 18 of which were produced
and Chase (2001) and Panmorphia by Luer (2006).
in this study. The remaining data were obtained from
We present nrITS analyses showing that most species
GenBank (Pridgeon et al. 2001, Chiron et al. 2012,
of Panmorphia, including the type species, Anathallis
Karremans et al. 2013a). Plants were obtained from
sertularioides (Sw.) Pridgeon & Chase, are embedded
living collections at Lankester Botanical Garden
within Anathallis. Our data also show that Anathallis
in Costa Rica, the Hortus Botanicus in Leiden, and
barbulata and a few sister species are not closely related
private collections. Vouchers were deposited in
to other Anathallis and require generic recognition to
spirit collections at JBL and L. Fresh leaf and flower
maintain monophyly.
cuttings of approximately 1 cm2 were dried with silica
Most of these Specklinia-like species of Anathallis
gel. Samples (20 mg) were pulverized and extraction
have also been treated as species of Specklinia Lindl.
performed following the DNEasy procedure (Qiagen).
at some point or another. A more extensive molecular
The nuclear ribosomal internal transcribed spacer
phylogenetic analysis of Specklinia (Karremans et
(nrITS) region was amplified using the methods and
al. unpublished), excludes the species here treated as
primers for sequencing and amplification described
Anathallis (Pupulin et al. 2012, Bogarín et al. 2013,
by Sun et al. (1994), and Sanger sequencing was
Karremans et al. 2013b), requiring the circumscription
done commercially by Macrogen on a 96-capillary
of those genera in the present manuscript. It
3730xl DNA Analyzer automated sequencer (Applied
becomes necessary as well to propose the systematic
Biosystems, Inc.) using standard dye-terminator
modifications required in order to attain monophyly
chemistry (Macrogen, Inc.).
within Anathallis, Specklinia, and Stelis and to propose
The Staden et al. (2003) package was used for
a segregated generic concept for the A. barbulata and
editing of the sequences. Contigs were exported as
its close relatives.
.fas files and opened in Mesquite v2.72 (Maddison
& Maddison 2007), where they were checked for
Material and Methods. This study was conducted at
base calling errors, the matrix was aligned manually.
Jardín Botánico Lankester (JBL) of the Universidad de
The ends of each data set were trimmed to eliminate
Costa Rica and Naturalis Biodiversity Center - Leiden
possible erroneous data, and gaps were regarded
University, between October 2011 and October 2013.
as missing data (filled with Ns). The data matrix is
Living material was studied at Lankester Botanical
deposited in the Dryad Digital Repository (Heneghan
Garden and the Hortus Botanicus in Leiden, while dried
et al. 2011). Echinosepala aspasicensis was used as
and spirit material was deposited at CR, JBL-spirit and
the outgroup, as it was found to be one of the most
L-spirit. Taxon names mostly follow Pridgeon (2005).
distantly related of all included species (Pridgeon et
Photography —. Color illustrations of complete al. 2001). The trees were produced with an analysis
flowers were made using a Nikon D5100 digital camera, of the nrITS dataset of 43 sequences using BEAST
while photographs of the columns and pollinaria were v1.6.0. (Drummond & Rambaut 2007). Parameters
Karremans — Lankesteriana, new genus 321
were set to preset, except for substitution model Discussion . The DNA based evidence obtained here
GTR with 10 categories, clock model uncorrelated supports the results of Chiron et al. (2012), showing
lognormal, tree prior Yule process, and number of that Anathallis is non-monophyletic. The addition
generations 20,000,000. The resulting trees were of other accessions of the variable A. barbulata, and
combined using TreeAnnotator v1.6.0., where the of its close relatives A. duplooyi, A. cuspidata and
first 2000 trees were used as burn-in. FigTree v1.3.1. A. fractiflexa confirms that this species group as a
(Rambaut 2009) was used to edit the resulting tree. whole should be excluded from Anathallis. The two
Posterior probabilities are given for each node in highly supported clades of Anathallis are not sister
decimal form. to each other. Most of these species had already been
segregated from Anathallis into Panmorphia by Luer,
Results. The consensus gene tree (Fig. 1) was obtained together with several others. However, Panmorphia
from a BEAST analysis of a matrix of 56 ITS sequences is not monophyletic. The type species of Panmorphia
(Table 1), including 41 individuals belonging to 34 is a member if Anathallis s.s., necessitating a novel
different species of genus Anathallis. The resulting generic concept for the remaining species of the
tree includes two highly supported clades of Anathallis former Panmorphia. When describing Panmorphia,
species; the first is coded clade Anathallis and the Luer (2006) suggested that he could find a “continuum
second clade has been coded Lankesteriana. of variations among them”, however, he did mention
Clade Lankesteriana (P.P. = 0.98) includes the that “several affinities among the species can be
accessions of the species Anathallis barbulata, A. recognized”. One of those affinities was likely this
cuspidata, A. duplooyi and A. fractiflexa. A clade little group. In fact, this species group can also be
including Trichosalpinx berlineri and T. dependens easily distinguished from other species of the genus
(Trichosalpinx II) is highly supported (P.P. = 1) as on morphological grounds, and they are therefore
sister to the Lankesteriana clade. Sister to both is recognized as a segregate genus here forth.
a clade including species of Zootrophion with high
support (P.P. = 0.94). Lankesteriana Karremans, Gen. Nov.
Clade Anathallis is highly supported (P.P. = 1) Type: Pleurothallis barbulata Lindl. Folia Orch.
and includes all accessions of genus Anathallis with Pleurothallis 40. 1859. Replaced name for Pleurothallis
the exception of those found in clade Lankesteriana. barbata H.Focke, Bot. Zeitung (Berlin) 11(13): 227.
Clade Anathallis includes A. obovata, type species 1853 (non Pleurothallis barbata Westc., Phytologist 1:
of the genus, and A. sertularioides, type species of 54. 1841).
genus Panmorphia. A clade including Trichosalpinx
Species of Lankesteriana are somewhat similar to
blaisdellii and T. orbicularis (Trichosalpinx I) is found
Anathallis but can be distinguished by the tri-alate
with low support (P.P. = 0.35) sister to the Anathallis.
ovary (vs. cylindrical), the bilabiate flowers with
Altogether they are sister, with medium support
lateral sepals convergent and usually fused to above
(P.P.=0.66), to a highly supported (P.P. = 1) clade which
the middle (vs. sepals free and spreading), the deeply
includes the accessions of Frondaria Luer, Lepanthes
depressed midline of the lip (vs. not or superficially
Sw. and Lepanthopsis (Cogn.) Ames.
depressed), the bilobed, helmet-shaped rostellum
Both mentioned clades are sister to each other, and
(vs. ligulate, not bilobed). Additionally, none of the
in turn to an accession of Trichosalpinx arbuscula
known species of Lankesteriana have: 1) a habit that
(Trichosalpinx III), with low support (P.P. = 0.44). High
exceeds 3 cm tall (excluding the inflorescence), 2)
support (P.P. = 1) is found for a clade which includes
ramicauls longer than the leaf, 3) multiple flowers
all the accessions of Anathallis, Frondaria, Lepanthes,
open simultaneously on an inflorescence; 4) whitish to
Lepanthopsis, Trichosalpinx and Zootrophion Luer.
greenish flowers; all of which are commonly found in
Branch length varies greatly within the whole
Anathallis.
group. The length of accessions of clade Lankesteriana
double or triple those of Anathallis, the latter having Description: Plants very small, 0.5-3 cm tall
accumulated many more nucleotide changes. (excluding the inflorescence), epiphytic, caespitose.
322 LANKESTERIANA
Figure 1. Consensus tree from a BEAST analysis of a matrix of 56 ITS sequences. The analysis ran for 20,000,000
generations. A — Branch length transformed to be equal for each species. Values on the nodes are Posterior Probabilities.
Species names for each terminal is included. B —Relative branch lengths maintained, showing amount of evolutionary
changes. Scale equals a 2% change. Posterior probability values and species names are excluded, but are equal to those
of A. Trees edited by A.P. Karremans using FigTree.

Table 1. List of vouchers and GenBank number used in the phylogenetic analyses. Scientific names mostly follow Pridgeon
2005.
Voucher collector and GenBank

Taxon Source
number number
Anathallis adenochila (Loefgr.) F.Barros (1) van den Berg 2148 (HUEFS) JQ306490 Chiron et al. 2012
Anathallis adenochila (Loefgr.) F.Barros (2) Karremans 4871 (L) KC425725 This study
Anathallis angustilabia (Schltr.) Pridgeon & M.W.Chase Manning 890604 (K) AF262868 Pridgeon et al. 2001
Anathallis aristulata (Lindl.) Luer van den Berg 2042 (HUEFS) JQ306338 Chiron et al. 2012
Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (1) Chiron 11071 (HUEFS) JQ306457 Chiron et al. 2012
Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (2) Bogarín 8606 (JBL) KC425726 This study
Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (3) Karremans 5750 (L) KF747834 This study
Anathallis bolsanelloi Chiron & V.P.Castro van den Berg 2000 (HUEFS) JQ306342 Chiron et al. 2012
Anathallis burzlaffiana (Luer & Sijm) Luer Karremans 4857 (L) KC425727 This study
Anathallis citrina (Schltr.) Pridgeon & M.W.Chase van den Berg 2086 (HUEFS) JQ306498 Chiron et al. 2012
Anathallis corticicola (Schltr. ex Hoehne) Pridgeon &
Hermans 3685 (K) AF262870 Pridgeon et al. 2001
M.W.Chase
Anathallis cuspidata (Luer) Pridgeon & M.W. Chase Bogarín 9619 (JBL) KF747835 This study
Anathallis depauperata (Cogn.) Karremans 4808 (L) KC425735 This study
Anathallis duplooyi (Luer & Sayers) Luer Karremnas 4888 (JBL) KF747836 This study
Anathallis fractiflexa (Ames & C. Schweinf.) Luer (1) Bogarín 8988 (JBL) KC425728 This study
Anathallis fractiflexa (Ames & C. Schweinf.) Luer (2) Bogarín 8988 (JBL) KC425729 This study
Anathallis grayumii (Luer) Luer (1) Karremans 2747 (JBL) KC425730 This study
Anathallis grayumii (Luer) Luer (2) Pupulin 3794 (JBL) KC425731 This study
Anathallis heterophylla Barb.Rodr. van den Berg 2031 (HUEFS) JQ306339 Chiron et al. 2012
Anathallis kautskyi (Pabst) Pridgeon & M.W.Chase van den Berg 2051 (HUEFS) JQ306340 Chiron et al. 2012
Anathallis lewisiae (Ames) Solano & Soto Arenas Bogarín 1056 (JBL) KC425733 This study
Anathallis linearifolia (Cogn.) Pridgeon & M.W.Chase Hrmans 2336 (K) AF262869 Pridgeon et al. 2001
Anathallis microgemma (Schltr. ex Hoehne) Pridgeon &
Manning 940319 (K) AF262894 Pridgeon et al. 2001
M.W.Chase
Anathallis minutalis (Lindl.) Pridgeon & M.W.Chase Jimenez-M. 1044 (UNAM) AF262922 Pridgeon et al. 2001
Anathallis nanifolia (Foldats) Luer Karremans 4793 (L) KC425736 This study
Anathallis nectarifera Barb.Rodr. van den Berg 2078 (HUEFS) JQ306458 Chiron et al. 2012
Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (1) Kollmann 6092 (MBML) JQ306497 Chiron et al. 2012
Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (2) Stenzel 840 (CU) JF934822 Stenzel 2004
Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (3) Karremans 4796 (L) KF747797 This study
Anathallis ourobranquensis Campacci & Menini Chiron 11220 (HUEFS) JQ306459 Chiron et al. 2012
Anathallis pabstii (Garay) Pridgeon & M.W.Chase Karremans 4821 (L) KC425737 This study
Anathallis pachyphyta (Luer) Pridgeon & M.W.Chase Karremans 4795 (L) KC425734 This study
Anathallis peroupavae (Hoehne & Brade) F. Barros Karremans 5759 (L) KF747837 This study
Anathallis petropolitana (Hoehne) Luer & Toscano van den Berg 2089 (HUEFS) JQ306491 Chiron et al. 2012
Anathallis piratiningana (Hoehne) F.Barros van den Berg 2066 (HUEFS) JQ306344 Chiron et al. 2012
Anathallis pubipetala (Hoehne) Pridgeon & M.W.Chase van den Berg 2106 (HUEFS) JQ306460 Chiron et al. 2012
Anathallis rabei (Foldats) Luer Karremans 4794 (L) KC425738 This study
Anathallis radialis (Porto & Brade) Pridgeon & M.W.Chase Chiron 10144 (HUEFS) JQ306345 Chiron et al. 2012
Anathallis rudolfii (Pabst) Pridgeon & M.W.Chase van den Berg 2127 (HUEFS) JQ306461 Chiron et al. 2012
Anathallis sertularioides (Sw.) Pridgeon & M.W.Chase Solano 807 (UNAM) AF262871 Pridgeon et al. 2001

324 LANKESTERIANA
Table 1. Continues.
Voucher collector and GenBank

Taxon Source
number number
Anathallis welteri (Pabst) F.Barros van den Berg 2009 (HUEFS) JQ306341 Chiron et al. 2012
Echinosepala aspasicensis (Rchb. f.) Pridgeon & M.W.
Hermans 2160 (K) AF262905 Pridgeon et al. 2001
Chase
Frondaria caulescens (Lindl.) Luer Luer 18778 (K) AF262914 Pridgeon et al. 2001
Lepanthes felis Luer & R. Escobar Hermans 2899 (K) AF262891 Pridgeon et al. 2001
Lepanthes steyermarkii Foldats Hermans 2682 (K) AF262889 Pridgeon et al. 2001
Lepanthes woodburyana Stimson Hermans 2931 (K) AF262890 Pridgeon et al. 2001
Lepanthopsis astrophora Garay Manning 941040 (K) AF262893 Pridgeon et al. 2001
Lepanthopsis floripecten (Rchb. f.) Ames van den Berg 2063 (HUEFS) JQ306336 Chiron et al. 2012
Trichosalpinx arbuscula (Lindl.) Luer Hermans 1266 (K) AF262888 Pridgeon et al. 2001
Trichosalpinx berlineri (Luer) Luer Hermans 1605 (K) AF262900 Pridgeon et al. 2001
Trichosalpinx blaisdellii (S.Watson) Luer Kew 1997-7412 (K) AF262887 Pridgeon et al. 2001
Trichosalpinx dependens (Luer) Luer van den Berg 2011 (HUEFS) JQ306456 Chiron et al. 2012
Trichosalpinx orbicularis (Lindl.) Luer Hermans 1349 (K) AF262886 Pridgeon et al. 2001
Zootrophion atropurpureum (Lindl.) Luer (1) Kew 1997-7414 (K) AF262898 Pridgeon et al. 2001
Zootrophion atropurpureum (Lindl.) Luer (2) van den Berg 2056 (HUEFS) JQ306415 Chiron et al. 2012
Zootrophion serpentinum Luer Manning 921030 (K) AF262899 Pridgeon et al. 2001
Ramicauls ascending, shorter than the leaf, never however as is frequent with other tiny Pleurothallids,
proliferating, with 1-3 imbricating, tubular, glandular species of this genus tend to be overlooked in the field
to microscopically glandular sheaths. Leaf erect to and lumped together into broad and variable species
prostrate. Inflorescence elongate, frequently exceeding concepts. Species of Lankesteriana are distributed
the leaves, successive, with one flower open at a time. from southern Mexico, through Central America, the
Flowers usually brownish-purple, sepals glabrous to Andes, and all the way down to Bolivia and Brazil
ciliate. Ovary trialate. Sepals elliptic, acute, the lateral (Fig. 4). Costa Rica, Ecuador and Colombia contain
ones fused to above the middle or least convergent, the largest number of species, whereas Brazil, the
forming a synsepal. Petals lanceolate to ovate-elliptic, center of diversity of sister genus Anathallis, has
widest near the middle, obtuse or acute, to acuminate, just a few Lankesteriana; they are notably absent
sometimes caudate. Lip oblong, to more or less from the Antilles. They occur between 280 and 2800
pandurate, with a pair of basal sub-orbicular lobes, m in elevation, but most are found at mid elevations
with a deep linear middle depression. Column winged, between 600 and 2000 m.
androclinium fimbriate-dentate, rostellum helmet-
shaped, with prominent lateral lobes. Anther helmet- Luer (1986) had noted that flowers of species here
shaped. Pollinia in pairs, with reduced, granulose, treated as Lankesteriana were similar to some species
whale-tail shaped caudicles (Fig. 2 & 3). of Trichosalpinx subgen. Trichosalpinx (Trichosalpinx
I & II in Fig. 1). In fact, they resemble species of
Etymology: The name honors both the Lankester
Trichosalpinx much more than Anathallis. Trichosalpinx
Botanical Garden of the University of Costa Rica,
was established by Luer for a group of species which
which is celebrating 40 years of existence, and also
shared the lepanthiform bracts of the stem and which
the homonymous scientific journal Lankesteriana,
did not fit well in either Draconanthes (Luer) Luer,
International Journal on Orchidology.
Lepanthes or Lepanthopsis (Luer 1997), however that
Distribution and Ecology: Nineteen species of meant that they did not share a particular synapomorphy,
Lankesteriana Karremans are recognized here, and may not represent a natural grouping. The inclusion
Figure 2. SEM images of micromorphology of Lankesteriana species. A — Column ventral view showing the
androclinium, anther cap, helmet-like rostellum and stigma. B — The flattened lip, showing the midline depression,
the basal sub-orbicular lobes and the glandular hairs near the apex. Specimens are Lankesteriana cuspidata (A-left &
B; Bogarín 9619; JBL-spirit) and Lankesteriana barbulata (A-right; Karremans 5444; JBL-spirit). Photographs by
A.P. Karremans
of a few species of Trichosalpinx in the DNA studies of

Pridgeon et al. (2001) evidenced the polyphyly of the
genus. A phylogenetic analysis of genus Trichosalpinx,
including many more additional species, further
evidences the need for a complete re-circumscription
of this highly polyphyletic genus, which is diversely
interrelated with all other genera in the clade (Fernández
et al. unpublished).
Subgenus Trichosalpinx is biphyletic in the analysis
presented here (Fig. 1), with a clade including the type
of the genus (Trichosalpinx I), sister to Anathallis, and a
second clade (Trichosalpinx II), sister to Lankesteriana.
A reconsideration of Trichosalpinx will be a hazardous
Left, figure 3. Micrographs taken with the Leica stereo

microscope. A. Apex of the column in ventral view, from
left to right, of Lankesteriana cuspidata (Fernández
695; JBL-spirit) and Anathallis polygonoides (JBL-
28237; JBL-spirit). B. Pollinaria, from left to right, of
Lankesteriana cuspidata (Fernández 695; JBL-spirit),
Anathallis polygonoides (JBL-28237; JBL-spirit),
Anathallis lewisae (Bogarín 1056; JBL-spirit) and
Trichosalpinx blaisdellii (Pupulin 1092; JBL-spirit).
Photographs by A.P. Karremans.
326 LANKESTERIANA
Key to the genera with Specklinia-like habit

1. Inflorescence frequently lax-flexuous, sepals usually
caudate, petals fimbriate, acute to caudate, column
inornate to narrowly winged .....................................
........................................... Muscarella (Specklinia)
1. Inflorescence mostly congested-straight, sepals
usually not caudate, petals entire to minutely denti-
culate, infrequently caudate, column ornate ......... 2
2. Petals linear to lanceolate, acute to acuminate,
column wings quadrate to triangular, androcli-
nium conspicuously fimbriate .......................... 3
3. Inflorescence single or simultaneously multi-
flowered. Flowers star-shapped, lateral sepals
free, flowers mostly white, green or yellow, lip
lacking a deep mid-line depression, rostellum
ligulate .......................................... Anathallis
3. Inflorescence successively single flowered.
Flowers bilabiate, lateral sepals fused, flowers
brownish-purple, lip with deep a midline
depression, rostellum helmet-like bilobate . ....
Figure 4. Distribution map (in green) of the 19 known ................................................. Lankesteriana
species of Lankesteriana Karremans. The highest 2. Petals elliptic to spathulate, obtuse, column wings
diversity of the genus in found from Costa Rica to rounded, androclinium erose or inornate ......... 4
Colombia and Ecuador. 4. Lip mostly linear-ligulate, column wings
prominent, pollinia without caudicles ............
task that falls outside of the scope of this study. It ....................................................... Specklinia
suffices to say that we consider sister genera Anathallis 4. Lip trilobed, with a pair of suborbicular lobes
and Trichosalpinx (Trichosalpinx I) distinct enough to close to the middle, columninconspicuously
keep them as separate genera and that the clade which ornate or inornate, pollinia with caudicles .....
includes Lankesteriana and Trichosalpinx II was until ....................................................... Pabstiella
now unnamed. When revising Trichosalpinx in the
future it can be re-considered if it is advantageous to Lankesteriana abbreviata (Schltr.) Karremans, comb.
include the few species belonging to Trichosalpinx nov.
II in a broadened Lankesteriana, however, based on Bas. Pleurothallis abbreviata Schltr., Repert. Spec.
morphology and genetic distance, such a move is in Nov. Regni Veg. 10: 352. 1912.
our view unfavorable.
Lankesteriana barbulata (Lindl.) Karremans, comb.
With species of subgen. Trichosalpinx they share
nov.
the fused sepals (with a few exceptions), the usually
Bas. Pleurothallis barbulata Lindl. Folia Orch.
purplish-brown flowers, the extremely sensitive linear
Pleurothallis 40. 1859. Replacement name for P.
lip, with a pair of rounded lobes at the base, and a
barbata H.Focke, 1853.
midline depression and the helmet-shaped rostellum.
These traits suggest that both groups share a similar Note: Specklinia pereziana Kolan. published in 2011
pollinator group. Species of subgen. Trichosalpinx from Colombia, is virtually indistinguishable from
however can be easily distinguished from those of Lankesteriana barbulata, a common, widely distributed,
Lankesteriana by the much larger plants, with long variable species with several heterotypic synonyms. As
ramicauls covered with lepanthiform bracts and the L. barbulata was not even mentioned by the author there
simultaneously multi-flowered inflorescences. is no evidence to separate the two.
Lankesteriana casualis (Ames) Karremans, comb. nov. Lankesteriana involuta (L.O.Williams) Karremans,
Bas. Pleurothallis casualis Ames, Sched. Orch. 9: comb. nov.
30, 1925. Bas. Pleurothallis involuta L.O.Williams, Bot.
Mus. Leafl. 12: 239. 1946.
Lankesteriana caudatipetala (C.Schweinf.) Karre-
mans, comb. nov. Lankesteriana millipeda (Luer) Karremans, comb. nov.
Bas. Pleurothallis caudatipetala C.Schweinf. Bot. Bas. Pleurothallis millipeda Luer, Orquideología
Mus. Leafl. 10: 175. 1942. 20: 216. 1996.
Lankesteriana comayaguensis (Ames) Karremans, Lankesteriana minima (C.Schweinf.) Karremans,

comb. nov. comb. nov.
Bas. Pleurothallis comayaguensis Ames, Bot. Mus. Bas. Pleurothallis minima C.Schweinf., Bot. Mus.
Leafl. 4: 31, 1936. Leafl. 3: 82. 1935.
Lankesteriana muricaudata (Luer) Karremans, comb.

Lankesteriana cuspidata (Luer) Karremans, comb.
nov.
nov.
Bas. Pleurothallis muricaudata Luer, Selbyana 7:
Bas. Pleurothallis cuspidata Luer, Selbyana 3: 282,
119. 1982.
1977.
Lankesteriana rubidantha (Chiron & Xim.Bols.)
Lankesteriana duplooyi (Luer & Sayers) Karremans,
Karremans, comb. nov.
comb. nov.
Bas. Specklinia rubidantha Chiron & Xim.Bols.,
Bas. Pleurothallis duplooyi Luer & Sayers. Rev.
Richardiana 9: 125. 2009.
Soc. Bol. Bot. 3: 48, 2001.
Lankesteriana steinbuchiae (Carnevali &
Lankesteriana edmeiae (F.J. de Jesus, Xim. Bols. &
G.A.Romero) Karremans, comb. nov.
Chiron) Karremans, comb. nov.
Bas. Pleurothallis steinbuchiae Carnevali &
Bas. Anathallis edmeiae F.J. de Jesus, Xim. Bols. &
G.A.Romero, Novon 4: 90. 1994.
Chiron, Richardiana 13: 296. 2013.
Lankesteriana escalarensis (Carnevali & Luer) Anathallis Barb.Rodr., Gen. Sp. Orch. Nov. 1: 23.
Karremans, comb. nov.. 1877.
Bas. Pleurothallis escalarensis Carnevali & Luer, Type: Anathallis fasciculata Barb.Rodr., Gen. Sp.
Novon 13: 414. 2003. Orch. Nov. 1: 23. 1877.
Lankesteriana fractiflexa (Ames & C.Schweinf.) This relatively old genus remained mostly unused
Karremans, comb. nov. until it was re-established by Pridgeon and Chase
Bas. Pleurothallis fractiflexa Ames & C.Schweinf., (2001), and re-defined by Pridgeon (2005). It was not
Sched. Orch. 10: 26, 1930. clear how many and which species actually belonged
to the concept, but initially about 90 species were
Lankesteriana haberi (Luer) Karremans, comb. nov. transferred. About 90 more names were added by other
Bas. Pleurothallis haberi Luer, Selbyana 23:36. 2002. authors since then (mostly transfers from other genera,
but also new species). If we exclude the species that
Lankesteriana imberbis (Luer & Hirtz) Karremans,
belong to Lankesteriana and Stelis, we end up just shy
comb. nov.
of 140 species, a number which seems reasonable.
Bas. Pleurothallis imberbis Luer & Hirtz,
Species of Anathallis are distributed from southern
Lindleyana 11: 163, 1996.
Mexico through Central America, the Antilles and
Lankesteriana inversa (Luer & R.Vásquez) all South America down to Argentina. They are most
Karremans, comb. nov. diverse in Brazil at low to mid elevations. They are
Bas. Pleurothallis inversa Luer & R.Vásquez, Rev. easily recognized by the more or less star-shaped flower,
Soc. Bol. Bot. 3: 50. 2001. with linear to lanceolate, acute to acuminate petals

328 LANKESTERIANA
that are similar to the sepals. The lip is horizontally Bas. Pleurothallis ariasii Luer & Hirtz, Lindleyana
placed and very sensitive, its general shape is linear- 12: 42. 1997.
ligulate but frequently it has small lobes at the base
Stelis asperilinguis (Rchb.f. & Warsz.) Karremans,
and/or middle. The column is sharply winged and
comb. nov..
prominently fimbriate. The pollinaria come in pairs
Bas. Pleurothallis asperilinguis Rchb.f. & Warsz.,
and have reduced whale-tail shaped caudicles.
Bonplandia (Hannover) 2: 114. 1854.
One species before treated as Specklinia is
transferred here to Anathallis based on those Stelis aurea (Lindl.) Karremans, comb. nov.
morphological features. Bas. Pleurothallis aurea Lindl., Ann. Mag. Nat.
Hist. 12: 397. 1843.
Anathallis napintzae (Luer & Hirtz) Karremans,
Replaced synonym: Dendrobium acuminatum
comb. nov.
Kunth in F.W.H.von Humboldt, A.J.A.Bonpland &
Bas. Pleurothallis napintzae Luer & Hirtz,
C.S.Kunth, Nov. Gen. Sp. 1: 357. 1816 = Anathallis
Lindleyana 11: 173. 1996.
acuminata (Kunth) Pridgeon & M.W. Chase.
Stelis Sw., J. Bot. (Schrader) 2: 239. 1799. Note: The name Dendrobium acuminatum has priority
Lectoype: Epidendrum ophioglossoides Jacq., Enum. over P. aurea, however Stelis acuminata Luer & Hirtz
Pl. Carib., 29. 1760. occupies the combination in Stelis. The heterotypic
synonyms of this species, if not proven distinct and
Although this genus has been traditionally
if not occupied in genus Stelis, have priority in the
accepted (Karremans et al. 2013), it was greatly
necessity of a new name. Therefore Stelis aurea is
modified by Pridgeon and Chase (2001) and Pridgeon
proposed for this species.
et al. (2005). As such the genus was broadened from
its classic definition (Luer 2009) to include several Stelis candida (Luer & Hirtz) Karremans, comb. nov.
species groups before placed in Pleurothallis. Stelis Bas. Pleurothallis candida Luer & Hirtz, Monogr.
in its broad sense was phylogenetically analyzed Syst. Bot. Missouri Bot. Gard. 76: 107. 1999.
and extensively discussed by Karremans (2010) and
Stelis catenata Karremans, nom. nov.
Karremans et al. (2013), and was proven largely
Replaced synonym: Pleurothallis ramulosa Lindl.,
monophyletic if the species of Pleurothallis subgen.
Fol. Orchid. 9: 33. 1859.
Acuminatia sect. Acuminatae were transferred to it.
Etymology: From the Latin catenatus referring to
That species group was found to be closely related
the chains of ramicauls formed.
to the species of Stelis in a strict sense (Luer 2009).
It will suffice to say here that although smaller, Note: The name Stelis ramulosa Luer & Dalström
better defined and informative generic concepts are (2004) occupies the combination in Stelis required for
preferred by the author, these species are transferred Pleurothallis ramulosa [=Anathallis ramulosa (Lindl.)
to a broad sense of Stelis where they are more Pridgeon & M.W. Chase]. Its heterotypic synonym
accurately placed than previously. Pleurothallis superposita Schltr. (1916) can’t be
In any other scenario this species group would combined in Stelis either as Stelis superposita Schltr.
require generic recognition, however, several other (1915) is also occupied. A new name for the species is
genera would have to be recognized and/or re- therefore proposed.
circumscribed as well. This might be possible at a Stelis coripatae (Luer & R.Vásquez) Karremans,
later stage when the species belonging to each of those comb. nov.
other groupings are well understood. The species Bas. Pleurothallis coripatae Luer & R.Vásquez,
transferred here were in any case already proven non- Phytologia 46: 362. 1980.
monophyletic as a group by Karremans et al. (2013),
Stelis dimidia (Luer) Karremans, comb. nov.
however, all still within the broad concept of Stelis.
Bas. Pleurothallis dimidia Luer, Monogr. Syst.
Stelis ariasii (Luer & Hirtz) Karremans, comb. nov. Bot. Missouri Bot. Gard. 76: 109. 1999.
Stelis jesupiorum (Luer & Hirtz) Karremans, comb. nov. Stelis mediocarinata (C.Schweinf.) Karremans, comb.
Bas. Pleurothallis jesupiorum Luer & Hirtz, nov.
Lindleyana 11: 164. 1996. Bas. Pleurothallis mediocarinata C.Schweinf.,
Fieldiana, Bot. 33: 26. 1970.
Stelis lagarophyta (Luer) Karremans, comb. nov.
Bas. Pleurothallis lagarophyta Luer, Monogr. Syst. Stelis melanopus (F.Lehm. & Kraenzl.) Karremans,
Bot. Missouri Bot. Gard. 76: 112. 1999. comb. nov.
Bas. Pleurothallis melanopus F.Lehm. & Kraenzl.,
Stelis lamprophylla (Schltr.) Karremans, comb. nov.
Bot. Jahrb. Syst. 26: 443. 1899.
Bas. Pleurothallis lamprophylla Schltr., Repert.
Replaced synonym: Pleurothallis stenophylla
Spec. Nov. Regni Veg. 15: 205. 1918.
Lehm. & Kraenzl., Bot. Jahrb. Syst. 26: 442. 1899 =
Replaced synonym: Pleurothallis dolichopus
Anathallis stenophylla (Lehm. & Kraenzl.) Pridgeon
Schltr., Repert. Spec. Nov. Regni Veg. 10: 394. 1912 =
& M.W. Chase.
Anathallis dolichopus (Schltr.) Pridgeon & M.W. Chase.
Note: The name Pleurothallis dolichopus has priority Note: The name Pleurothallis stenophylla has priority
over P. lamprophylla, however Stelis dolichopus Schltr. over P. melanopus, however Stelis stenophylla Rchb.f.
occupies the combination in Stelis. The heterotypic occupies the combination in Stelis. The heterotypic
synonyms of this species, if not proven distinct and synonyms of this species, if not proven distinct and
if not occupied in genus Stelis, have priority in the if not occupied in genus Stelis, have priority in the
necessity of a new name. Therefore Stelis lamprophylla necessity of a new name. Therefore Stelis melanopus
is proposed for this species. is proposed for this species.
Stelis lauta Karremans, nom. nov. Stelis meridana (Rchb.f.) Karremans, comb. nov.
Replaced Synonym: Pleurothallis concinna Luer & Bas. Pleurothallis meridana Rchb.f., Linnaea 22:
R.Vásquez, Revista Soc. Boliv. Bot. 2: 133. 1999. 826. 1850.
Etymology: From the Latin lautus, elegant, fine, as Stelis montserratii (Porsch) Karremans, comb. nov.
a replacement for the also Latin adjective concinnatus Bas. Pleurothallis montserratii Porsch, Oesterr.
used in the original description of this species. Bot. Zeitsch. 158. 1905.
Note: The name Stelis concinna Lindl. (1834) occupies Replaced synonym: Pleurothallis rubens Lindl.,
the combination in Stelis required for Pleurothallis Edwards’s Bot. Reg. 21: t. 1797. 1835.
concinna [=Anathallis concinna (Leur & R.Vásquez) Note: The name Pleurothallis rubens has priority over
Pridgeon & M.W. Chase]. A new name for the species P. montserratii, however as Stelis rubens Schltr. (1910)
is proposed. occupies the combination in Stelis, a new name has to
Stelis lennartii Karremans, nom. nov. be proposed in that genus. Chiron et al. (2012) proposed
Replaced Synonym: Pleurothallis anderssonii Stelis neorubens Chiron, however the heterotypic
Luer, Lindleyana 11: 145. 1996. synonyms of this species, if not proven distinct and
Etymology: The name honors Lennart Andersson, if not occupied in genus Stelis, have priority in the
to whom the species was originally dedicated. necessity of a new name. Therefore Stelis montserratii
is proposed for this species and has priority over S.
Note: The name Stelis anderssonii Luer & Endara neorubens, unless it is proven a distinct species.
occupies the combination in Stelis required for
Pleurothallis anderssonii [=Anathallis anderssonii Stelis papuligera (Schltr.) Karremans, comb. nov.
(Luer) Pridgeon & M.W. Chase]. A new name for the Bas. Pleurothallis papuligera Schltr., Repert. Spec.
species is proposed. Nov. Regni Veg. 10: 453. 1912.
Stelis maguirei (Luer) Karremans, comb. nov. Stelis regalis (Luer) Karremans, comb. nov.
Bas. Pleurothallis maguirei Luer, Monogr. Syst. Bas. Pleurothallis regalis Luer, Selbyana 5: 178.
Bot. Missouri Bot. Gard. 76: 113. 1999. 1979.
330 LANKESTERIANA
Stelis scariosa (Lex.) Karremans, comb. nov. diagnosable using morphological characters. With the
Bas. Dendrobium scariosum Lex. in P.de La Llave exclusion of the species belonging to Lankesteriana and
& J.M.de Lexarza, Nov. Veg. Descr. 2(Orchid. Opusc.): Stelis, the recircumscribed Anathallis is monophyletic
39. 1825. based on all available data.
It must be stressed that the present work does not
Stelis schlimii (Luer) Karremans, comb. nov.
intend to be a molecularly based phylogenetic study
Bas. Pleurothallis schlimii Luer, Monogr. Syst.
of Anathallis and Lankesteriana. Instead, a systematic
Bot. Missouri Bot. Gard. 76: 120. 1999.
re-circumscription of those genera is proposed using
Stelis sclerophylla (Lindl.) Karremans, comb. nov. an all evidence approach in which clear morphological
Bas. Pleurothallis sclerophylla Lindl., Edwards’s patterns are correlated with available DNA evidence.
Bot. Reg. 21: t. 1797. 1835. The analyses of additional genetic regions and of
Stelis soratana (Rchb.f.) Karremans, comb. nov. a broader species set might refine the phylogenetic
Bas. Pleurothallis soratana Rchb.f., Xenia Orchid. relationships among these species, however, as
3: 25. 1881. already evidenced in several earlier studies the
basic phylogenetic reconstruction produced using a
Stelis spathilabia (Schltr.) Karremans, comb. nov.
representative number of nrITS sequences is mostly
Bas. Pleurothallis spathilabia Schltr., Repert. Spec.
found unchanged (Pridgeon & Chase 2001; Karremans
Nov. Regni Veg. Beih. 27: 56. 1924.
2010; Karremans et al. 2013), especially when the
Stelis spathuliformis (Luer & R.Vásquez) Karremans, found clades have been thoroughly characterized
comb. nov. morphologically (Luer 2002; Karremans 2010).
Bas. Pleurothallis spathuliformis Luer & Lankesteriana (Fig. 5) is a well supported and defined
R.Vásquez, Revista Soc. Boliv. Bot. 2: 137. 1999. genus of some 19 species. They are widely distributed
in the Neotropics with the noteworthy exception of the
Stelis unduavica (Luer & R.Vásquez) Karremans,
Antilles. The genus is phylogenetically closely related to
comb. nov.
some species of Trichosalpinx and Zootrophion, however,
Bas. Pleurothallis unduavica Luer & R.Vásquez,
the tiny habit with an extremely reduced ramicaul with
Phytologia 46: 372. 1980.
adpressed inconspicuous bracts, and the relatively long
Stelis vasquezii (Luer) Karremans, comb. nov. successively single flowered inflorescences resemble
Bas. Pleurothallis vasquezii Luer, Phytologia 49: species of Anathallis and Specklinia much more closely.
220. 1981. On the other hand, the frequently purplish flowers with
usually fused lateral sepals and an extremely sensitive
Conclusions. High species diversity and the many cases lip are once again reminiscent of some species of
of convergence and parallelism make the systematics of Trichosalpinx subgen. Trichosalpinx.
the Pleurothallidinae quite hazardous. Morphological
features are often congruent with phylogenetic
hypotheses based on DNA data, but homoplasy can Acknowledgments. I am thankful to the Costa Rican Ministry
occur in morphological traits; similar morphological of Environment and Energy (MINAE) and its National System
features may not always reflect a similar evolutionary of Conservation Areas (SINAC) for issuing the Scientific
Passports under which wild species treated in this study
history. Molecular data provide an independent data set
were collected. My colleagues Franco, Diego and Melania at
that can be used to evaluate morphological homoplasy. Lankester Botanical Garden have been most insightful, and
Several modifications to the genera Anathallis, have helped with the collecting and documenting the studied
Specklinia and Stelis have been proposed here in an effort material. Some of data was produced as part of the research
to circumscribe genera that are both monophyletic and projects under supervision of Barbara Gravendeel in diverse
Right, figure 5. Representative species of genus Lankesteriana. A — Lankesteriana barbulata (Karremans 5187; JBL-
spirit). B — Lankesteriana barbulata (Karremans 5447; JBL-spirit) C — Lankesteriana cuspidata (Bogarín 9619;
JBL-spirit). D — Lankesteriana duplooyi (Karremans 4888; JBL-spirit). E — Lankesteriana fractiflexa (Bogarín 8988;
JBL-spirit). F — Lankesteriana sp.nov. (Karremans 4900; JBL-spirit). Photographs by A.P. Karremans.

332 LANKESTERIANA
labs at Leiden University and the Naturalis Biodiversity Luer, C.A. 1999. lcones Pleurothallidinarum XVIII.
Center. In general I wish to thank all the staff of JBL and L Systematics of Pleurothallis Subgen. Pleurothallis
for the unrestricted access and help. I am most thankful to Lio Sect. Pleurothallis Subsect. Antenniferae, Subsect.
and Ibra for the delight they have been during this period. Lisa Longiracemosae, Subsect. Macrophyllae-Racemosae,
Thoerle and two other anonymous reviewers made a series Subsect. Perplexae, Subgen. Pseudostelis, Subgen.
of improvements to the manuscript, and I am very thankful Acuminatia. Mongr. Syst. Bot. Missouri Bot. Gard. 76.
to them. I am also in debt to the Vice-Presidency of Research Luer, C.A. 2002. A systematic method of classification of the
of the University of Costa Rica for providing support through Pleurothallidinae versus a strictly phylogenetic method.
the projects “Inventario y taxonomía de la flora epífita de la Selbyana 23(1): 57-110.
región Mesoamericana” (814-A7-015), “Flora Costaricensis: Luer, C.A. 2006. Icones Pleurothallidinarum XXVIII.
Taxonomía y Filogenia de la subtribu Pleurothallidinae Reconsideration of Masdevallia, and the Systematics of
(Orchidaceae) en Costa Rica” (814-BO-052), “Filogenia Specklinia and vegetatively similar genera (Orchidaceae).
molecular de las especies de Orchidaceae endémicas de Costa Mongr. Syst. Bot. Missouri Bot. Gard. 105.
Rica” (814-B1-239) and “Taxonomía, filogenia molecular, Luer, C.A. 2009. Icones Pleurothallidinarum XXX. Lepanthes
aislamiento reproductivo y diferenciación de nichos de of Jamaica and Systematics of Stelis, Stelis of Ecuador,
Specklinia endotrachys” (814-B3-075). part four and addenda: systematic of Masdevallia, new
species of Lepanthes from Ecuador, and miscellaneous
new combinations. Mongr. Syst. Bot. Missouri Bot. Gard.
Literature cited 115.
Bogarín, D., A.P. Karremans, R. Rincón & B. Gravendeel. Maddison, W.P. & D.R. Maddison. 2007. Mesquite: a
2013. A new Specklinia (Orchidaceae: Pleurothallidinae) modular system for evolutionary analysis. Mesquite v.
from Costa Rica and Panama. Phytotaxa 115(2): 31-41. 2.72. Available at http://mesquiteproject.org
Chiron, G.R., J. Guiard & C. van den Berg. 2012. Pridgeon, A.M. & M.W. Chase. 2001. A phylogenetic
Phylogenetic relationships in Brazilian Pleurothallis reclassification of Pleurothallidinae (Orchidaceae).
sensu lato (Pleurothallidinae, Orchidaceae): evidence Lindleyana 16(4): 235-271.
from nuclear ITS rDNA sequences. Phytotaxa 46: 34–58. Pridgeon, A.M., R. Solano, M.W. Chase. 2001. Phylogenetic
Drummond, A.J. & A. Rambaut. 2007. BEAST: Bayesian relationships in Pleurothallidinae (Orchidaceae):
evolutionary analysis by sampling trees. BMC Evol. Biol. combined evidence from nuclear and plastid DNA
7: 214. sequences. Am. J. Bot. 88(12): 2286-2308.
Heneghan C, M. Thompson, M. Billingsley & D. Cohen. Pridgeon, A.M. 2005. Subtribe Pleurothallidinae. In: A.M.
2011. Data from: Medical-device recalls in the UK and Prigeon, P.J. Cribb, M.W. Chase & F.N. Rasmussen
the device-regulation process: retrospective review of (Eds.), Genera Orchidacearum. Volume 4 Epidendroideae
safety notices and alerts. Dryad Digital Repository. http:// (Part One). Pp. 319-422.
dx.doi.org/10.5061/dryad.585t4. Pupulin, F., A.P. Karremans & B. Gravendeel. A
Karremans, A.P. 2010. Phylogenetics of Stelis (Orchidaceae: reconsideration of the empusellous species of Specklinia
Pleurothallidinae) and closely related genera, based (Orchidaceae: Pleurothallidinae) in Costa Rica. Phytotaxa
on molecular data, morphological characteristics and 63: 1-20.
geographical distribution in the Central American and Rambaut, A. 2009. FigTree v1.3.1. Available at http://tree.
Andean Cordilleras. MSc Thesis, Plant Sciences Group bio.ed.ac.uk/software/
and Biosystematics Group, Wageningen University. Staden, R., D.P. Judge & J.K. Bonfield. 2003. Analysing
Karremans, A.P., F.T. Bakker, F. Pupulin, R. Solano-Gomez Sequences Using the Staden Package and EMBOSS. In:
& M.J.M. Smulders. 2013a. Phylogenetics of Stelis and S. A. Krawetz and D. D. Womble (Eds.), Introduction to
closely related genera (Orchidaceae: Pleurothallidinae). Bioinformatics. A Theoretical and Practical Approach.
Plant Syst. Evol. 29(1): 69-86. Human Press Inc., Totawa, NJ 07512.
Karremans, A.P., F. Pupulin & B. Gravendeel. 2013b. Stenzel, H. 2004. Systematics and evolution of the
Taxonomy, molecular phylogenetics, reproductive genus Pleurothallis R. Br. (Orchidaceae) in the
isolation, and niche differentiation of the Specklinia Greater Antilles. Dissertation Thesis. Mathematisch-
endotrachys species complex (Orchidaceae: Naturwissenschaftlichen Fakultät I der Humboldt-
Pleurothallidinae). Lankesteriana 13(1-2): 132-133. Universität zu Berlin.
Luer, C.A. 1986. Systematics of the genus Pleurothallis Sun, Y., D.Z. Skinner, G.H. Liang & H. Hulbert. 1994.
(Orchidaceae). Mongr. Syst. Bot. Missouri Bot. Gard. 20. Phylogenetic analysis of Sorghum and related taxa using
Luer, C.A. 1997. Systematics of Trichosalpinx. Monogr. Syst. internal transcribed spacers of nuclear ribosomal DNA.
Bot. Missouri Bot. Gard. 64. Theor. Appl. Genet. 89: 26-32.
LANKESTERIANA 13(3): 333—335. 2014.
THE FIRST TEN YEARS OF SELBY GARDENS
Carlyle A. Luer
3222 Old Oak Drive, Sarasota, FL, 34239-5019, U.S.A.

cluer@juno.com
Abstract. In her will, Marie Selby left her home and grounds to be used as a “botanical garden” at the discretion
of the directors of Palmer Bank. The property was zoned for high-rises, but opposition to a botanical garden was
overcome. Cal Dodson, Professor of Botany at the University of Miami, was a chosen as a director. The Gardens
soon acquired more grounds and staff. A volunteer program was begun, and volunteers contributed vastly to
our rapid growth. Our many accomplishments include the quarterly Bulletin, first appearing in spring 1974, and
the scientific journal, Selbyana, first published in January 1975. The growth of the Gardens would inevitably
accelerate with the great infrastructure put in place during our first ten years.
Key words: William Selby, Marie Selby, Sarasota, botanical garden, Calaway H. Dodson
Bill and Marie Selby built their retirement home in property would also revert to the Foundation, at the
Sarasota on the bay front in the early 1920s. Bill had discretion of Palmer Bank.
amassed a fortune with Texaco Oil Company. Without Bill Coleman, the chairman of the board of Palmer
heirs, they created the charitable William G. and Marie Bank, was a friend of ours. We shared an interest in
Selby Foundation with Palmer Bank as trustee. I knew nature, and had made field trips into the Fakahatchee
Mr. Selby, only in consultation in his terminal illness Swamp. I explained to the board the possibility of
in 1956. I cared for Mrs. Selby’s surgical problems, creating a true botanical garden, but there was no
but I knew nothing about her intention of leaving her enthusiasm. Zoned for high-rises, her seven-acre
home for a “botanical garden.” Only in June 1972, property must have been worth a fortune. Privately,
one year after her death, were conditions of her will I described the potentialities to Coleman, and he was
announced at a meeting of the board of Palmer Bank. receptive. He was a forceful chairman, so during the
By coincidence, I was in attendance. I had been a summer of 1972, it was decided that there would
director for six or seven years, not because I knew indeed be a Marie Selby Botanical Gardens.
anything about banking, but because of my surgical Consultants from the New York Botanical Garden
practice. and the University of Florida agreed that specializing
In her will, Mrs. Selby left her home and grounds in one small group of plants such as orchids would
with the adjacent vacant lot to the north, to be used be feasible. Several alternative, larger sites east and
as a “botanical garden” at the discretion of the south of Sarasota were investigated, but her home
directors of Palmer Bank. She had purchased the with seven acres of land near downtown Sarasota was
lot to the north, also on the bay, where the home of finally decided upon, but not without considerable
Russian Prince Michael Cantacuzene once stood, to reservations. The property was zoned for high-rises, not
prevent the construction of a high-rise. Her idea of a a botanical garden. There was considerable opposition
botanical garden had been a pretty garden where she to a botanical garden from more than one source. All
could hold garden club meetings and social events. For kinds of questions were raised by the city commission,
maintenance, she designated a small endowment, all and the city building, planning, and zoning boards. It
the rest of her estate reverting to the Selby Foundation. seemed like one roadblock after another was being
The endowment with the proceeds from the sale of her thrown in our path. Were we to become an amusement
334 LANKESTERIANA
park? Where would cars park? How about traffic? How Williams’ The Orchid Album, a complete run of Curtis’
about your neighbors? How about pollution? Would Botanical Magazine, and Woolward’s Monograph of
anything be sold? Could we be taxed? By the end of Masdevallia.
1972, a special exemption for a botanical garden was An attractive, substantial “gate house,” with a front
granted reluctantly by the city. We applied for and reception desk, restrooms, and plant shop, was built
received tax-exempt status from the IRS to become a in 1973 and opened to the public with a dedication
charitable institution. ceremony in January 1974. The property across the
Next, a director had to be found. Cal Dodson, street from the gate house, and the adjacent lot and
Professor of Botany at the University of Miami, at that house to the north, were acquired for parking, and
time on a year sabbatical in Ecuador, was a candidate. the corner house by highway 41 was acquired for
In January 1973, Bill Coleman, his wife and their “administration,” all with grants from The Selby
daughter, and Jane and I flew down to Ecuador to Foundation in 1973. Across the street from the newly
discuss the situation with him. Dodson thought that acquired administration building was the Payne
the proposition seemed too good to be true, that new mansion (also on the bay and zoned for a high rise) that
botanical gardens were not being made any more. He belonged to Dr. Paulk, an orthodontist and friend of
was not aware of the impending Lankester Garden. He ours. After negotiations, the price agreed upon for the
reasoned that if the scope of the garden were restricted Payne house was paid by the Selby Foundation and a
to one small group of plants, such as epiphytes, it might donor, so by the summer of 1973 we had considerably
fit on the small piece of land allotted. He accepted the expanded the physical scope of the Gardens.
offer. Abandoning his tenure with the University of During the summer of 1973, the Gardens hosted
Miami and his sabbatical, he and his family arrived in its first visiting botanical scientist, Dr. Richard Keating
Sarasota the following month. of Southern Illinois University. He and his family
In February 1973, the Dodson family moved into lived on the grounds. Also that summer, the Gardens’
the moldy Selby house that had been closed for over official seal with four epiphytic species (an orchid, a
18 months with a leaking roof before they found a bromeliad, a gesneriad, and a Peperomia) and the date
place to live. Mrs. Selby’s yard had become a massive 1973 was designed on our kitchen table.
jungle of weeds and Brazilian pepper trees during the Greenhouses were completed in the summer of
last 20 years of her life. Months were spent clearing 1974. In the largest one close to the gate house, we
the invasive plants. Where to place what kinds of built a meandering trellis-covered walkway beside a
greenhouses and where to place the walkways had to massive, rugged, cliff-like wall of “lava rock” boulders,
be decided. dripping wet and festooned with lush vegetation. It
Among the first employees were two gardeners became the display house. Workers, volunteers, and
who had worked for Mrs. Selby. In April 1973, many visitors came and went.
Dodson hired Ruby Hollis, who became a masterful Paid memberships in the Gardens were begun. A
secretary and backbone of administrative duties for the volunteer program was started without which we could
next generation. Hans Wiehler and Kiat Tan, doctoral not have existed. Volunteers contributed vastly to our
candidates in botany from the University of Miami, rapid growth. One of their many accomplishments was
were brought to the Gardens as staff members. the quarterly Bulletin, the first number appearing in
Soon after our beginning in 1973, one of our most spring 1974. The first issue of Selbyana, the scientific
important acquisitions with Selby Foundation funds journal, was published in January 1975.
was the botanical library of William Cole of Winter Our small endowment was dwindling. Our new
Park. From him and Weldon and Wesley, rare book Selby Gardens Board of Directors of only five members
dealers in England, we obtained famed treasures such eliminated the expensive services of an outside
as Bateman’s Orchidaceae of Mexico and Guatemala accounting firm, and gained complete independence
as well as his Monograph of Odontoglossum, from Palmer Bank, under which we had been a
Lindley’s Sertum Orchidaceum, Linden’s Pescatoria, dependent and charged a fee. Even after elimination
Warner’s Select Orchidaceous Plants, Warner and of the above losses of revenue, our income from the
Luer- The firts ten years of Selby Gardens 335
endowment was so meager, we could scarcely survive. The corner building, previously a dental office, then
On at least one occasion, a donor made the payroll. insurance office, but now the library, was acquired next
In July 1975, we decided that we would start with funds from the Selby Foundation, Eric Young, an
charging visitors a fee of one dollar. Already open English philanthropist, and donors. It became known
a year and a half, none of us thought that this date as the EYMC, the Eric Young Micropropagation
would be cited incorrectly, some 30 years later, as the Centre, which eventually failed and was abandoned.
“beginning” of Selby Gardens. Volunteers worked tirelessly on exhibits, luaus,
Meanwhile, Dodson initiated a student internship plant sales, auctions, and all kinds of social events
program, and an orchid identification service. Harry to raise money. Money was always a problem. We
Luther in bromeliads, John Atwood in orchids, and spent money we did not have, but we had tremendous
Mike Madison in aeroids joined us. Dr. Raven, assets, so there was never a possibility of our facing
director of the Missouri Botanical Garden, came bankruptcy. Had we always waited until we could
down for the formal dedication of the Gardens, a gala afford something, we would have been still sitting in
reception held 3 April 1976. The Selby Foundation Mrs. Selby’s house. We were in debt, but by the end
promised a certain amount of financial aid for each of of eight years, our financial picture was looking better.
our first five years to help with capital improvements, Income from sales, special events, and donations was
but that ceased after four. increasing, and the debt was decreasing.
The next acquisition of land, purchased by a donor, The board had been expanded to include bankers
was the frame house on Orange Avenue with an existing who thought a new director was necessary. A retired
driveway, next door to the building that presently Air Force General was hired to replace Dodson who
houses the library. This would give us a second access was made Director of Research. Camaraderie and
to the Gardens, but the city said ‘no,’ because it would enthusiasm vanished. Volunteers were alienated. A
be ‘too dangerous’ near the busy intersection of 41 and promised research building with endowment from
Orange. After arguing our case before a hostile city Jesse Cox failed to materialize. With fancy charts,
commission, Ken Thompson, the city manager, said, the new director general “proved” how much the
‘let them try it.’ Begrudgingly, Ken’s suggestion was greenhouses with extensive collections, such as aeroids
allowed. Of course, it worked, but we agreed that the and gesneriads, were wasting money. He decided to
exit would be limited by a ‘no left turn.’ Nothing more convert a large, valuable greenhouse into a room for
was ever heard. meetings and social events. After the slow years that
The next acquisition was the two-story, frame followed, the growth of the Gardens would inevitably
house east of the administration building, purchased accelerate with the great infrastructure already in place.
mostly from donated funds. It was used as student It could not fail, and it did not fail. The momentum
quarters until it was demolished for more parking. regained in the last 30 years has been phenomenal.

LANKESTERIANA
LANKESTERIANA 13(3): 337—351. 2014.
a r t í c u l o i n v i t a d o*
CONSIDERACIONES SOBRE LA HISTORIA DE LA PRIORIDAD

TAXONÓMICA DE ONCIDIUM ORNITHORHYNCHUM
Laura C. Mazo1, Alberto Gómez-Gutiérrez1,2,5, Sonia R. Quintanilla1, 2,

Jaime E. Bernal1, 2 & Pedro Ortiz-Valdivieso, S.J.†2,3
1
Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana,
Cra 7 # 40-62, edificio 32, Bogotá D.C., 110231, Colombia
2
Iniciativa Genómica Javeriana, Pontificia Universidad Javeriana, Cra 7 # 40-62, edificio 32,
Bogotá D. C., 110231, Colombia
3
Asociación Bogotana de Orquideología, Avenida calle 63 # 68G-14, Bogotá D. C., Colombia
5
Autor para correspondencia: agomez@javeriana.edu.co
† Pedro Ortiz-Valdivieso, S.J. (1926-2012)
Resumen: La historia de la prioridad taxonómica de la orquídea Oncidium ornithorhynchum está aún por aclarar
si se consideran las diferentes descripciones y publicaciones de esta especie propuestas en los siglos XVIII y
XIX por botánicos como José Celestino Mutis, John Lindley, Alexander von Humboldt, Aimé Bonpland y Carl
S. Kunth, entre otros. Con el fin de resolver las inconsistencias en los reportes taxonómicos de esta especie en
el transcurso del tiempo, y teniendo como base la reciente aclaración realizada por Jiménez y Hágsater sobre la
identidad del ejemplar tipo conservado en París, hemos procedido a ordenar las fuentes primarias asociadas con
su descripción y nomenclatura botánica.
Abstract. The history of the nomenclatural taxonomic priority of the orchid Oncidium ornithorhynchum is yet
to be clarified, as successive descriptions and publications of this species were proposed in the eighteenth and
nineteenth centuries by botanists such as José Celestino Mutis, John Lindley, Alexander von Humboldt, Aimé
Bonpland and Carl S. Kunth, among others. In order to resolve the inconsistencies in taxonomic reports of this
species in the course of time, and based on the recent clarification by Jiménez and Hágsater on the type specimen
conserved in Paris, we proceeded to review the primary sources associated with its description and botanical
nomenclature.
Palabras claves: Orquídeas, Oncidium ornithorhynchum, O. pyramidale, exsicados, herbario
Introducción. La familia de las orquídeas cuenta (subtribu Oncidiinae) cuyo nombre deriva de la raíz
con el mayor número de especies de todo el reino griega onkos, tumor, refiriéndose al callo tuberculado
vegetal aproximadamente 30000 (Montes y Eguiluz del labelo. El nombre específico ornithorhynchum
1996). Ellas se encuentran en todos los continentes procede de las palabras griegas ornitho, relativo a las
y en todos los climas, con excepción de las zonas aves, y rhynchos que significa pico. Son plantas epífitas
polares. Colombia puede considerarse como una de los páramos, ubicadas entre 2850 y 3340 metros
zona privilegiada para las orquídeas por la variedad sobre el nivel del mar (msnm) y se reconocen por la
de climas y zonas ecológicas de su territorio. Se han inflorescencia erecta, en forma “piramidal” (Jiménez
registrado hasta hoy más de 3000 especies de orquídeas & Hágsater 2010, Pridgeon et al. 2009).
en el territorio colombiano (Asociación Bogotana de La descripción taxonómica de Oncidium ornitho-
Orquideología 2013). rhynchum ha variado con el tiempo y los círculos
Oncidium ornithorhynchum Kunth es una especie de investigadores involucrados, hasta presentarse
de orquídea perteneciente al género Oncidium Swartz confusiones fenotípicas y biogeográficas como la
* Este artículo fue preparado en el marco de la celebración del 40 aniversario del Jardín Botánico Lankester.
338 LANKESTERIANA
que reportaron recientemente Jiménez y Hágsater epistolar del sabio naturalista Don José Celestino Mutis
(2010). Este no es un caso único en el trabajo 1968, pp. 277-292). Humboldt y Bonpland encontraron
combinado del trío científico conformado por la misma planta, probablemente en los alrededores
Humboldt, Bonpland y Kunth (H.B.K.), pues se de Bogotá (donde todavía es frecuente), y no, como
conocen al menos 2 ejemplos más de inconsistencias se afirma en Nova genera, donde se anota que crece
biogeográficas en las colecciones H.B.K. La “sobre los árboles en la regiones templadas del Reino
primera, en la que la localidad de la colección “Santa neogranadino, junto a Santa Ana y Mariquita, alt. 400
Fe” fue interpretada como “Santa Fe, México” (hoy toesas” (lámina LXXV del Nova genera et species
en día parte del estado de Nuevo México, USA), plantarum). Esta especie nunca ha sido encontrada de
lo cual no sólo le sucedió a Kunth, sino también a nuevo en esa región y a alturas tan bajas (600 m sobre
Linneo (Oscar Vargas, com. pers. 2012), como fue el nivel del mar), y de ordinario se ha encontrado entre
publicado respectivamente para dos especies de los matorrales en el suelo. Probablemente hubo alguna
la familia Asteraceae, Diplostephium phylicoides confusión en las fichas. Pero lo que sí estuvo correcto
(Kunth) Wedd. (Vargas 2011) y Lycoseris mexicana fue el publicarla como un nuevo género Telipogon
(L.) Cass (Díaz-Piedrahita et al. 1997) angustifolius Kunth solo que, como ya había sido
La primera de estas inconsistencias en la colección publicada por Linneo con un epíteto específico propio,
H.B.K., fue reportada por Vargas (2011) en los era necesario conservarlo, y así, en 1917, el botánico
siguientes términos: británico George Claridge Druce (1850-1932) hizo la
nueva combinación a Telipogon nervosus, nombre que
“Diplostephium phylicoides (Kunth) Wedd., Chlor.
es actualmente aceptado”. (Ortiz-Valdivieso & Gómez,
And. 1: 205. 1856. Distribution: col. series:
en imprenta).
Phylicoidea. Aster phylicoides Kunth, Nov. Gen. Sp.
Pl. 4:93. 1820. TYPE: COLOMBIA [erroneously cited Con base en estos antecedentes, y en las
as Mexico], [without date], Humboldt & Bonpland s.n. consideraciones particulares expuestas en lo que
(P ‘‘Herb. Bonpland’’, holotype; P ‘‘Herb. Bonpland’’, concierne a la orquídea Oncidium ornithorhynchum,
isotype; F, fragment). The type specimen was supposed es conveniente ordenar la cronología de las diferentes
to be collected in Mexico, it is known that some of descripciones taxonómicas de esta especie para
the Humboldt & Bonpland collections were wrongly resolver adecuadamente su identidad.
labeled as collected in Santa Fe, Mexico (now USA),
while they [were collected near] Bogotá (before: Santa Cronología de la descripción de Oncidium orni-
Fe de Bogotá), Colombia”. thorhynchum. Esta especie fue colectada y registrada
por primera vez por José Celestino Mutis (1732-1808)
La segunda inconsistencia biogeográfica en la
en la Real Expedición Botánica del Nuevo Reino de
colección H.B.K., correspondiente a la orquídea
Granada que funcionó formalmente entre los años 1783
Telipogon nervosus Druce, fue reportada por el padre
y 1816. En su descripción, Mutis no registró su nombre
Pedro Ortiz-Valdivieso, en los siguientes términos:
taxonómico en la lámina correspondiente, y ésta sería
“Una de las primeras plantas que envió Mutis a denominada posteriormente por los estudiosos del
Linneo fue recolectada en las minas de oro de Real Jardín Botánico de Madrid, como Oncidium
Suratá (Santander) que Linneo interpretó de manera pyramidale Lindl refiriendo que el epíteto específico
equivocada y publicó como Tradescantia nervosa proviene del término latino pyramis, -idis = pirámide,
Linn. en 1771. Mutis, en cambio, sí se dio cuenta en clara alusión a la forma de la inflorescencia de esta
de que se trataba de lo que Linneo llamaba una especie (Traducido del latín por Pedro Ortiz Valdivieso,
ginandra (hoy orquídea) y pensó en darle el nombre S.J., 2000, p. 51).
de Mormolycanthus tradescantioides pero nunca la En medio de los reportes botánicos de la Real
publicó el gaditano y esto lo conocemos solo por una Expedición Botánica del Nuevo Reino de Granada,
carta de Mutis al botánico sueco Peter Jonas Bergius y considerando que José Celestino Mutis llegó a este
(1730-1790) con fecha de enero de 1786 (Archivo virreinato español en 1760, se puede considerar que

Mazo et al. – Historia taxonómica de Oncidium ornithorhynchum 339
Figura 1. A — Lámina original a color de la orquídea Oncidium pyramidale en la colección de la Flora de la Real Expedición
Botánica del Nuevo Reino de Granada. Esta aparece sin descriptor taxonómico. B — En el verso de la lámina original
aparece efectivamente la inscripción “Oncidium pyramidale Lindl.” manuscrita a lápiz en la parte inferior izquierda,
y esta descripción fue atribuida a Charles Schweinfurth (1890-1970). Otras inscripciones reportadas sobre esta lámina
original son: “537” [tachado]. Inscripción manuscrita a lápiz [s. XX], en la parte inferior derecha y “8.200” en el verso,
inscripción manuscrita a lápiz, en la parte superior derecha. DIV. III A-486, en el Real Jardín Botánico de Madrid
(http://www.rjb.csic.es/icones/mutis/paginas/laminadibujo.php?lamina=837).
el reporte no fechado de esta orquídea habría tenido con manchas pardas, fragantes, con segmentos
lugar entre 1760 y 1808, año de su fallecimiento. extendidos; sépalo dorsal oblongo-lanceolado, ca.
Esta especie, dibujada por uno de los pintores de la 7.5 mm de ancho, laterales libres, linear-lanceolados,
Expedición Botánica en aquella época (Fig.1), fue oblicuos ligeramente más largos que el dorsal,
descrita en el siglo XX por el Padre Pedro Ortiz pétalos aovado-oblongos, abruptamente agudos,
Valdivieso, S.J. (1926-2012) como: apiculados, de igual longitud sépalo dorsal pero
“Planta epifita de tamaño mediano, con pseudobulbos el doble de ancho; labelo más largo que los otros
agregados ovoides, 2.5-7 cm de alto, cubiertos en segmentos, pandurado-trilobado, sésil, con base
la base por 2 o 3 pares de vainas conduplicadas, abrupto-auriculada, bilobado en el ápice, 10-12 mm
escamosas, con ápice agudo, bi-trifoliadas; tiene de largo y 9.8–11.3 mm de ancho a través de los
hojas elíptica-oblongas hasta oblanceoladas, agudas lóbulos laterales; los lóbulos laterales suborbiculares,
o corto-acuminadas, de 14-20 cm de largo y 3,38 lóbulo medio oborado, emarginado o bilobado; disco
cm de ancho. Se caracteriza por presentar una en la base, con un callo plurituberculado, blanco,
inflorescencia que nace de la axila de una vaina columna pequeña, fuertemente signoidea en vista
basal y es paniculada, multiflora, suberecta, de forma lateral ca. 3 mm de alto, con un par de aletas erectas
generalmente piramidal, de hasta 70 cm de largo, en la pared apical, profundamente bilobuladas, tabla
incluyendo el escapo, flores pequeñas, amarillas infra estigmática prominente; róstelo linear, antera
340 LANKESTERIANA
Figura 2. Lámina 39 que acompaña la publicación impresa de la orquídea Oncidium pyramidale en la obra Flora de la Real
Expedición Botánica del Nuevo Reino de Granada. Vol. XI, Orchideaceae, Vol XI. Tomo 5.

Figura 3. Lámina no. 486a que acompaña la publicación original de Oncidium pyramidale en la obra Flora de la Real
Expedición Botánica del Nuevo Reino de Granada. Vol. XI, Orchideaceae, Vol XI. Tomo 5.
alargada, polinios en número de 2 con estípite largo y Luego, en 1840, John Lindley (1799-1865) publica
viscidio pequeño (Figs. 2–3). Su hábitat y distribución incorrectamente a esta misma especie como Oncidium
es en diversas zonas montañosas de Colombia, en ornithorhynchum (Fig. 9) en el Botanical Register (Fig.
clima frio; aunque también ha sido herborizada en 10) y la describe, haciendo en primer lugar referencia a
Ecuador y Perú” (Traducido del latín por Pedro Ortiz la descripción previa de Humboldt, Bonpland y Kunth
Valdivieso, S.J. 2000) y, en segundo lugar, a la descripción de Bateman.
En el año 1845, Sir William Jardine (1800-1874)
Por otro lado, a comienzos del siglo XIX, Alexander
y colaboradores describen esta orquídea por primera
von Humboldt (1769-1859) y Aimé Bonpland (1773-
vez con el nombre de Oncidium pyramidale en The
1858) viajaron a América y colectaron varias especies
Annals and Magazine of Natural History (Fig. 11).
de orquídeas, que fueron enviadas al herbario del
Este nuevo nombre, cuya prioridad se atribuye a
Museo Nacional de Historia Natural de París (Fig.
Lindley, obedece a que sería una especie intermedia
4). Posteriormente, en el año 1815, basándose en el
ejemplar tipo colectado por Humboldt y Bonpland, entre Oncidium excavatum Lindl y Oncidium
Carl Sigismund Kunth (1788-1855) publica la ornithorhynchum, y hace referencia a una colecta
descripción de Oncidium ornithorhynchum (Fig. 5) en de Theodor Hartweg en la región de Pasto, en el sur
el tomo I de la obra Nova Genera et Species Plantarum de Colombia, sin especificar su color ni publicar la
(Fig. 6), sin referirse al color de la especie colectada. lámina correspondiente.
Esta especie habría sido publicada coloreada en A mediados del siglo XIX y a comienzos del siglo
amarillo sin autorización de los colectores en una XX, se propondrían como sinónimos de esta especie
de las ediciones de lujo del Nova Genera et Species a Oncidium chrysopyramis Rchb.f. & Warsz (Fig.
Plantarum. En efecto, Jiménez y Hágsater (2010) 12), publicada en el año 1854 por Berthold Seemann
refieren que más adelante, en el curso del siglo XIX, (1825-1871) y Wilhelm Seemann (c1820-1868) en
George Ure Skinner (1804-1867) habría enviado a Bonplandia, y a Oncidium maderoi Schltr (Fig. 13),
James Bateman (1811-1897) una orquídea colectada publicada en el año 1920 por Friedrich Fedde (1873-
en Guatemala, quien la publicó erróneamente en 1837 1942) en Repertorium Specierum Novarum Regni
como Oncidium ornithorhynchum (Fig. 7) en su obra Vegetabilis.
The Orchidaceae of México and Guatemala (Jiménez En el año 1922 Fritz Krænzlin (1847-1934) ilustró
& Hágsater 2010) (Fig. 8). En esta publicación esta especie con el nombre Oncidium pyramidale
centroamericana solo se hace referencia a Humboldt Lindl. en su obra Orchidaceae-Monandrae, Tribus
y Kunth (sic), excluyendo al botánico Aimé Bonpland, Oncidiinae-Odontoglosseae pars II (Fig. 14),
colector y coautor del Nova Genera et Species especificando que se distribuye en Colombia y
Plantarum. También mencionan Jiménez y Hágsater Ecuador, sin ninguna referencia a Centroamérica, ni a
(2010) que hay copias coloreadas a mano donde Oncidium ornithorhynchum.
las flores de esta especie se representaban de color Recientemente, en 1996, María Dolores Montes
amarillo; afirmando que seguramente se debía a que y Pedro Eguiluz, en su publicación El cerro, frontera
el dibujo se hizo a partir de un espécimen seco, dando abierta recorrido ecológico por el cerro de Usaquén
prioridad a la referencia sobre el lugar en donde habría reportan – con el nombre que les fue indicado por
sido colectada la planta. Pedro Ortiz Valdivieso – la presencia de Oncidium
342 LANKESTERIANA
Figura 4. Foto del ejemplar tipo de Oncidium ornithorhynchum en el herbario de París. Tomada por Alberto Gómez
Gutiérrez.

Figura 5. Lámina no. 80 que acompaña la publicación Figura 7. Lámina que acompaña la publicación original de
original de Oncidium ornithorhynchum en la obra Nova Oncidium ornithorhynchum en la obra Orchidaceae of
Genera et Species Plantarum, basada en el ejemplar Mexico and Guatemala.
colectado por Humboldt y Bonpland en América y
conservado en el herbario de París.
de pocas hasta muchas flores y variados tamaños,
muchas veces vistosas. Se encuentra desde México
hasta Chile, en todos los climas”. Estos autores dan
una distribución claramente equivocada, siguiendo lo
reportado por Kunth en cuanto a la localidad del tipo
de O. ornithorhynchum como: “El Puerto Andaracuas,
entre Guanajuato y Valladolid, Michoacán” (Jiménez
& Hágsater 2010). Esa localidad corresponde a la
provincia fisiográfica conocida como la Altiplanicie
mexicana meridional y El Bajío, una zona muy seca,
donde abundan los encinares secos, muy pobres en
orquídeas epífitas, siendo la más frecuente Laelia
speciosa Kunth (Hágsater et al. 2005).
Figura 6. Descripción taxonómica original de Humboldt,
De acuerdo con el reporte del GBIF (Global
Bonpland & Kunth, 1815, pp. 345-346.
Biodiversity Information Facility) habría 131
ornithorhynchum en el norte de Bogotá y la describen ocurrencias de Oncidium ornithorhynchum en
como un género con flores (18 × 12 mm) y hojas América incluyendo, de norte a sur, los siguientes
(30 × 5 cm), “plantas medianas o pequeñas con o países: Estados Unidos (1), México (88), Guatemala
sin seudobulbos. Inflorescencia basal en racimo (6), Nicaragua (2), El Salvador (3), Panamá (1),
344 LANKESTERIANA
Figura 9. Lámina que acompaña la publicación original

realizada por John Lindley en Edwards’s Botanical
Register.
Figura 8. Descripción taxonómica original de James
Bateman, 1837, pp. 34-35. se encuentran “Comparative histology of floral
elaiophores in the orchids Rudolfiella picta (Schltr.)
Colombia (27) y Ecuador (3) (GBIF, consultado en Hoehne (Maxillariinae sensu lato) and Oncidium
noviembre 6 de 2013), sin reportarse hasta la fecha en ornithorhynchum H.B.K (Oncidiinae sensu lato)”
esta base de datos ocurrencias de esta especie en otros realizada por Kevin L. Davies y Malgorzata
países (Ortiz-Valdivieso S.J 2000). Sin embargo, al Stpiczynska en el año 2009. También, el artículo de
revisar el detalle de las plantas centroamericanas Rolando Jiménez Machorro y Eric Hágsater del año
incluidas en este reporte, la imagen asociada es una 2010 que hemos venido citando, titulado “Oncidium
orquídea violeta que, de acuerdo con el reporte de ornithorhynchum, una especie mal interpretada y un
Jiménez y Hágsater (2010), correspondería mejor a nombre para una vieja especie: Oncidium sotoanum
Oncidium sotoanum. (Orchidacee)”, en el que corrigen definitivamente
Las últimas descripciones científicas de esta el nombre de esta planta mexicana. Por otra parte,
orquídea al iniciarse el siglo XXI incluyen las nuestro grupo publicó en 2012 el artículo “Extraction
publicaciones enfocadas a la vez al ámbito botánico and amplification of DNA from orchid exsiccates
como al ámbito filogenético. Dentro de estas conserved for more than half a century in a herbarium
Figura 11. Descripción taxonómica original de William

Jardine et al. 1845, p. 384.
Figura 10. Descripción taxonómica original de John

Lindley, 1840, pp. 30-31.
in Bogotá, Colombia”, reportando la presencia de

Oncidium ornithorhynchum en Duitama (Boyacá)
a 2870 metros de altura y también en Santandercito
(Cundinamarca) a 2000 metros de altura, de acuerdo
con los registros del herbario “Lorenzo Uribe Uribe S.
J.” de la Pontificia Universidad Javeriana (Mazo et al. Figura 12. Descripción taxonómica original de Berthold
2012). Seemann y Wilhelm Seemann. 1854, p. 108

346 LANKESTERIANA
Figura 14. Descripción taxonómica original de Fritz

Krænzlin, 1922, pp. 195-196.
Figura 13. Descripción taxonómica original de Friedrich

Fedde, 1920, p. 191.
Discusión. Al comparar cada una de estas publicaciones

se observan varias inconsistencias en el epíteto
específico, en el color de la flor y en el hábitat de la
orquídea Oncidium ornithorhynchum (Tabla 1). En
cuanto al color de la flor, tanto Lindley como Bateman
hacen referencia en sus publicaciones a la obra de
Humboldt (Nova Genera et Species Plantarum), el
primero citando como colaboradores a Bonpland y
a Kunth, como debe ser, y el segundo solamente a
Kunth, excluyendo inexplicablemente a Bonpland.
Mencionan que hay dos copias de esta obra coloreadas
a mano donde las flores de esta especie se representan
de color amarillo, afirmando que seguramente se debía Figura 15. Foto de Oncidium ornithorhynchum. Tomada por
Pedro Ortiz-Valdivieso, S.J.† Colombia.
a que el dibujo se hizo a partir de un espécimen seco
(Jiménez & Hágsater 2010), sin considerar que el de O. ornithorhynchum (Jiménez & Hágsater 2010).
error podría corresponder, alternativamente, a un error Con la ayuda de esta imagen, al examinar y comparar
de transcripción del lugar de colección de la planta los ejemplares tipo de Oncidium, Rolando Jiménez
llevada a Europa por Humboldt y Bonpland. confirmó en el año 2008 que la especie encontrada en
En 1990, Miguel Ángel Soto tuvo la oportunidad el herbario de París, no concordaba con la especie que
de ver en el herbario de París el ejemplar tipo de se distribuye en México y Centroamérica, en razón a
Oncidium ornithorhynchum (Fig. 4), y allí constató las marcadas diferencias físicas que hay entre los dos
que la especie que se encontraba distribuida en México ejemplares (Jiménez & Hágsater 2010). La especie
no correspondía con dicho ejemplar. Posteriormente, que se encuentra en el herbario de París, presenta
en 1997, Adolfo Espejo viajó al herbario de París y un margen membranoso en las vainas foliosas de la
tuvo la posibilidad de tomarle una foto al ejemplar tipo base del pseudobulbo; hay una sola inflorescencia
Figura 16. Oncidium sotoanum R. Jiménez & Hágsater. Figura 17. Foto de Oncidium sotoanum R. Jiménez &
Basado en R. Jiménez 626, Orizaba Veracruz, Mexico, Hágsater; M. A. Soto 4900, Chiapas. Tomada por de R.
AMO [ilustración tomada de Icon. Orchid. (Mexico)1: Jiménez M.
pl.77].
por pseudobulbo, erecta, con las ramas de la base artículo de 2010, postularon que debe haber un
alargadas, acortándose gradualmente hacia el ápice error en la indicación de la localidad del Oncidium
(inflorescencia piramidal), el pedúnculo y raquis son ornithorhynchum, colectada por Humboldt y Bonpland,
casi erectos, ligeramente sinuosos, el callo del labelo como si fuera de México. El ejemplar tipo, que se
se compone de dos quillas cortas hacia los lados conserva en París, tanto como el dibujo correspondiente,
y otras tres hacia el ápice, las alas de la columna muestran que este espécimen no es lo que a partir
son erectas y cuneadas. En contraste, la especie de Lindley se ha considerado como “Oncidium
mexicana tiene flores violetas con callo amarillo, ornithorhynchum de México y Centroamérica” (y
el margen de las vainas foliosas es membranáceo no de Suramérica), sino que corresponde a lo que
pero este es inconspicuo, midiendo 1 mm de ancho; se ha llamado Oncidium pyramidale de Colombia,
cada pseudobulbo produce simultáneamente 2-4 Ecuador y Perú, siendo este O. pyramidale sinónimo
inflorescencias arqueadocolgantes, con las ramas de la de O. ornithorhynchum (Fig. 15). Por otra parte, la
base del raquis cortas, las de la mitad largas y las del especie mexicana con flores violetas, se conoce ahora,
ápice cortas; el raquis es en zigzag, el callo es distinto con razones bien fundamentadas, como Oncidium
y las alas son oblicuamente dolabriformes y paralelas sotoanum (Fig. 16-17). A pesar que se ha propuesto
al cuerpo de la columna (Jiménez & Hágsater 2010). a Oncidium chrysopyramis Rchb.f. como sinónimo
Debido a la confusión en la descripción de esta de O. ornothorhynchum, Rolando Jiménez y Eric
especie, Rolando Jiménez y Eric Hágsater, en su Hágsater establecen que al presentar esta especie una
Tabla 1. Datos importantes de cada una de las publicaciones realizadas por 7 botánicos.
348
Titulo publicación Autor Año Epíteto específico Nombre correcto Color de la flor Hábitat
Real Expedición Botánica del Nuevo José Celestino Mutis 1760- 1808 Colombia, [Ecuador y
[Onc. pyramidale] Onc. ornithorhynchum Amarilla
Reino de Granada [Pedro Ortiz Valdivieso] [2000] Perú]
México-Puerto de
Alexander von Humboldt,
Andaracuas, entre
Nova Genera et Species Plantarum Aimé Bonpland y Carl S. 1815 Onc. ornithorhynchum Onc. sotoanum Amarilla
Guanaxuato y Valladolid
Kunth
de Michoacán
Orchidaceae of Mexico and Michoacán, Oaxaca y

James Bateman 1837 Onc. ornithorhynchum Onc. sotoanum Violeta
Guatemala Guatemala

LANKESTERIANA
Edwards´s Botanical Register John Lindley 1840 Onc. ornithorhynchum Onc. sotoanum Violeta México y Guatemala
The Annals and Magazine of Natural

William Jardine et al 1845 Onc. pyramidale Onc. ornithorhynchum - Pasto
History
Orchidaceae-Monandrae, Tribus
Fritz Kranzlin 1922 Onc. pyramidale Onc. ornithorhynchum - Colombia y Ecuador
Oncidiinae-Odontoglosseae, pars II
El cerro, frontera abierta recorrido María Dolores Montes y

1996 Onc. ornithorhynchum Onc. ornithorhynchum - Desde México hasta Chile
ecológico por el cerro de Usaquén Pedro Eguiluz
Tabla 2. Resumen de las publicaciones mencionadas a lo largo del escrito.
Año Autor
1760-1808 José Celestino Mutis, quien colecta en el Nuevo Reino de Granada a partir de 1760 y fallece en 1808, dirige
la Real Expedición Botánica del Nuevo Reino de Granada y describe Oncidium ornithorhynchum denominada
posteriormente como Oncidium pyramidale en la Flora de la Real Expedición Botánica del Nuevo Reino de
Granada (Real Expedición Botánica del Nuevo Reino de Granada, 1783-1816).
1801 Alexander von Humboldt y Aimé Bonpland viajan a Sudamérica y colectan la orquídea que bautizan Oncidium
ornithorhynchum. La depositan en el herbario de París. (Jiménez & Hágsater 2010).
1815 Carl S. Kunth, con base en el tipo colectado por Humboldt y Bonpland, publica la especie Oncidium
ornithorhynchum en su obra Nova Genera et Species Plantarum (Humboldt, Bonpland & Kunth 1815).
1836 Theodor Hartweg le envía a Loddiges una orquídea con el nombre Oncidium ornithorhynchum colectada en
Oaxaca, México, de tal forma que la introdujo al cultivo en Europa; también este año George Skinner le envía una
James Bateman. Flores violetas. (Jiménez & Hágsater 2010).
1837 James Bateman publica una orquídea con el nombre Oncidium ornithorhynchum en su obra Orchidaceae of
México and Guatemala. Flores violetas (Bateman 1837).
1840 John Lindley publica esta orquídea en Edwards’s Botanical Register con el nombre de Oncidium
ornithorhynchum (Lindley 1840).
1845 William Jardine et al. la publican como Oncidium pyramidale en The Annals and Magazine of Natural
History (Jardine et al. 1845).
1854 Berthold Seemann y Wilhelm Seemann reportan Oncidium chrysopyramis Rchb. f & Warsz como sinónimo
de Oncidium pyramidale en Bonplandia 2: 108 (Seemann & Seemann 1854).
1920 Fedde publica Oncidium maderoi como sinónimo de Oncidium pyramidale en Repertorium Specierum
Novarum Regni Vegetabilis (Fedde 1920).
1922 Fritz Kranzlin publica esta especie como Oncidium pyramidale en la obra Orchidaceae-Monandrae, Tribus
Oncidiinae-Odontoglosseae pars II (Kranzlin 1922).
1968 Pedro Ortiz Valdivieso, S.J., reporta Oncidium ornithorhynchum en Colombia, y en el año 1975 la deposita
en el herbario de la Pontificia Universidad Javeriana. Esta concuerda con la planta denominada Oncidium
pyramidale de la Real Expedición Botánica y con la planta denominada Oncidium ornithorhynchum de la
colección de Humboldt y Bonpland depositada en el Herbario de París
1990 Miguel Ángel Soto viaja a París y ve que la Oncidium ornithorhynchum que está en el herbario no
concuerda con orquídeas mexicanas de la misma región (Jiménez & Hágsater 2010).
1996 María Dolores Montes y Pedro Eguiluz publican una Oncidium ornithorhynchum en su libro El cerro,
frontera abierta recorrido ecológico por el cerro de Usaquén especificando que esta especie de encuentra
desde México hasta Chile (Montes & Eguiluz 1996).
1997 Adolfo Espejo viaja al herbario de París y le toma una foto al tipo de Oncidium ornithorhynchum (Jiménez
& Hágsater 2010).
2008 Rolando Jiménez, con base en la foto tomada por Adolfo Espejo, compara O. ornithorhynchum de París
con la especie de México (Jiménez & Hágsater 2010).
2010 Rolando Jiménez y Eric Hágsater, publican que el tipo de Oncidium ornithorhynchum conservado en París
coincide con la Oncidium pyramidale que se distribuye en Colombia, Ecuador y Perú de tal forma que el
nombre Oncidium pyramidale queda como sinónimo del primero. En cuanto a la Oncidium ornithorhynchum
que se distribuye en México, fue renombrada con el nombre de Oncidium sotoanum (Jiménez & Hágsater
2010).
2011 Laura Mazo et al. establecen la secuencia de los genes matK de tres (3) especímenes de Oncidium
ornithorhynchum colectados en Colombia (Madrid-Cundinamarca y Duitama-Boyacá) de los cuales el
primero correspondía a una planta fresca y los dos restantes se encontraron conservados en el “Herbario
Julián Uribe Uribe S. J.” de la Pontificia Universidad Javeriana, con 36 y 43 años de antigüedad,
respectivamente (Mazo et al. 2012).

350 LANKESTERIANA
inflorescencia más laxa, no en forma “piramidal”, Musée National d´Histoire Naturelle de Paris, y
flores de menor tamaño y alas más angostas, es que tuvimos la ocasión de volver a examinar en
definitivamente diferente a la morfología de Oncidium el mes de marzo del presente año, correspondería
pyramidale (Jiménez & Hágsater 2010). mejor a una orquídea colectada en el territorio
En conclusión, tanto John Lindley como James que se llamaba en aquella época “Virreinato de la
Bateman, ilustraron una especie con flores rosadas o Nueva Granada”, y que comprende hoy territorios
violetas, hábitat en México y con el nombre erróneo de de Colombia y Ecuador.
Oncidium ornithorhynchum, diferenciándose un poco 3. El registro manuscrito de esta orquídea en el Diario
de Kunth quien la publicó con este mismo nombre botánico o “Journal botanique” de Aimé Bonpland,
y hábitat, aunque, a diferencia de los dos botánicos podrá aclarar el origen biogeográfico del ejemplar
anteriores, la describió de manera explícita como una tipo conservado en París, puesto que en general cada
orquídea con flores amarillas. En contraste, tanto José uno de los registros de este libro de campo fueron
Celestino Mutis, como Fritz Kranzlin y William Jardine inscritos en orden consecutivo y cronológico, y
la clasificaron con el nombre de Oncidium pyramidale, podemos deducir, con base en las consideraciones
flores amarillas (únicamente en la descripción de del presente artículo, que el registro de esta especie
Mutis) y como hábitat: Colombia, Perú y Ecuador. se hallará en el tramo correspondiente a la zona
Es importante recalcar que estos últimos 3 botánicos sur de la actual Colombia, o bien a la zona Norte
concuerdan con Kunth en el color amarillo de la flor, del actual Ecuador con fechas entre septiembre de
y se diferencian principalmente en su localización 1801 y mayo de 1802.
biogeográfica. 4. Finalmente, nos proponemos intentar la
Lo anterior se explica gracias a la aclaración comparación molecular del exsicado tipo
realizada por Jiménez y Hágsater, en donde se deduce conservado en París con ADN extraído de
que las descripciones de John Lindley y James Bateman ejemplares de Oncidium ornithorhynchum
corresponden ciertamente con la orquídea presente en colectados en Colombia o Ecuador.
México pero se equivocaron al nombrarla (siguiendo
a Kunth) como Oncidium ornithorhynchum. Jiménez Agradecimientos. Los autores agradecen al personal
y Hágsater aclaran así, finalmente, la identidad de del Herbario “Lorenzo Uribe, S.J.” (Facultad de Ciencias,
Pontificia Universidad Javeriana), a los miembros del
la planta centroamericana, distribuida en el sur de Instituto de Genética Humana (Facultad de Medicina,
México y Centroamérica, como una nueva especie Pontificia Universidad Javeriana), particularmente a los
llamada Oncidium sotoanum y, a su vez, describen colegas del grupo de investigación en ADN antiguo, así
una nueva subespecie O. sotoanum ssp. papalosmum como a las doctoras Marpha Telepova, Cécile Aupic y
Jiménez, conocida únicamente de los estados de Myriam Gaudeul, del Musée National d´Histoire Naturelle
de Paris, y a la museógrafa Claudia Navas-Courbon, en la
Oaxaca y Chiapas, México. misma ciudad. Dedicamos este artículo a la memoria del
En el presente artículo nosotros postulamos que: Padre Pedro Ortiz Valdivieso, S.J. †
1. La orquídea descrita en Bogotá antes de 1808 por

José Celestino Mutis, y luego en el curso del siglo
XIX por Fritz Kranzlin y por William Jardine, con Literatura citada
flores amarillas, distribución en Colombia, Perú, Asociación Bogotana de Orquideología. http://www.
Ecuador, y denominada Oncidium pyramidale, orquideasbogotaabo.com/index.php?option=com_
es la que correspondería al mismo ejemplar content&view=article&id=72&Itemid=30. Consultado:
17-01-2013.
publicado por Kunth con el nombre de Oncidium
Bateman, J. 1837-1843. Oncidium ornithorhynchum. Pp
ornithorhynchum, en consonancia con que el
34-35 in: The Orchidaceae of Mexico and Guatemala.
epíteto especifico Oncidium pyramidale haya London, Ridgway.
pasado a ser sinónimo del primero. Davies, K. L & M. Stpiczynska. 2009. Comparative
2. El ejemplar tipo de Oncidium ornithorhynchum histology of floral elaiophores in the orchids Rudolfiella
que se encuentra hoy en el Herbario Histórico del picta (Schltr.) Hoehne (Maxillariinae sensu lato) and

Oncidium ornithorhynchum H.B.K. (Oncidiinae sensu Lindley, J. 1840. Oncidium ornithorhynchum. Pp. 30-31 in:
lato). Ann. Bot. 104: 221-234. Edward’s Botanical Register, Vol. III. Londres: James
Díaz-Piedrahita, S. & C. Vélez-Nauer. 1997. Revisión de Ridgway and Sonos, Piccadilly.
las tribus Barnadesiae y Mutisieae (Asteraceae) para la Mazo, L., A. Gómez, S. Quintanilla, J. Bernal & P. Ortiz-
Flora de Colombia. In: Monografías del Jardín Botánico Valdivieso S.J. 2012. Extraction and amplification of
José Celestino Mutis, Vol. 1. Bogotá: Jardín Botánico DNA from orchid exsiccates conserved for more than
“José Celestino Mutis”. half a century in a herbarium in Bogotá, Colombia.
Fedde, F. 1920. Oncidium maderoi Schltr. In: Repertorium Lankesteriana 12(2): 121-129.
specierum novarum regni vegetabilis. Dahlem bei Montes, M.D. & P. Eguiluz. 1996. El cerro, frontera abierta.
Berlin: Verlag des repertoriums, Fabeckstr. 191 p. Recorrido ecológico por el cerro de Usaquén. Bogotá:
Global Biodiversity Information Facility (GBIF) http:// Santillana. 110 p.
data.gbif.org/occurrences/searchCountries.htm?c[0]. Ortiz-Valdivieso S.J, P. 2000. Oncidium pyramidale Lindl.
s=20&c[0].p=0&c[0].o=5322086 (consultado en: In: Flora de la Real Expedición Botánica del Nuevo
noviembre 6 de 2013) Reino de Granada (1783 – 1816). Vol. XI, Orchideaceae,
Hágsater, E., M.A. Soto Arenas, G.A. Salazar Chávez, R. Vol XI. Tomo 5. Madrid, España. Ediciones de Cultura
Jiménez Machorro, M.A. López Rosas & R.L. Dressler. Hispánica. 51 p.
2005. Las Orquídeas de México. Instituto Chinoín, Ortiz-Valdivieso, P. & A. Gómez. En imprenta. Las
México, 304 p. orquídeas de Colombia en la obra de Humboldt,
Hernández, G., 1968. Archivo epistolar del sabio naturalista Bonpland y Kunth. In: Los hermanos Alexander
José Celestino Mutis. Instituto Colombiano de Cultura y Wilhelm von Humboldt en Colombia. Huellas
Hispanica. Editorial Kelly. Bogotá, D.C. Vol 3, Tomo 1, históricas de la cooperación científica entre dos
pp. 277-292. continentes.
Humboldt, A., A. Bonpland & C. S. Kunth. 1815. Pridgeon, A. M., P. J. Cribb & M. W. Chase. 2009. Genera
“Oncidium ornithorhynchum”. In: Nova Genera et Orchidacearum, Vol. 5. Oxford University Press, Oxford
Species Plantarum. París: Schoell. 1: 345-346. New York.
Jardine, W., P. J. Selby, G. Johnson, C. Babington, J.H. Proyecto de digitalización de los dibujos de la Real
Balfour & R. Taylor. 1845. Oncidium pyramidale. In: Expedición Botánica del Nuevo Reino de Granada
The Annals and Magazine of Natural History, including (1783-1816), dirigida por José Celestino Mutis: www.
Zoology, Botany and Geology, Londres: R. and J. E. rjb.csic.es/icones/mutis. Real Jardín Botánico-
Taylor. 15: 384. CSIC. Consultado: 14-03-2013
Jiménez, R. & E. Hágsater. 2010. Oncidium Seemann, B. & W. Seemann. 1854. Oncidium
ornithorhynchum, una especie mal interpretada y un chrypsopyramis. In: Bonplandia. Vol II. Londres:
nombre para una vieja especie: Oncidium sotoanum Williams y Norgate. París: Fr. Klincksieck. 158 p.
(Orchidaceae). Lankesteriana 9(3): 411- 422. Vargas, O.M. 2011. A nomenclator of Diplostephium
Kranzlin, F. 1922. Oncidium pyramidale Lindl. Pp. 195- (Asteraceae: Astereae): a list of species with their
196 in: Orchidaceae-Monandrae: Tribus Oncidiinae- synonyms and distributions by country. Lundellia 14:
Odontoglosseae pars II. 32–51.

LANKESTERIANA
LANKESTERIANA 13(3): 353—357. 2014.
VANILLA RIVASII (ORCHIDACEAE), A NEW SPECIES FROM THE

COLOMBIAN PACIFIC REGION
Francisco Molineros-Hurtado1, 2, Robert Tulio González Mina1, 2,

Nicola S. Flanagan1, 3 & J. Tupac Otero1,4,5
1
Grupo de Investigación en Orquídeas, y Ecología y Sistemática Vegetal
2
Programa de Agronomía, Universidad del Pacifico, Avenida Simón Bolívar 54ª-10,
Buenaventura, Colombia
3
Programa de Biología, Pontificia Universidad Javeriana, Cali, Colombia
4
Departamento de Ciencias Biológicas, Universidad Nacional de Colombia,
Sede Palmira, Palmira, Colombia
5
Instituto de Estudios Ambientales IDEA, Palmira. Universidad Nacional de Colombia,
Sede Palmira, Palmira, Colombia
Abstract. We describe a new species of fragrant Vanilla from the Chocó biogeographic region of Western
Colombia, named Vanilla rivasii sp. nov. in honor of the local farmer who drew it to our attention. This
species is related to the Vanilla hostmannii group, also containing V. dressleri, V. ruiziana and V. cribbiana,
with which it shares flower traits such as the showy, yellowish flower with thickened longitudinal venation
in the lip apex. Vanilla rivasii is characterised by possessing: a long racemose inflorescence up to 60 cm
in length, carrying up to 150 yellow flowers, with two to four open simultaneously; a trilobed labellum
with a conspicuously bi-lobulated central lobe; and basally fused lateral sepals. Vanilla rivasii can be
distinguished from the most morphologically-similar species, V. cribbiana and V. hostmannii, by the
number of veins in the cushion-like structure of the lip and the larger size and higher number of flowers
per inflorescence. This discovery highlights northern South America as a centre of diversity for this
economically-important genus, and underlines the need for further botanical exploration in the highly
biodiverse region of the Chocó.
Key words: Orchidaceae, Vanilla, fragrant clade, V. rivasii, Buenaventura, Chocó, Colombia
Vanilla Plumier ex Miller, a pan-tropical genus In a recent generic review, the existence of
within the Orchidaceae, contains over 100 species, undescribed neotropical species became evident
with several species, principally Vanilla planifolia (Soto-Arenas & Dressler 2010), with a new species,
Andr., being of economic importance in the food and Vanilla espondae Soto Arenas, described from the
cosmetics industries. These commercially-valuable Magdalena river valley of Colombia (Soto-Arenas
species form part of the so-called fragrant clade: 2010). Vanilla is a taxonomically-challenging genus,
Vanilla subgenus Xanata Soto Arenas & Cribb, with our understanding of the diversity and biology of
comprising species producing fragrant fruits, and these species hindered by plants being rare and hyper-
which are naturally distributed exclusively within dispersed in their native forest habitat. Furthermore,
the neo-tropics (Soto-Arenas & Cribb 2010). While flowering is infrequent, and a large proportion of
V. planifolia is the predominant commercial species, herbaria material is sterile.
other fragrant Vanilla species are of interest for their In Colombia, 11 Vanilla species have been
potential in vanilla breeding programmes. However, reported to date (Table 1). The genus Vanilla reaches
the diversity and biology of this clade has been poorly its greatest diversity in South America, and, given the
studied. rare distributions of these plants, the inadequate nature
354 LANKESTERIANA
Table 1. List of Vanilla species reported for Colombia (Soto Arenas & Cribb 2010).
Species Reference Year
Vanilla calyculata Schltr Repert. Spec. Nov. Regni Veg. Beih. 7: 42–43 1920
Vanilla columbiana Rolfe J. Linn. Soc., Bot. 32: 468 1896
Vanilla dressleri Soto-Arenas Lankesteriana 9(3): 303–305, f. 5 2010
Vanilla espondae Soto-Arenas Lankesteriana 9(3): 281–284, f. 1–2 2010
Vanilla hostmannii Rolfe J. Linn. Soc., Bot. 32: 462 1896

Vanilla odorata C. Presl Reliq. Haenk. 1(2): 101 1827
Vanilla palmarum (Salzm. ex Lindl.) Lindl. Gen. Sp. Orchid. Pl. 436 1840
Vanilla pompona Schiede Linnaea 4: 573–574 1829
Vanilla ribeiroi Hoehne Comm. Lin. Telegr., Bot. 1: 28 1910
Vanilla sprucei Rolfe J. Linn. Soc., Bot. 32: 461 1896
Vanilla trigonocarpa Hoehne Arq. Bot. Estado São Paulo 1(6): 126–127, t. 139 1944
of most herbarium specimens and the poor botanical green rachis of 12-40 cm in length and 0.7 cm in
records of lowland areas, it is likely more species thickness with white dots in the epidermis, a shortly
will be reported for the country, both described and pedunculate raceme, the rachis congested, with
undescribed. up to 150 flowers, with bracts distant up to 6 mm.
Here we describe a new Vanilla species native to Bracts pale green, basal ones alternate distichal.
the Chocó biogeographic region of the Pacific Coast Distal bracts ovate and concave, 3-4 × 5 mm. Ovary
of Colombia. This region has the highest documented subterete to sub-trigonous, curved, pale green with
plant diversity (Faber-Langendoen & Gentry 1991), white base and white dots in the epidemis, 45-55 mm
and is still relatively under-explored botanically. The length and 4.5 mm in diameter, white in the base and
region retains more than 50% of its original vegetation pale green in the rest. Flowers ephemeral with 2-4
cover, and continued taxonomic description of the open simultaneously, conspicuous with buds pale
diversity of the region is essential in order to establish yellow at base, apex green, 10-12 cm diameter when
conservation priorities. spread out, aroma of rose and clover flowers; sepals
yellowish green outer, whitish yellow inside, basal
Vanilla rivasii Molineros, Rob.González, Flanagan & surface of the lip yellow, mid lobe and throat yellow
J.T.Otero, sp. nov. lined dark yellow-ochre; the segments spreading,
strong rose fragrance. Dorsal sepal yellowish green,
TYPE: Colombia, Valle del Cauca, Buenaventura,
deeply recurved, long-lanceolate, narrow at the base,
Sendero El Paraíso, cultivated by A. Rivas, R. T.
apex sub-acute and sub-calyptrate, with 13 veins,
Gonzalez 1118 (holotype, CUVC). Figures 1–2.
of equal length to lateral sepals, 68 × 8-10 mm.
Hemi-epiphytic herb. Stems dark green, 6.8-8.0 Lateral sepals directed downwards, long-lanceolate,
mm thick, terete, smooth, the internodes 8.0-9.3 cm subacute, base long attenuate, lateral sepals fused in
long. Young aerial roots greenish to greyish, subterete the proximal third of the length; with 13-14 veins,
to flattened, 4.2 mm thick. Leaf shortly petiolate, very smooth, 67 × 8-11 mm. Petals pale yellow
the petiole ca. 10 mm long, blade oblanceolate, to cream, slightly recurved at the apex, narrowly
acuminate, the apex incurved, base subobtuse, the elliptic-oblanceolate, obtuse, concave, narrower
basal margin revolute, subcoriaceous, pale green than the sepals, longitudinally keeled on the abaxial
with a central concavity, 16.5-24.6 × 4.0-5.5 cm. surface, the keel broad and conspicuous, 7-8 veins,
Inflorescence terminal, sometimes lateral with pale 68 × 9 mm. Lip showy, 66 × 35 mm forming a long
Molineros-Hurtado et al. — Vanilla rivasii sp. nov. from Colombia 355
A
E
Figure 1. Vanilla rivasii Molineros-Hurtado, González, Flanagan & Otero. A — Habit. B — Portion of the stem with leaves
and root. C — Inflorescence with flowers and fruits. D — Dissected perianth, with details of the indumenta. E
— Column, ventral view, with detail of the ventarl indumentum. Prepared from the holotype by Robert Tulio Gonzalez.
Drawing by Nhora Helena Ospina Calderón.

356 LANKESTERIANA
naturally in the wild in small isolated populations,

mainly in regenerating secondary growth forest.
Known populations comprise between one and
twelve apparently separate plants. The largest
population of twelve plants occurs over an area of
25 Ha. Localities have been identified up to 300 km
apart. The association with secondary forest may be
a consequence of sampling bias, as most exploration
has been conducted close to populated regions. It is
likely that, with further exploration of the Colombia
Pacific region, particularly away from settlements
along the coast, more populations will be found. The
known localities will not be mentioned explicitly so
Figure 2. Vanilla rivasii, photograph of the flower in situ.
as to protect the small populations of this species
Photo by F. Molineros-Hurtado.
from the threat of collection from the wild.
tube, marginally fused to the column at least 40-42
Phenology: No clear seasonality has been observed.
mm, with 30 veins; when spread out trilobed with
Initiation of flowering has been observed in the month
the midlobe oblong, bilobulated, the lateral lobes
of January, corresponding with a dryer climatic period
well defined with rounded shoulders, overlapping
in the region. However flowering has continued
above the column, oblong-triangular to sub-square,
until April, June, July and September, resulting
tapering at apex, with thickened axial cushion near
in inflorescences of up to 150 flowers. Natural
the lip apex ca. 6 × 23 mm with 7-8 thickened keels
fertilization has been observed of 6-18 % of flowers in
with papilose texture extended to the lateral lobes.
an inflorescence.
The margin of the lip is sub-entire and flabellate;
slightly verrucose at the base with brownish papillae, Eponymy: This species is dedicated to Luis Álvaro
the apex somewhat narrowed and forming a cushion, Rivas, a local farmer committed to sustainable
the penicillate callus 4.5 × 6.0 mm covered by 4 agricultural practices and biodiversity preservation.
yellow showy lacerate structures of scales thickened The type specimen consists of the collection R. T.
in the distal portion, separated 44 mm from the lip Gonzalez 1118 from Buenaventura, and N. H. Ospina
base. Column subterete, elongated 45.0-49.0 × 2.6 466 from Bahia Malaga, with pictures taken by F.
mm, yellow whitish, with brownish tricomes in Molineros-Hurtado.
the distal ventral part; membranous wings 5.3 mm;
bilobed stigma with rectangular emergent lobes, 1.2 Vanilla rivasii Molineros-Hurtado, González,
× 1.1 mm. Anther versatile, ovate, 3 × 2.6 mm. Fruits Flanagan & Otero belongs within Vanilla subgenus
elongated, pale green, subtriangular with white dots Xanata. Vanilla rivasii has affinity to the V. hostmannii
in the epidermis. 130-180 × 11 mm, dehiscent when group, possessing the thickened veins in the lip apex
mature into two valves, with a strong vanilla aroma and the distichous arrangement of the basal bracts of
detectable over more than 200 m. the inflorescence characteristic of this group. Vanilla
rivasii may be distinguished from the other Vanilla
Paratype: Colombia, Valle del Cauca, Buenaventura, species in the group by the frequent terminal position
Bahía Málaga. N. H. Ospina 466 (CUVC). of the inflorescence, although occasionally this can
be lateral. The bracts of the inflorescence are smaller
Other records: Colombia, Buenaventura, F. G.
than those of related species such as V. cribbiana
Lehmann H.K.1185 (K, fruit!).
Soto-Arenas, V. ruiziana Klotzsch, and the sympatric
Distribution: Known only from the Pacific coastal V. dressleri Soto-Arenas. Flowers are larger, with
region in the Valle del Cauca, and Chocó Departments, deeply recurved sepals. The lateral sepals are fused
Colombia. The species has been observed occurring in the basal third. The mid-lobe of the labellum is
Molineros-Hurtado et al. — Vanilla rivasii sp. nov. from Colombia 357
conspicuously bilobulated with a thickened axial Acknowledgments. We thank Nhora Helena Ospina
cushion near the apex bearing 7-8 thickened veins Calderon for the line drawings; Álvaro Rivas for
with papilose texture extending into the lateral lobes. kindly sharing his knowledge and experience regarding
Vanilla rivasii is morphologically most similar to V. vanillas; and the ´Semillero de Investigacion en Recursos
cribbiana but differs from this species in the fused Fitogeneticos´ at the Universidad del Pacifico. Support for
lateral sepals in the basal third, the bi-lobed shape field trips was obtained from the research offices of the
of the central lobe of the labellum and the greater Pontificia Universidad Javeriana, Cali, the Universidad
number of thickened veins. Vanilla rivasii differs Nacional de Colombia, sede Palmira, (DIPAL), and the
from the sympatric species V. dressleri in the tri-lobed Vicerectoría de Investigación of Universidad Nacional de
labellum and non-granulose sepals. Additionally, the Colombia.
living flower of V. rivasii has much less conspicuous
orange longitudinal stripes on the labellum than those Literature cited
of V. dressleri. Vanilla rivasii is more heliophytic Faber-Langendoen, D., & A.H. Gentry. 1991. The structure
than V. dressleri, with subcoriaceous, deep green, and diversity of rain forests at Bajo Calima, Choco
Region, Western Colombia. Biotropica 23(1): 2-11.
smooth leaves. It differs from V. ruiziana from Peru
Soto-Arenas, M.A. & R.L. Dressler. 2010. A revision of
and Bolivia which has an ovate mid lobe of the lip,
the Mexican and Central American species of Vanilla
and 1-3 thickened veins on the lip apex. Vanilla Plumier ex Miller with a characterization of their ITS
rivasii plants have been documented with terminal region of the nuclear ribosomal DNA. Lankesteriana
inflorescences producing up to 150 flowers (less in 9(3): 285-354.
lateral inflorescences), compared with a maximum Soto-Arenas, M.A. 2010. A new species of Vanilla from
recorded for V. hostmannii of 60, and for V. cribbiana, South America. Lankesteriana 9(3): 281-284.
and V. dressleri of ca. 10, and rarely up to 30 flowers. Soto-Arenas, M.A. & P. Cribb. 2010. A new infrageneric
classification and synopsis of the genus Vanilla Plum.
Mature fruits are dehiscent.
ex Mill. (Orchidaceae: Vanillinae). Lankesteriana
9(3):355-398.

LANKESTERIANA
LANKESTERIANA 13(3): 359—374. 2013.
Charles H. Lankester (1879-1969): his life and legacy
Carlos Ossenbach
Orquideario 25 de mayo
Abstract. Charles Herbert Lankester (1879-1969) was without a doubt the most dominant figure of Central
American orchidology during his time. Better known as ‘Don Carlos’, Lankester was born in Southampton,
England, on June 14 1879. It was in London that he read an announcement offering a position to work as an
assistant to the recently founded Sarapiquí Coffee Estates Company in Costa Rica, he applied and was hired.
Surely influenced by his uncle’s zoological background, Lankester was at first interested in birds and butterflies.
However, living in Cachí, at that time one of the regions with the greatest botanical diversity, he must have
fallen under the spell of the plant world as he soon began collecting orchids in the nearby woods. Many of the
plants he collected at this time proved to be new species. With no literature at his hand to determine the plants
he collected, Lankester started corresponding with the assistant director of the Royal Botanic Gardens at Kew,
Arthur Hill in 1910, and somewhat later with Robert Allen Rolfe, Kew’s most eminent authority on orchids.
At the same time, Lankester began his collection of living plants that would become so famous years later. He
returned to England in 1920 to enroll his five children in English schools. Lankester traveled to Africa from
1920 to 1922, hired by the British Government to do research on coffee plantations in Uganda. When returning
to England, he found that Rolfe had died the year before. Many orchids that he had brought to Kew were left
without identification. Lankester was back in Costa Rica in 1922, the year that was a turning point in his career
as an orchidologist: it brought the first correspondence with Oakes Ames. Over the next fifteen years, Ames
would discover more than 100 new species among the specimens he received from Costa Rica. In 1922, Ames
began a series of publications on orchids, which he named Schedulae Orchidianae. In its third fascicle, in
January 1923, Ames started to describe many of the Lankester orchids, which were deposited at Kew and had
been left unidentified. Ames kept asking Lankester to send more and more specimens. After 1930, Lankester
and Ames seem to drift slowly apart. Ames was taken in more by administrative work at Harvard, and Lankester
traveled abroad more frequently. In 1955, after his wife’s death and already 76 years old, Lankester decided
to sell his farm but retained the small part which contained his garden, a piece of land called “El Silvestre”.
Lankester moved to a house he had bought in Moravia, one of the suburbs of the capital, San José. On a section
of this farm called “El Silvestre”, Lankester began his wonderful collections of orchids and plants of other
families, which formed the basis of the Charles H. Lankester Botanical Garden of the University of Costa Rica.
Key words: Charles H. Lankester, Costa Rica, botany, history
“Twenty three years ago today, the good ship ‘Atrato’ Brenes (1870-1948) and Charles Herbert Lankester
(now alas asleep in the depths off the N. Irish coast) (1879-1969). Undoubtedly the most important of
left Southampton with myself on board en route for the three was Auguste R. Endrés, who prepared the
Costa Rica, and here I am still ...” country’s first monographical treatment of a plant
Charles Lankester, letter to Oakes Ames, family. His orchid collections, with over 3,500
December 1923 numbers, form an important part of the Reichenbach
orchid herbarium at the Vienna Natural History
Three famous names form the most illustrious trio Museum. In the first decades of the twentieth century,
of collectors in Costa Rica’s history of orchidology: Alberto Manuel Brenes, born in San Ramón when
Auguste R. Endrés (1838-1874), Alberto Manuel Endrés was living in this small city of the northwestern
360 LANKESTERIANA
Figure 2. Ray Lankester by Leslie Ward, Vanity Fair, 1905.
studio and later went to London, where he specialized

in color photography at the Polytechnic Institute. It
was in London that he read an announcement in the
Daily Telegraph, offering a position in Costa Rica to a
Figure 1. Charles H. Lankester (1879-1969), photographed young Englishman willing to work as an assistant to the
ca. 1925. recently founded Sarapiquí Coffee Estates Company.
Central Valley, did little botanical work but made Lankester applied and was hired, landing a few months
extraordinary collections of orchids in the surrounding later in Puerto Limón, then going on by train to the
mountains. These include dozens of new species, capital of Costa Rica, where he arrived just in time to
described by Rudolf Schlechter in his Additamenta ad take part in the “Ball of the New Century”, given by the
Orchideologiam Costaricensem (1923) in a chapter president of Costa Rica, Rafael Yglesias, in the National
entitled Orchidaceae Brenesianae. Theater, San José.
But it would be Charles Herbert Lankester Sarapiquí, in the Atlantic region, proved too
(1879-1969) (Fig. 1), without doubt the dominant humid for the commercial production of coffee and
figure of Central American orchidology during his the plantations had to be abandoned three years after
time, who should rightly bear the soubriquet of lynx- Don Carlos’ arrival. It was here, surrounded by the
eyed investigator, given by Reichenbach some 50 most exuberant tropical vegetation, that his interests in
years earlier to Auguste R. Endrés. plants, insects and birds began. As Dr. Louis Williams
wrote in his obituary, “Don Carlos Lankester arrived
The early years (1900-1908). Better known as ‘Don at the right place at the right time to join into the active
Carlos’, Lankester was born in Southampton, England, biological exploration of Costa Rica, perhaps the most
on June 14 1879, the son of Charles Lankester and exciting place biologically on our continent.”
Helen West. He lost both parents when only three years Lankester was not the first talented natural historian
old and was raised, together with his sister, by two aunts. in his family; his father’s cousin, Sir Edwin Ray
After finishing school he started work at a photographic Lankester (1847-1929) (Fig. 2), had been the third
Ossenbach — Charles H. Lankester, his life and legacy 361
Director of the Natural History Museum in London.

The arrival of Lankester in Costa Rica marked the
end of a period - the last two decades of the nineteenth
century - which had shown for the first time the
development of a ‘national science’ in Central America.
In Costa Rica, as part of an educational reform aimed
at secularizing public education, the government of
president Bernardo Soto (1885-1889) hired a group of
European academics to staff the two new public high
schools in the capital, San José;The ‘Liceo de Costa
Rica’ for boys and the ‘Colegio Superior de Señoritas’
for girls, both founded under Soto’s administration. The
arrival of these academics marks the beginning of a small
scientific awakening in Costa Rica. Two institutions
symbolize this: the Instituto Físico-Geográfico (IFG)
(=‘Physical-Geographical Institute’) and the National
Museum, founded in 1889 and 1887, respectively.
Among the teachers hired were Pablo Biolley
(1861-1908) and Henri Francois Pittier (1857-1950)
(Fig. 3), who arrived in 1886 and 1887. Pittier lived
in Costa Rica until 1905 and spent some of this time
conducting a systematic exploration of the Costa
Rican flora; a study that had no equal in any country
of tropical America at that time. According to Paul C.
Standley, in his introduction to the Flora of Costa Rica:
“Henri Pittier […] undoubtedly gained a more intimate
Figure 3. Henri Francois Pittier (1857-1950). Portrait by
knowledge of the natural history and especially the
Sava Botzaris (Caracas, 1942).
botany of Central America and northwestern South
America than has ever been possessed by any single summoned by Pittier to take over the experimental
person (Standley, 1937:49).” station, which the United Fruit Company planned to
The combined labors of Pittier and Biolley, and, establish in Zent, near the Caribbean port of Limón.
somewhat later, of Anastasio Alfaro, Adolph Tonduz, This project, however, never came to fruition.
Carl Wercklé, and Brenes as well as the Brade brothers Lankester was thus forced to work with different
(Alfredo and Alexander Curt) resulted in the formation companies until 1908, when he left for England to
of the National Herbarium, which initially comprised marry Dorothea Mary Hawker.
more than 5,000 species. Again citing Standley, in
1903 the National Herbarium “was unequaled below First botanical activities (1910-1922). In 1910, he
the Río Grande del Norte (Standley, 1937:50).” returned to Costa Rica with his wife (Fig. 4), taking
Lankester and Pittier began a lifelong friendship over the administration of a coffee farm in Cachí, on
when the latter visited Sarapiquí. The other players the eastern limits of Costa Rica’s Central Valley, where
in this scientific awakening, Alfaro, Biolley, Tonduz, he lived for the next nine year. As Amelia and Philip
Wercklé, the Brades, and, years later, Otón Jiménez Calvert would write a few years later: “Mr. Lankester’s
would also be important to Lankester, as they often house was beautifully situated half a mile from the
accompanied him on his collecting excursions and Reventazón River and about a hundred and fifty feet
were frequent visitors to his farm in Cartago. above it. It was not a typical Costa Rica residence,
When his contract expired, Lankester went back to for although built of adobe it was two-storied and had
England. He returned to Costa Rica a few months later, no patio. A wide veranda or “corridor” ran across the
362 LANKESTERIANA
Figure 4. Dorothea Mary Hawker, Lankester’s wife.
entire front on the first and second floors, charming

places, for they were set with plants and hung with
baskets of orchids, some of which were in full flower
Figure 5. Orchids in Lankester’s house in Cachí, photo-
when we were there (Calvert & Calvert, 1917: 160)”
graphed by himself.
(Figs. 5–6).
Surely influenced by his uncle’s zoological
background, Lankester was at first interested in birds
and butterflies. However, living in Cachí, at that time
one of the regions with the greatest botanical diversity,
he must have fallen under the spell of the plant world
as he soon began collecting orchids in the nearby
woods. Many of the plants he collected at this time
proved to be new species. With no literature at his
hand to determine the plants he collected, Lankester
started corresponding with the assistant director of the
Royal Botanic Gardens at Kew, Arthur Hill in 1910,
and somewhat later with Robert Allen Rolfe, Kew’s
most eminent authority on orchids. Figure 6. Orchids in Lankester’s house in Cachí, photo-
The first mention of orchids in his correspondence graphed by himself.
is in a letter to Hill of December 1910, where he
wrote: “I have a few orchids chiefly of botanical Pleurothallis dentipetala Rolfe and Pleurothallis
interest, which I will send when it gets warmer on your costaricensis Rolfe.
side”. Stelis barbata Rolfe (Fig. 7), a plant collected At the same time, Lankester began his collection of
near Cachí and sent to Kew, where it flowered in living plants that would become so famous years later.
November 1912 and described by Rolfe in the Bulletin Lankester returned to England in 1920 to enroll his
of Miscellaneous Information of Kew in 1913, was five children (four daughters and one son) in English
the first new orchid discovered by Lankester in Costa schools. Another daughter, his youngest, was born in
Rica. Others would follow: Dichaea ciliolata Rolfe, England that same year. Lankester traveled to Africa
Figure 7. Stelis barbata Rolfe, Lankester’s first collection of a new orchid species. Photograph by R. Parsons.
from 1920 to 1922, hired by the British Government foremost orchidologist, soon challenged and replaced
to do research on coffee plantations in Uganda. When by the German Rudolf Schlechter (1872-1925). It was
Lankester returned to England, he found that Rolfe not until Rolfe’s death in 1921, followed by Schlechter’s
had died the year before, just as he was preparing to in 1925, that the first American expert on orchids would
travel to Costa Rica and Panama on his first field trip arise in the figure of Oakes Ames (1874-1950) (Fig. 8),
to tropical America. Many orchids that Lankester had who took a dominant position in the orchid world that
brought to Kew were left without identification. was never challenged until his death.
After returning from a trip to Europe, Ames wrote
The relation with Oakes Ames. Lankester was back his first letter to Lankester (Sept. 17 1922): “At Kew I
in Costa Rica in 1922, the year that was a turning point saw many specimens collected by you in Costa Rica,
in his career as an orchidologist: it brought the first the greater part unnamed. As it will take some time
correspondence with Oakes Ames (1874-1950) -- the for Kew to recover from the loss of Rolfe and as the
start of a deep and long-lasting friendship. Germans are making great efforts to assemble Costa
To understand what was happening in the world Rican material through Wercklé, Jimenez and Tonduz,
of orchidology, it must be remembered that up to the it seemed to me that you might be willing to co-operate
1920s, the study and knowledge of orchids was strictly with me by stimulating orchidological interest among
an European business. Orchidology in the nineteenth your neighbors.” And continued: “It would surely
century had been dominated by an Englishman, the be worthwhile if you can see your way clear to send
great John Lindley (1790-1865), followed by a German, me herbarium specimens and to send collectors into
Heinrich Reichenbach junior (or filius, as he liked to be the orchid regions of Costa Rica. I have already
called) (1824-1889). After Reichenbach’s death in 1889, identified and described as new, one of your species of
Robert Allen Rolfe (1855-1921) became the world’s Pleurothallis. I refer to P. palliolata (Lankester 192).
364 LANKESTERIANA
some years earlier. In a letter dated September 25

1922, Powell wrote to Ames: “This will introduce to
you (by letter) my good friend Mr. C.H. Lankester, of
“Las Cóncavas”, Cartago, Costa Rica. Mr. Lankester
wishes to take up with you the subject of Costa Rican
Orchids, with which he is well familiar. He has a
number of specimens now at Kew unidentified or
undetermined, which he would like you to have you
procure and determine for him. Also he wishes to
send to you anything new which he may discover for
determination”.
In his answer to the letter from Powell, Ames
showed his delight in learning that he could count on
Lankester’s help: “Now that I know from your letter that
he has contemplated sending his things to me, this day
Figure 8. Oakes Ames (1874-1950), American orchidologist begins with plenty of sunshine even though heavy clouds
and founder of the world’s largest orchid herbarium.
obscure the sky (Letter from Ames to Powell, October 6
1922).” Ames was undoubtedly playing a double game:
while he could not sever his relations with Schlechter
(the German had too much information that Ames
needed desperately), he tried to block Schlechter’s
access to Powell’s and Lankester’s materials.
Lankester answered Ames’ first letter immediately,
and went on to become the expert’s favorite collector.
Over the next fifteen years, Ames would discover
more than 100 new species among the specimens he
received from Costa Rica. In his letter to Ames of
October 11, 1922, Lankester wrote: “I fear stimulation
of orchidological interest is exceedingly improbable or
Figure 9. Pleurothallis palliolata Ames, collected by likely to be successful in Costa Rica…. I think I alone
Lankester near his house in Cachí. Photograph by E.
have the necessary madness.” Orchids had become the
Hunt.
center of Lankester’s world, and would remain so until
The specimen was sent for determination by Hort. his very last day.
Kew” (Fig.9). Ames finished this famous first letter to In 1922, Ames began a series of publications on
Lankester by saying: “We must work fast if we hope to orchids, which he named Schedulae Orchidianae. In its
keep abreast of the Germans. I was surprised to see third fascicle, in January 1923, Ames started to describe
how far reaching their efforts have been to secure a many of the Lankester orchids, which were deposited at
monopoly of tropical American species.” Kew and had been left unidentified because of Rolfe’s
We must keep in mind that, at that time, Rudolf death. Dozens of new species were discovered (see
Schlechter, the famous German orchidologist, was appendix). Ames described more and more new orchids
describing hundreds of new Central American orchid from Costa Rica and kept asking Lankester to send more
species, based on the collections by Powell in Panama and more specimens. “Your specimens have arrived...
and by Wercklé, Brenes, Tonduz and Jiménez in Costa They made my day cheerful to the end. I wished they
Rica. were more. But if you had sent ten times as many, I
Ames’ letter to Lankester was followed by one would still say that (August, 1923).”
from Charles W. Powell, who had been collecting One of the specimens that Lankester sent to Ames
for years in Panama and who had met Don Carlos was the reason for a famous anecdote: “Your number
Figure 10. Lankesterella costaricensis Ames, the type species of the genus that Ames dedicated to his favorite collector.
Photograph by F. Pupulin.
387 is not an orchid, it is a Bromeliad” wrote Ames this means among other things the translation of
in 1923. Lankester replied: “Look again”. An unusual about 1,800 orchids over unimaginable roads.” It is
new orchid genus had been discovered. Ames admitted therefore easy to understand why Lankester’s farm
his error and a week later wrote to Lankester: “There would become, over the years, a Mecca for botanists
seems to be a new genus among your specimens, and orchidologists from all over the world. With
Lankesterella would be a good name” (Fig. 10). its beautiful collections of plants, “Las Cóncavas”
After World War I, prices for tropical commodities could not go unnoticed by the world’s naturalists. The
such as coffee and bananas rose quickly. The restrictions gardens had important collections of cacti, palms and
imposed on the import of such goods into Europe bromeliads although orchids were always Lankester’s
and the United States by four years of naval warfare favorites. Among the visitors to “Las Cóncavas “ were
were now replaced by an increasing demand. Owners famous names such as Arthur Hill, director of Kew
of coffee plantations in Costa Rica had one of their Gardens, Thomas Barbour of Harvard, Harvey Stork,
most prosperous periods during the 1920s, and coffee William Maxon, Wilson Popenoe, Philip Calvert,
production and exports increased constantly. Lankester James Rehn and Louis Otho Williams.
was not the only one to take advantage of the situation. By December 1924, after only two years of
In 1924, he moved to “Las Cóncavas”, a coffee farm corresponding with Lankester, Ames had already
that he had acquired in the vicinity of Cartago. Coffee described 66 new species among his collections. A
had been the reason for his initial emigration from self-made man with no formal botanical training,
England to Costa Rica, and his livelihood would depend Lankester had developed a sharp eye for novelties.
on coffee for the rest of his life. The year of 1925 shows us Charles Lankester, who
His orchid collection was already enormous. In had just reached the age of 45, at what appears to
August 1924, he wrote to Ames: “…we hope to move be the peak of his success as a planter and as an
over to the ‘finca’ about the middle of November, orchidologist. He saw his children again during a
366 LANKESTERIANA
Figure 11. Lankester, wife and daughter, 1925. Figure 12. Lankester named honorary member of the
American Orchid Society.
short trip to England (Fig. 11), his new coffee farm Rica: “It is just possible I may complete sale of this
was in full production, and in July of that year he was place during the coming week, if so Costa Rica will
elected an honorary member of the American Orchid soon see me no more.” We will probably never know
Society (Fig. 12). what really happened, but luckily Lankester did not
What was, however, the real condition of sell and did not leave although it seems that he was
Lankester’s business? There seem to have been never without financial problems until the end of his
problems which went largely untold. By 1924, he life. He continued collecting orchids to send to Ames,
had already tried to convince Ames to invest in his now often attaching to his herbarium specimens crude
coffee farm -- a proposal that Ames had politely sketches or black and white photographs, all preserved
declined. Then, in November 1925, he seemed to today in Ames´ documents at the Oakes Ames Orchid
have decided to sell everything and to leave Costa Herbarium (Fig. 13).
Figure 13. Letter from Lankester to Ames, with a sketch of a species of Oncidium.

the creation of many new ones. “... Standley hoped

that every Central American country would have a
botanical library adequate for the study of its flora,
and a comprehensive herbarium, formed by local
collectors” (McCook, 1999: 119).
Standley arrived in Panama in November 1923.
Over the following five months, he collected 7,500
plant specimens in the Canal Zone. In December 1923,
January 1924 and during a week in November 1925
(during his second stay in Panama), he collected 800
additional plants on the island of Barro Colorado,
recently established as a protected area. As a result
of these visits, he wrote his Flora of Barro Colorado
Island and the Flora of the Panama Canal Zone,
published in 1927 and 1928 respectively, by the
Smithsonian Institution.
The two visits by Standley to Panama were followed
by extensive collecting trips to Costa Rica, a country
that Standley visited during the first months of 1924 and
then again between December 1925 and March 1926.
Standley collected an enormous amount of material in
Costa Rica -- over 15,000 plant specimens, of which no
Figure 14. Paul Carpenter Standley (1884-1963). Courtesy less than 30 orchid species were new to science. “Standley
of Jorge Gómez Laurito. is in New York to-day. When he arrives in Costa Rica,
shower orchids on him. Make it a rule that no orchid
Paul Standley in Central America (1921-1925). goes unpressed” (Ames to Lankester, November 13,
A very special visitor came to Costa Rica in January 1923). “At this stage of the undertaking, quantity rather
1924 and again in December 1925: Paul Carpenter than quality is important” (id., December 3, 1923).
Standley (1884-1963) (Fig. 14). Three years earlier, on While Standley was working in Honduras, Lankester
December 19, 1921, Standley, a botanist with the U. visited him, and the two became intimately acquainted;
S. National Museum, had arrived at the port city of La they continued to have frequent contact until their later
Libertad, El Salvador , the first visit to Central America years. Standley always remembered the gesture of the
of the man who was probably the most important figure Lankesters in December 1925, while he was collecting
in the history of botanical exploration of the region in the region of Santa María de Dota: “The writer has
during the first half of the 20th century. not forgotten that they sent a special messenger upon a
In a conversation with Otón Jiménez, Pittier said: two days’ journey to bring a greeting at Christmas time
“Much can be expected from such a young and capable (Standley, 1937: 59).”
element” (Jiménez, 1963: 2). For over 40 years,
Standley collected intensively in all of the countries of Years of indecision: between England and Costa
Central America and published a series of fundamental Rica (1925-1939). Lankester was still far from
works about their floras. He acquired an intimate finishing with his orchid collections. Ames continued
knowledge of the region, not only about its botanical the publication of his Schedulae Orchidianae, now
aspects, but also its culture and traditions. He was a with Charles C. Schweinfurth as co-author. With the
friend to all the Central American scientists of his time publication of fascicle 9 in July 1925, the number of
and contributed like no other to furthering the study new species collected by Lankester and described by
and research of the local naturalists and collectors, as Ames reached 99. In 1927, Lankester visited Charles
well as to the development of existing herbaria and W. Powell, Panama’s famous orchid collector, and
368 LANKESTERIANA
wrote to Ames in one of his most famous passages: “I orange beaked-toucanet (Pteroglossus frantzii).
have just spent a fortnight with my fellow sufferer from At the end of a decade marked by enormous
Orchiditis, CWP, and it was a very delightful time of indecision about his future, torn between his love for
talk and talk and then talk. I wish we could have had his adopted country – despite difficulties - and missing
you there as High Priest of our cult. Possibly a few both his homeland and his children, Lankester went to
tangles might have been unraveled.” England again before the outbreak of World War II. He
After 1930, Lankester and Ames seem to drift returned to Costa Rica with his wife at the end of 1939,
slowly apart. Ames was taken in more and more by very narrowly missing being torpedoed in the convoy
administrative work at Harvard, and Lankester traveled in which they crossed the Atlantic; a small ship to the
abroad more frequently. In a letter of April 1932, Ames side of them was the unfortunate victim. Lankester’s last
complained about the separation. “I have missed you. package of plants was sent to Ames, according to our
Those little crumbs from your orchidologist feasts records, in March 1942 although their correspondence
always made me feel that you were near at hand. continued until Ames passed away in 1950.
Since your return to England I have felt that you had
departed almost to another planet!” The final years (1949-1969). In the early 1940’s,
Later in 1932, and back in Costa Rica, Lankester Lankester began what he meant to be his final tribute to
was named by the president of Costa Rica as a member the orchids of his adopted country: a book that would be
of the board of the National Museum; a great honor entitled Costa Rican Orchids. News of this work soon
that he shared with two other famous figures in the spread, and the orchid world wanted to see it. Paul H.
history of the orchids of Costa Rica: Anastasio Alfaro Allen, the foremost expert on the orchids of Panama,
and the grande dame of Costa Rican orchid history, wrote to Lankester in 1946: “Through the grapevine, I
Amparo Zeledón. Abroad again, Lankester visited have heard that you have done a manual on the Orchids
the Canary Islands in 1934, exploring Tenerife with of Costa Rica. It is most fortunate in my opinion that
Professor Balinaga, director of the Botanical Gardens you have done so, since you have probably seen more
there. The following year he went to Brazil and, after species in the field than any living collector.”
traversing the Continent, left through Bolivia. Lankester did not only want to write a book, he
In 1934, already 55 years old, Lankester was back also wanted to raise funds for the conservation of his
in Costa Rica, where he collected the last three orchids farm as a paradise of Costa Rican orchids. He wrote
that Ames described based on Lankester’s collections. to Rodney Wilcox Jones, president of the American
These were published between 1934 and 1935 in the Orchids Society from 1942 to 1948, who gave a
Harvard University Botanical Museum leaflets. The polite but clearly negative response: “… I would
orchids were three different species of Stelis: Stelis be inclined to believe there is not much that can be
crystallina, S. latipetala and S. transversalis (Fig. 15). done… Of course, now with your book coming along,
The American naturalist Alexander F. Skutch I can see where it could be a basis to start an interest
(1904-2004), who lived in Costa Rica from 1935 until in conserving your place as an orchid haven…”. The
his death, soon became one of the country’s most years went by, and the manuscript was never published,
respected leaders in the study of natural sciences – although Lankester’s dream of preserving his garden
especially ornithology-- and in the development of was fulfilled a few years after his death.
an original philosophical paradigm for understanding More and more, Lankester dedicated himself to
the relationship between mankind and its natural building up his orchid and plant collections. In 1949,
environment. Skutch collected orchids in Guatemala he sold his house in London, deciding to stay in Costa
in 1933 and 1934, before moving to Costa Rica, so Rica although three of his daughters were married and
that it should come as no surprise that he soon met living in England. As he wrote to Gordon Dillon in
Lankester. In 1950, Skutch married Lankester’s 1960: “No idea of returning to live in England, I sold
daughter Pamela; they spent the rest of their lives on my house in London in 1949, but retain the link of 3
a small farm on the River Peñas Blancas that Skutch married daughters there, a summer like last years’ is
named “Los Cusingos”, after the local name for the certainly inviting, but the winters …” (Fig. 16).
Figure 15. Lankester in his garden at “Las Cóncavas”, 1936.
In 1955, after his wife’s death and already 76 years Lankester a few months before his death, and in one of
old, Lankester decided to sell his farm but retained the his letters called him plantsman extraordinaire.
small part which contained his garden, a piece of land Charles Herbert Lankester passed away in 1969,
called “El Silvestre”. Lankester moved to a house he alone but for the company of his daughter Dorothy,
had bought in Moravia, one of the suburbs of the capital, and having had financial problems during his last
San José. A few years later, on June 10, 1961, in a years. Shortly before his death, Lankester confessed
ceremony at the British Embassy in San José, Lankester to Dorothy: “I am only sorry that, with all the
was named an Officer of the Order of the British Empire opportunities I had, I never made enough money.” As
by order of Queen Elizabeth II, an honor of which one of his friends wrote in his guest book: “Time is
Lankester would be proud to the end of his days (Fig. unfair to this place and these people” (Fig. 18).
17). Gordon Dillon had especially gentle words about Louis Williams described Lankester in his obituary
370 LANKESTERIANA
Figure 16. Lankester with wife Dorothy in 1952. Figure 17. Lankester receiving the Order of the British
Empire from the British Embassador, San José, 1961.
with these words: “Generous to a fault, hospitable The Lankester Botanical Garden. “Cóncavas”(=
to all, he was counselor to all scientists who came to concavities) is the local Spanish name for circular, clay-
Costa Rica. His interests were catholic - butterflies, filled depressions, several hundred feet in diameter
birds, but most especially epiphytic plants, orchids, and three to four feet-deep. They are frequently
bromeliads and aroids.” And Paul Standley wrote: “A found to the east of the Costa Rican city of Cartago.
naturalist in the best and widest sense of that word.” These depressions often fill with water and form large
lagoons, a paradise for the migratory birds, which fly
to Costa Rica during the last months of the year to
escape the harshness of the North American winter.
A coffee farm with the name of “Las Cóncavas”
featured one of these beautiful lagoons. Established in
the second half of the 19th century by Francisco Quesada,
it was bought in 1924 – as we have seen- by Charles H.
Lankester (Fig. 19). On a section of this farm called “El
Silvestre”, Lankester began his wonderful collections of
orchids and plants of other families, which formed the
basis of the Charles H. Lankester Botanical Garden of
the University of Costa Rica.
“El Silvestre”, which Lankester kept when he sold
the rest of his farm in 1955, was inherited by his daughter
Figure 18 . Charles H. Lankester shortly before his death, in Dorothy (Fig. 20), but difficult financial circumstances
his house in Moravia, 1968. made it seem impossible to fulfill Lankester’s dream of
Figure 19. A “concava” at Lankester’s farm in Cartago. Figure 20 . Dorothy Lankester.

Photographed by C. Lankester.
conserving the place as an “orchid heaven”. Dorothy Rica was of great value. Their decision was positive,
was forced to put the garden up for sale. However, and the funds were deposited. The University of Costa
through the efforts of the Costa Rican Orchid Society Rica purchased the property and began to operate it
and Costa Rican biologist Rafael Lucas Rodríguez, a as a botanical garden. And so, on March 2 1973, the
group of members of the American Orchid Society (led Charles H. Lankester Botanical Garden was formally
by Rebecca T. Northen), raised half of the purchase inaugurated (Fig. 21).
price: $25,000. The other half was donated by the The first years were difficult. Without a proper
Stanley Smith Horticultural Trust of Great Britain. budget, the garden could not be kept open to the public
An evaluation committee was formed, and the garden and could only be visited by special appointment with
was inspected by Thomas A. Bartenfeld, president of Rafael Lucas Rodríguez. It was not until 1979 that the
the Conservation Committee of the AOS, Eric Young, University named Dora Emilia Mora de Retana (Fig. 22)
president of the Orchid Society of Great Britain and as the first director of the Garden. Under her direction,
Dr. Calaway H. Dodson, whose expertise on Costa the garden was slowly transformed from a small farm of
10,7 hectares (aprox. 25 acres) into a world-renowned
botanical garden. In a very similar way to Charles
Lankester, Dora Emilia turned the Garden into a meeting
place for the world’s most prestigious orchidologists.
Calaway H. Dodson, Norris H. Williams, Robert L.
Dressler, John T. Atwood, Carlyle A. Luer, Rudolf Jenny,
Eric Hágsater, Henry Oakeley, Günter Gerlach, Klaus C.
Horich and many others were frequent guests at Charles
Lankester’s old farm at “Las Cóncavas”. Her interaction
with other botanists resulted in 300 Costa Rican
orchids being illustrated in the series Icones Plantarum
Tropicarum, mostly based on the living collections kept
at the gardens. As Atwood remembers, Dora Emilia’s
Figure 21. Rafael Lucas Rodríguez during the opening
did not see Lankester Gardens as just a tourist garden
address at the inauguration of the Lankester Botanical
Garden. Next to him Gordon Dillon, Secretary of the for generating income, but as a garden dedicated to
American Orchid Society and to the right Rebecca Costa Rican orchid research. In 1984, she organized
Northen, who led the fundraising efforts in the United the first formal course in orchidology in collaboration
States to buy the gardens. with Robert L. Dressler, who at the time was a visiting
372 LANKESTERIANA
Figure 22. Dora Emilia Mora (right) with Pamela Lankester Figure 23. Joaquín Bernardo García Castro (1944-2001).
(left), wife of Alexander Skutch. Photograph by Eduardo Bitter.
professor at the University of Costa Rica. Her main A doctor of medicine and a university professor,
scientific legacy to the knowledge of Costa Rican orchid Joaquín García was, for many years, the mentor
taxonomy was the treatment of the subtribes Maxillarinae of numerous Costa Rican orchid lovers. A brilliant
and Oncidiniinae for the Flora Costaricensis, prepared scholar, Joaquín liked to lecture his friends on
in collaboration with John Atwood. complicated themes, such as the biochemistry of colors
Many new orchid species were dedicated to in orchid flowers or the fundamentals in orchid hybrid
Dora Emilia Mora de Retana. Hágsater named his genetics. As John Atwood liked to say: “I don’t have
Epidendrum mora-retanae in her honor, Gerlach his the brains of Joaquín, therefore I need a well-organized
Kefersteinia retanae, Dressler his Sobralia doremiliae, library.” Always generous with his knowledge and his
Luer his Stelis morae and Dodson & Escobar their time, Joaquín served several terms as president of the
Telipogon retanae. Costa Rican Orchid Society. Shortly after his death,
We leave Dora Emilia with Atwoods’ final words Franco Pupulin named Prosthechea joaquingarciana
in her obituary: “…her greatest legacy is to rise above in his honor.
personal ambitions to foster efforts of those around The Lankester Botanical Garden has become the
her. Because of her, Lankester Gardens is blessed with most important center for orchid research in Central
a talented, imaginative, and altruistic staff…” America and the Caribbean. For this reason, in 2003
Joaquín B. García Castro (1944-2001) (Fig. 23), the University of Costa Rica changed its status and
called “Quincho” by his friends, was Dora Emilia’s converted the garden into an ‘experiment station’.
friend and main collaborator for over 25 years. In December 2005, the Ministry of the Environment
Together, they published the first checklist of Costa declared the Lankester Botanical Garden “National
Rican orchids after Paul Standley’s Flora of Costa Rica Center for the Conservation of Flora” and “National
(1937), to which Oakes Ames had contributed with the Epiphyte Sanctuary”. For its institutional merits,
treatment of Orchidaceae. In this Lista actualizada de Luer named Masdevallia lankesteriana, and Pupulin
las orquídeas de Costa Rica, Dora Emilia and Joaquín named Chondrorhyncha lankesteriana (today
García added 46 genera and 467 species to the previous Stenotyla lankesteriana) in honor of the gardens.
catalogue.
Literature cited H. Lankester and Oakes Ames. Orchids (West Palm

Beach), February 2006: 120-127.
Atwood, J.T. 2001. Dora Emilia Mora de Retana, a Ossenbach, C. 2006. Orchids in Costa Rica - Part IV: The
remembrance. Lankesteriana 2: 9. Charles H. Lankester Botanical Garden. Orchids (West
Jiménez, O. 1963. Paul C. Standley. Chicago Natural Palm Beach), April 2006: 284-291.
History Museum Press. Ossenbach, C. 2009. Orchids and Orchidology in Central
Jiménez, O. 1963. 1967. Charles Herbert Lankester. Revista America: 500 years of history. Lankesteriana 9 (1-2):
de Agricultura, Oct. 1967: 248-264. 1-268.
McCook, S. 1999. Creole Science: Botanical Surveys of Schlechter, R. 1923. Additamenta ad Orchideologiam
Costa Rica, 1880-1940. Endeavour 23(3): 118-120. Costaricensem. Repert. Sp. Nov. Regni Veg. 19.
Northen, R. 1964. Charles H. Lankester – Orchidologist of Standley, P.C. 1937. Flora of Costa Rica, Part I. Field
Costa Rica. Amer. Orchid Soc. Bull. January 1964: 43- Museum of Natural History, Botanical Series, Vol. 18,
50. publication 391.
Ossenbach, C. 2003. Breve Historia de la Orquideología en Williams, L.O. 1969. In Memoriam: Charles Herbert
Costa Rica. Editorial de la Universidad de Costa Rica. Lankester – 1879-1969. Amer. Orchid Soc. Bull. : 860-
Ossenbach, C. 2006. Orchids in Costa Rica - Part II: Charles 862.
Appendix
New orchid species collected by Charles Lankester

Campylocentrum lankesteri Ames Lankesterella Ames
Campylocentrum longicalcaratum Ames & C.Schweinf. Lankesterella costaricensis Ames
Chondrorhyncha estrellensis Ames Lepanthes cascajalensis Ames
Cranichis lankesteri Ames Lepanthes chameleon Ames
Cranichis saccata Ames Lepanthes estrellensis Ames
Cryptocentrum gracillimum Ames & C.Schweinf. Lepanthes exasperata Ames & C.Schweinf.
Dichaea ciliolata Rolfe Lepanthes eximia Ames
Dichaea lankesteri Ames Lepanthes grandiflora Ames & C.Schweinf.
Dichaea verrucosa Ames & C.Schweinf. Lepanthes micrantha Ames
Elleanthus tricallosus Ames & C.Schweinf. Lepanthes rostrata Ames
Epidendrum adnatum Ames & C.Schweinf. Lepanthes sanchoi Ames
Epidendrum bilobatum Ames Lepanthes subdimidiata Ames & C.Schweinf.
Epidendrum circinatum Ames Lepanthes tridens Ames
Epidendrum crescentilobium Ames Limodorum lankesteri Ames & C.Schweinf.
Epidendrum cristobalense Ames Lockhartia lankesteri Ames
Epidendrum dentiferum Ames & C.Schweinf. Malaxis lankesteri Ames
Epidendrum dolabrilobum Ames & C.Schweinf. Malaxis uncinata Ames & C.Schweinf.
Epidendrum equitantifolium Ames Masdevallia fimbriata Ames & C.Schweinf.
Epidendrum estrellense Ames Maxillaria arachnitiflora Ames & C.Schweinf.
Epidendrum exile Ames Maxillaria confusa Ames & C.Schweinf.
Epidendrum intermixtum Ames & C.Schweinf. Maxillaria foliosa Ames & C.Schweinf.
Epidendrum lankesteri Ames Maxillaria lankesteri Ames
Epidendrum nervosiflorum Ames & C.Schweinf. Notylia lankesteri Ames
Epidendrum peraltense Ames Oncidium lankesteri Ames
Epidendrum ramosissimum Ames & C.Schweinf. Ornithidium lankesteri Ames
Epidendrum rugosum Ames Ornithocephalus lankesteri Ames
Epidendrum santaclarense Ames Physosiphon obliquipetalus Ames & C.Schweinf.
Epidendrum vagans Ames Pleurothallis angusta Ames & C.Schweinf.
Habenaria lankesteri Ames Pleurothallis arietina Ames
Hexisea lankesteri Ames Pleurothallis cachensis Ames
Hexisea sigmoidea Ames & C.Schweinf. Pleurothallis cerea Ames

374 LANKESTERIANA
Pleurothallis costaricensis Rolfe Scaphyglottis bicallosa Dressler

Pleurothallis crassilabia Ames & C.Schweinf. Sobralia atropubescens Ames & C.Schweinf.
Pleurothallis crescentilabia Ames Sobralia carazoi C.H. Lank. & Ames
Pleurothallis cucullata Ames Sobralia mucronata Ames & C.Schweinf.
Pleurothallis dentipetala Rolfe ex Ames Spiranthes lankesteri Standl. & L.O.Williams
* Pleurothallis dichotoma Ames (nom. ill.) Stelis barbata Rolfe
Pleurothallis geminicaulina Ames Stelis carnosiflora Ames & C.Schweinf.
Pleurothallis glomerata Ames Stelis cascajalensis Ames
Pleurothallis longipedicellata Ames & C.Schweinf. Stelis crystallina Ames
Pleurothallis nana Ames & C.Schweinf. Stelis cucullata Ames
Pleurothallis palliolata Ames Stelis cuspidata Ames
Pleurothallis papilliferaRolfe Stelis distantiflora Ames
Pleurothallis peperomioides Ames Stelis elliptica Ames & C.Schweinf.
Pleurothallis peraltensis Ames Stelis fractiflexa Ames & C.Schweinf.
Pleurothallis peregrina Ames Stelis glandulosa Ames
Pleurothallis periodica Ames Stelis lankesteri Ames
Pleurothallis pompalis Ames Stelis latipetala Ames
Pleurothallis rectipetala Ames & C.Schweinf. Stelis minutiflora Ames & C. Schweinf. (nom. ill.)
Pleurothallis saccata Ames Stelis propinqua Ames
Pleurothallis sanchoi Ames Stelis sanchoi Ames
Pleurothallis scandens Ames Stelis transversalis Ames
Pleurothallis segregatifolia Ames & C.Schweinf. Stelis vestita Ames
Pleurothallis strumosa Ames Stellilabium distantiflorum Ames & C.Schweinf.
Pleurothallis vinacea Ames Stenorrhynchus bracteosus Ames & C.Schweinf.
Restrepia lankesteri Ames & C.Schweinf.
New species collected by Lankester in other plant families

ASTERACEAE PIPERACEAE
Vernonia lankesteri S.F.Blake ex Standl. Peperomia lankesteri Trel.
BROMELIACEAE RANUNCULACEAE
Araeococcus pectinatus L.B.Smith Thalictrum lankesteri Standl.
CACTACEAE SAPOTACEAE
Discocactus lankesteri Kimnach Bumelia lankesteri Standl.
CAPPARACEAE SOLANACEAE
Capparis lankesteri Standl. Lycianthes lankesteri Standl.
EUPHORBIACEAE VERBENACEAE
Croton triumfettoides Croizat Citharexylum lankesteri Moldenke
MALVACEAE
Wercklea lutea Rolfe

LANKESTERIANA 13(3): 375—392. 2014.
Generic and Subtribal Relationships in Neotropical

Cymbidieae (Orchidaceae) Based on matK/ycf1 Plastid Data
W. Mark Whitten1,2, Kurt M. Neubig1 & N. H. Williams1

1
Florida Museum of Natural History, University of Florida
Gainesville, FL 32611-7800 USA
2
Corresponding author: whitten@flmnh.ufl.edu
Abstract. Relationships among all subtribes of Neotropical Cymbidieae (Orchidaceae) were estimated using
combined matK/ycf1 plastid sequence data for 289 taxa. The matrix was analyzed using RAxML. Bootstrap
(BS) analyses yield 100% BS support for all subtribes except Stanhopeinae (87%). Generic relationships within
subtribes are highly resolved and are generally congruent with those presented in previous studies and as
summarized in Genera Orchidacearum. Relationships among subtribes are largely unresolved. The Szlachetko
generic classification of Maxillariinae is not supported. A new combination is made for Maxillaria cacaoensis
J.T.Atwood in Camaridium.
Key words: Orchidaceae, Cymbidieae, Maxillariinae, matK, ycf1, phylogenetics, Camaridium, Maxillaria
cacaoensis, Vargasiella
Cymbidieae include many of the showiest align nrITS sequences across the entire tribe was
Neotropical epiphytic orchids and an unparalleled unrealistic due to high levels of sequence divergence,
diversity in floral rewards and pollination systems. and instead to concentrate our efforts on assembling
Many researchers have posed questions such as a larger plastid data set based on two regions (matK
“How many times and when has male euglossine and ycf1) that are among the most variable plastid
bee pollination evolved?”(Ramírez et al. 2011), or exon regions and can be aligned with minimal
“How many times have oil-reward flowers evolved?” ambiguity across broad taxonomic spans. Although
(Reis et al. 2000) within this clade, but answering various plastid spacer regions such as trnL-F or atpB-
such questions requires a densely sampled and well- rbcL are more rapidly evolving (Shaw et al. 2005),
supported phylogenetic hypothesis. Although the they (like nrITS) are difficult or impossible to align
broad outlines of relationships within Cymbidieae were with confidence across Cymbidieae. In this paper,
revealed by the rbcL/matK analyses of Freudenstein we present phylogenetic analyses of ca. 280 taxa of
et al. (2004) and summaries of Chase et al. (2003), Cymbidieae including representatives of 10 subtribes
both of these studies were constrained by low taxon and most genera (excluding many Oncidiinae) utilizing
sampling and low bootstrap support for many the majority of the matK exon and a ca. 1500 base
clades. The most recent publication of the Genera pair (bp) portion of the 3’ end of ycf1. Phylogenetic
Orchidacearum series (Pridgeon 2009) provided a relationships within Oncidiinae were addressed in
concise and authoritative summary of knowledge of detail by Neubig et al. (2012). Relationships within
this clade that includes 11 subtribes. Phylogenetic trees Maxillariinae were studied using nrITS/matK/atpB-
for Neotropical Cymbidieae published in that volume rbcL spacer by Whitten et al.(2007), and the Bifrenaria
were based upon our nrITS/matK/ycf1 data sets that clade was analyzed in more detail using nrITS/trnL-F
were unpublished and included many sequences not by Koehler et al. (2002). Zygopetalinae relationships
deposited in GenBank. In attempting to rework these were previously studied using nrITS/matK/trnL-F
data for publication, we decided that attempting to (Neubig et al., 2009b; Whitten et al., 2005).
376 LANKESTERIANA
Methods for Stanhopeinae), but most relationships among

subtribes lack BS support.
Most matK sequences were downloaded from
GenBank from previous studies of Cymbidieae subtribes. Eulophiinae — (Fig. 1). Out of the nine genera
Additional sequences were generated using primers recognized in this subtribe, our sampling included the
matK-19F (cgttctgaccatattgcactatg) and only two Neotropical genera; the majority of species
matK 1520R (CGGATAATGTCCAAATACCAAATA) are from the tropics of Africa, Madagascar, Asia, and
and the amplification and sequencing protocols of Australia. Eulophiinae are weakly sister to Catasetinae
Whitten et al. (2007). A ca. 1500 bp portion of 3’ in the single ML tree.
portion of ycf1 was amplified and sequenced using the
primers and protocols in Neubig et al. (2009a). A list Catasetinae — (Fig. 1). Recent molecular phylogenetic
of taxa, vouchers, and GenBank numbers is presented studies (Batista et al., In press) place the three
in Table 1. Matrices were aligned using Muscle species of Cyanaeorchis Barb.Rodr. in Catasetinae;
(Edgar, 2004)followed by manual adjustment of gaps it is sister to Grobya Lindl., and they are sister to all
to maintain reading frame using Se-Al (Rambaut remaining Catasetinae. Our sampling includes five
1996). The matK matrix was trimmed to eliminate of the seven genera, with Grobya and Mormodes
a region of ambiguous alignment in the first 100 bp. absent; other phylogenetic studies confirm Grobya as
Polystachya was chosen as the outgroup based upon monophyletic and a member of Catasetinae (Monteiro
broader sampling (Neubig et al. 2009a). Matrices and et al. 2010). Unpublished ycf1 and matK sequences
a list of vouchers are deposited in the Dryad Digital for Cyanaeorchis arundinae (Rchb.f.) Barb.Rodr. and
Repository (http://doi.org/10.5061/dryad.2rm60) or unidentified Grobya species (Whitten and Batista,
are available from the author. The resulting combined unpubl.) confirm these relationships. Oscar Peréz
matrix consists of 288 ingroup taxa and 1 outgroup (pers. comm.) also reported finding plastid/nuclear
(Polystachya); the aligned matrix consists of 3618 incongruence among sections of Cycnoches.
characters (1605 for matK; 2013 for ycf1). Gaps are Cyrtopodiinae — (Fig. 1). Our analyses confirm the
coded as missing data. distinctiveness of this monogeneric subtribe from
The aligned matrix was analyzed using maximum the vegetatively similar Catasetinae; Cyrtopodium is
likelihood (ML) as implemented in RAxML-HPC weakly sister to all remaining Cymbidieae, and not
Blackbox version 7.6.3 (Stamatakis, 2006) via the to Catasetinae, confirming the relationships found by
CIPRES Science Gateway computing facility (http:// Pridgeon and Chase (Pridgeon & Chase 1998).
www.phylo.org/index.php/portal/). Analyses were run
using default values with 200 fast bootstrap replicates. Oncidiinae — (Fig. 1). Our sampling of Oncidiinae
The resulting bootstrap trees were saved to a treefile, was minimal, including placeholder representatives
opened in PAUP* (Swofford 2003), and a majority- of the major clades within the subtribe; a much
rule consensus tree was generated to display bootstrap more extensive sampling based on matK/ycf1 plus
support values. FigTree 1.4.0 (Rambaut 2013) was other regions was presented by Neubig et al. (2012).
used to edit and print the best ML tree. Oncidiinae are in a highly supported clade that includes
subtribes Eriopsidinae, Zygopetalinae, Stanhopeinae,
Results and Discussion Coeliopsidinae, and Maxillariinae but relationships
within this clade are poorly supported.
The resulting best ML tree is presented in Figures
1-5; bootstrap (BS) values above 75% are annotated Eriopsidinae — (Fig. 2). Dressler (1981) included
on this tree. Overall, the tree agrees well with previous Eriopsis in Cyrtopodiinae on the basis of floral traits
studies based on plastid and nuclear regions (Górniak and pollinarium structure but later regarded it as
et al. 2010). Subtribe Cymbidiinae is represented by incertae sedis (Dressler 1993). Szlachetko (1995)
only a single taxon (Cymbidium); it is sister to all created a subtribe to accommodate this anomalous
remaining taxa. All subtribes (as delimited in Genera genus; our trees confirm its uniqueness relative to
Orchidacearum) received 100% BS support (except other subtribes.
Whitten et al. — Generic and subtribal relationships in Neotropical Cymbidieae 377
Table 1. List of taxa sequenced with GenBank numbers and voucher information.
Taxon matK ycf1 Voucher:Herbarium
Acineta chrysantha (C. Morren) Lindl. KF660253 KF660372 Whitten 91360 (FLAS)
Acineta superba (Kunth) Rchb.f. KF660254 KF660523 Whitten 3378 (FLAS)
Aetheorhyncha andreettae (Jenny) Dressler AY869932 KF660386 Dressler 6360 (FLAS)
Aganisia fimbriata Rchb.f. AY870006 KF660404 Breuer s.n. (M)
Aganisia pulchella Lindl. AY870007 KF660403 Breuer s.n. (M)
Anguloa hohenlohii C. Morren AF239429 KF660512 Whitten 3023 (FLAS)
Anguloa uniflora Ruiz & Pav. KF660255 KF660364 Whitten 3263 (FLAS)
Batemannia lepida Rchb.f. AY869990 KF660323 Gerlach 92-3900 (M)
Benzingia cornuta (Garay) Dressler AY869927 KF660450 Whitten 1818 (FLAS)
Benzingia estradae (Dodson) Dodson AY869930 KF660398 Gerlach 96-4287 (M)
Benzingia hajekii (D.E.Benn. & Christenson) Dressler AY869929 KF660377 Whitten 1751 (FLAS)
Benzingia reichenbachiana (Schltr.) Dressler AF239421 KF660363 Whitten 1747 (FLAS)
Bifrenaria inodora Lindl. DQ210744 KF660365 Whitten 0097 (FLAS)
Bifrenaria tetragona (Lindl.) Schltr. DQ210751 KF660529 Whitten 0506 (FLAS)
Bifrenaria tyrianthina (Lodd. ex Loudon) Rchb.f. DQ210752 KF660379 Whitten 0507 (FLAS)
Braemia vittata (Lindl.) Jenny AF239476 KF660338 Chase 84748 (FLAS)
Brasiliorchis gracilis (Lodd.) R. B. Singer, S. Koehler DQ210811 KF660426 Whitten 2303 (FLAS)
& Carnevali
Brasiliorchis schunkeana (Campacci & Kautsky) DQ210799 KF660421 Whitten 1992 (FLAS)
R. B. Singer, S. Koehler & Carnevali
Brassia aurantiaca (Lindl.) M.W.Chase AF239492 FJ563573 Williams s.n. (FLAS)
Brassia jipijapensis Dodson & N.H.Williams FJ564762 FJ563258 Whitten 1829 (FLAS)
Camaridium bradeorum Schltr. DQ210963 KF660468 Whitten 2639 (FLAS)
Camaridium carinatum (Barb.Rodr.) Hoehne DQ210828 KF660431 Whitten 2337 (FLAS)
Camaridium ctenostachys (Rchb.f.) Schltr. DQ210967 KF660471 Whitten 2647 (FLAS)
Camaridium cucullatum (Lindl.) M.A Blanco DQ210753 KF660354 Whitten 2547 (FLAS)
Camaridium dendrobioides Schltr. DQ210952 KF660463 Whitten 2627 (FLAS)
Camaridium horichii (Senghas) M.A. Blanco DQ210937 KF660461 Whitten 2602 (FLAS)
Camaridium nutantiflorum Schltr. DQ210964 KF660469 Whitten 2643 (FLAS)
Camaridium ochroleucum Lindl. DQ210626 KF660312 Gerlach 2003-3648 (M)
Camaridium paleatum (Rchb.f.) M.A.Blanco DQ210907 KF660458 Whitten 2561 (FLAS)
Camaridium scalariforme (J.T.Atwood) M.A.Blanco DQ210957 KF660466 Whitten 2633 (FLAS)
Camaridium vestitum (Sw.) Lindl. DQ209866 KF660304 Atwood & Whitten 5070 (SEL)
Catasetum expansum Rchb.f. KF660256 KF660525 Whitten 3543 (FLAS)
Chaubardia klugii (C.Schweinf.) Garay AY869973 KF660378 Whitten 1853 (FLAS)
Chaubardia surinamensis Rchb.f. AY869974 KF660309 Gerlach 2001-2159 (M)
Chaubardiella pubescens Ackerman AY869944 KF660416 Whitten 1620 (FLAS)
Chaubardiella subquadrata (Schltr.) Garay AY869945 KF660407 Whitten s.n. (FLAS)
Chaubardiella tigrina (Garay & Dunst.) Garay AY869946 KF660311 Gerlach 1651 (M)
Chondrorhyncha hirtzii Dodson AY869916 KF660389 Whitten 1637 (FLAS)
Chondrorhyncha hirtzii Dodson AY869913 KF660406 Maduro & Olmos 217 (FLAS)
Chondrorhyncha rosea Lindl. AY869914 KF660385 Whitten 1760 (FLAS)

378 LANKESTERIANA
Table 1. Continues.
Chondroscaphe amabilis (Schltr.) Senghas & G.Gerlach AY869966 KF660391 Whitten 1855 (FLAS)
Chondroscaphe bicolor (Rolfe) Dressler AY869971 KF660390 Dressler ex Hoffman s.n. (FLAS)
Chondroscaphe eburnea (Dressler) Dressler AY869915 KF660408 Dressler 6361 (FLAS)
Chondroscaphe flaveola (Linden & Rchb.f.) Senghas AY869969 KF660320 Gerlach 93-3342 (M)
& G.Gerlach
Christensonella ferdinandiana (Barb.Rodr.) Szlach., Mytnik, DQ210670 KF660353 Koehler 109 (UEC)
Górniak & Smiszek
Christensonella nardoides (Kraenzl.) Szlach., Mytnik, DQ210890 KF660452 Whitten 2502 (FLAS)
Górniak & Smiszek
Christensonella pacholskii (Christenson) S.Koehler DQ210851 KF660437 Whitten 2393 (FLAS)
Cirrhaea fuscolutea Lindl. KF660257 KF660508 Whitten 2976 (FLAS)
Cirrhaea seidelii Pabst KF660258 KF660333 Gerlach s.n. (M)
Cischweinfia pusilla (C.Schweinf.) Dressler & N.H.Williams FJ565130 FJ563799 Whitten 3300 FLAS
Clowesia dodsoniana E.Aguirre KF660259 KF660524 Whitten 3542 (FLAS)
Cochleanthes flabelliformis (Sw.) R.E.Schult. & Garay AY869965 KF660513 Whitten 99113 (FLAS)
Coeliopsis hyacinthosma Rchb.f. AF239440 KF660337 Whitten 93153 (FLAS)
Comparettia falcata Poepp. & Endl. FJ563869 FJ563283 Williams N084 (FLAS)
Comparettia macroplectron Rchb.f. & Triana FJ565135 FJ563804 Whitten 3425 (FLAS)
Coryanthes elegantium Linden & Rchb.f. KF660260 KF660318 Whitten 87267 (FLAS)
Coryanthes macrantha (Hook.) Hook. KF660261 KF660319 Gerlach O-21458 (M)
Coryanthes verrucolineata G.Gerlach KF660262 KF660317 Gerlach 96-4284 (M)
Cryptarrhena guatemalensis Schltr. AY869983 KF660476 Pupulin & Campos 2957 (USJ)
Cryptarrhena lunata R.Br. AY869982 KF660405 Whitten 98000 (FLAS)
Cryptocentrum beckendorfii Carnevali KF660263 KF660307 Beckendorf s.n. (CICY)
Cryptocentrum peruvianum (Cogn.) C.Schweinf. DQ210820 KF660430 Whitten 2322 (FLAS)
Cryptocentrum roseans (Schltr.) A.D.Hawkes DQ210903 KF660457 Whitten 2554 (FLAS)
Cycnoches cooperi Rolfe KF660264 KF660526 Whitten 3591 (FLAS)
Cycnoches lehmannii Rchb.f. KF660265 KF660328 Whitten 87011 (FLAS)
Cycnoches manoelae P.Castro & Campacci KF660266 KF660310 Gerlach 05-1231 (M)
Cycnoches pachydactylon Schltr. KF660267 KF660316 Gerlach 00-3414 (M)
Cymbidium devonianum Paxton KF660268 KF660325 Chase 87030 (K)
Cyrtidiorchis alata (Ruiz & Pav.) Rauschert DQ210627 KF660321 Gerlach 94-4005 (M)
Cyrtidiorchis alata (Ruiz & Pav.) Rauschert DQ211044 KF660505 Whitten 2932 (FLAS)
Cyrtochilum serratum (Lindl.) Kraenzl. FJ563842 FJ562462 Chase O-032 (K)
Cyrtopodium andersonii (Lamb. ex Andrews) R.Br. KF660269 KF660329 Kew no voucher
Cyrtopodium flavum (Nees) Link & Otto ex Rchb. KF660270 KF660522 Whitten 3377 (FLAS)
Cyrtopodium longibulbosum Dodson & G.A.Romero KF660271 KF660453 Whitten 2504 (QCA)
Daiotyla albicans (Rolfe) Dressler AY869917 KF660396 Whitten 1932 (FLAS)
Dichaea eligulata Folsom EU123625 EU123747 Pupulin 1094 (USJ-L)
Dichaea fragrantissima Folsom EU123628 EU123750 Pupulin 4601 (USJ-L)
Dichaea panamensis Lindl. EU123650 EU123772 Whitten 2556 (FLAS)
Dichaea trulla Rchb.f. EU123671 EU123792 Whitten 2475 (FLAS)

Table 1. Continues.
Dipteranthus grandiflorus (Lindl.) Pabst AF350587 FJ563191 Chase O-103 (K)

Dressleria dilecta (Rchb.f.) Dodson AF239507 EU490731 Whitten F1046 (SEL)
Dressleria fragrans Dodson KF660272 KF660327 Dodson 8855 (SEL)
Dressleria helleri Dodson KF660273 KF660326 Hills 87145 (FLAS)
Embreea herrenhusana (Jenny) Jenny KF660275 KF660314 Gerlach 04-2526 (M)
Embreea rodigasiana (Claes ex Cogn.) Dodson KF660276 KF660313 Gerlach 05-2172 (M)
Eriopsis biloba Lindl. DQ210866 EU490743 Whitten 3327 (FLAS)
Eriopsis biloba Lindl. DQ210866 KF660441 Whitten 2439 (FLAS)
Eriopsis biloba Lindl. DQ461806 KF660515 Whitten 3153 (QCA)
Erycina pusilla (L.) N.H.Williams & M.W.Chase FJ565025. FJ563690 Whitten 1771 FLAS
Eulophia guineensis Lindl. AF239509 EU490745 Whitten 99029 (FLAS)
Eulophia petersii (Rchb.f.) Rchb.f. KF660274 KF660332 Chase 22361 (K)
Fernandezia cuencae (Rchb.f.) M.W.Chase FJ565079 KF660454 Whitten 2537 (FLAS)
Fernandezia sanguinea (Lindl.) Garay & Dunst. FJ565009 FJ563674 Whitten 1700 FLAS
Fernandezia tica Mora-Ret. & García Castro FJ564944 FJ563591 Dressler & Atwood s.n. FLAS
Galeandra devoniana M.R.Schomb. ex Lindl. KF660278 KF660330 Pupulin 1133 (JBL)
Galeottia burkei (Rchb.f.) Dressler & Christenson AY869987 KF660400 Maguire & Politi 28175 (AMES)
Galeottia ciliata (Morel) Dressler & Christenson AY869989 KF660401 Breuer s.n. (M)
Galeottia colombiana (Garay) Dressler & Christenson AY869986 KF660397 Gerlach 93-3396 (M)
Gongora amparoana Schltr. AF239481 KF660367 Whitten 91036 (FLAS)
Gongora armeniaca (Lindl.) Rchb.f. AF239482 KF660334 Hills 86143 (FLAS)
Gongora armeniaca (Lindl.) Rchb.f. AF239482 KF660374 Whitten F1636 (FLAS)
Gongora escobariana Whitten KF660279 KF660347 Whitten 95023 (FLAS)
Gongora hirtzii Dodson & N.H.Williams KF660280 KF660349 Whitten 93109 (FLAS)
Gongora ilense Whitten & Jenny AF239480 KF660509 Whitten 2982 (FLAS)
Gongora portentosa Linden & Rchb.f. AF239485 KF660341 Bennett 5258 (FLAS)
Gongora portentosa Linden & Rchb.f. KF660281 KF660350 Bennett 5279 (FLAS)
Gongora seideliana Rchb.f. KF660282 KF660348 Whitten F-1635 (FLAS)
Gongora sphaerica Jenny KF660283 KF660331 Whitten 2003 (FLAS)
Gongora tridentata Whitten AF239483 KF660373 Whitten 1083 (FLAS)
Grandiphyllum robustissimum (Rchb.f.) Docha Neto FJ563959 FJ563597 Whitten 1777 FLAS
Guanchezia maguirei (C.Schweinf.) G.A.Romero KF660284 KF660410 Maguire & Politi 27931 (AMES)
& G.Carnevali
Heterotaxis crassifolia Lindl. DQ210897 KF660455 Whitten 2544 (FLAS)
Heterotaxis equitans (Schltr.) Ojeda & Carnevali DQ210877 KF660448 Whitten 2483 (FLAS)
Heterotaxis maleolens (Schltr.) Ojeda & Carnevali DQ209972 KF660486 Whitten 2764 (FLAS)
Heterotaxis santanae (Carnevali & I.Ramírez) Ojeda DQ209973 KF660487 Whitten 2765 (FLAS)
& Carnevali
Heterotaxis valenzuelana (A.Rich.) Ojeda & Carnevali DQ210950 KF660510 Whitten 2620 (FLAS)
Heterotaxis violaceopunctata (Rchb.f.) F.Barros DQ210807 KF660424 Whitten 2294 (FLAS)
Hintonella mexicana Ames FJ564940 FJ562874 Whitten W513 (FLAS)
Horichia dressleri Jenny AF239458 KF660340 Whitten 93151 (FLAS)

380 LANKESTERIANA
Table 1. Continues.
Houlletia brocklehurstiana Lindl. KF660285 KF660335 Gerlach s.n. (M)

Houlletia odoratissima Linden ex Lindl. & Paxton KF660286 KF660315 Gerlach 97-3285 (M)
Houlletia sanderi Rolfe AF239467 KF660376 Whitten 93079 (FLAS)
Houlletia tigrina Linden ex Lindl. AF239466 KF660375 Whitten 91354 (FLAS)
Huntleya wallisii (Rchb.f.) Rolfe EU123674 EU123796 Whitten 88026 (FLAS)
Hylaeorchis petiolaris (Schltr.) Carnevali & G.A.Romero DQ211020 KF660352 Whitten 2874 (FLAS)
Inti bicallosa (Rchb.f.) M.A.Blanco DQ209946 KF660417 Whitten 1677 (FLAS)
Inti bicallosa (Rchb.f.) M.A.Blanco DQ210960 KF660467 Whitten 2636 (FLAS)
Inti chartacifolia (Ames & C.Schweinf.) M.A.Blanco DQ209942 EU490750 Whitten 1597 (FLAS)
Inti chartacifolia (Ames & C.Schweinf.) M.A.Blanco DQ211000 KF660485 Whitten 2752 (FLAS)
Ixyophora viridisepala (Senghas) Dressler AY869942 KF660418 Whitten 1749 (FLAS)
Kefersteinia excentrica Dressler & Mora-Ret. AY869934 KF660507 Dressler 6236 (FLAS)
Kefersteinia maculosa Dressler AY869938 KF660422 Whitten 1997 (FLAS)
Kefersteinia microcharis Schltr. AY869937 KF660308 Pupulin 252 (USJ)
Kefersteinia trullata Dressler AY869936 KF660423 Whitten 1998 (FLAS)
Kegeliella atropilosa L.O.Williams & A.H.Heller AF239459 KF660342 Whitten 93101 (FLAS)
Kegeliella kupperi Mansf. AF263666 KF660339 Whitten F167 (FLAS)
Koellensteinia graminea (Lindl.) Rchb.f. AY870003 KF660429 Chase 159 (K)
Lacaena spectabilis (Klotzsch) Rchb.f. KF660287 KF660346 Whitten F-184 (FLAS)
Lockhartia amoena Endres & Rchb.f. FJ564686 FJ563116 Blanco 1803 (FLAS)
Lueckelia breviloba (Summerh.) Jenny KF660288 KF660382 Gerlach 96-6072 (M)
Lueddemannia pescatorei (Lindl.) Linden & Rchb.f. AF239472 KF660488 Gerlach 2003-1482(M)
Lycaste aromatica (Graham) Lindl. AF263669 KF660322 Freudenstein s.n.
Lycomormium fiskei H.R.Sweet AF239441 KF660528 Whitten 91340 (FLAS)
Mapinguari auyantepuiensis (Foldats) Carnevali & DQ210830 KF660432 Whitten 2347 (FLAS)
R.B.Singer
Mapinguari longipetiolatus (Ames & C.Schweinf.) Carnevali DQ210747 KF660305 Atwood & Whitten 5075 (SEL)
& R.B.Singer
Maxillaria acostae Schltr. DQ210965 KF660470 Whitten 2644 (FLAS)
Maxillaria angustissima Ames, F.T.Hubb. & C.Schweinf. DQ210993 KF660479 Whitten 2735 (FLAS)
Maxillaria augustae-victoriae F.Lehm.&Kraenzl. DQ211026 KF660500 Whitten 2893 (FLAS)
Maxillaria brachybulbon Schltr. DQ210773 KF660414 Whitten 1583 (FLAS)
Maxillaria buchtienii Schltr. DQ211047 KF660506 Whitten 2940 (FLAS)
Maxillaria cacaoensis J.T.Atwood KC747493 KC747494 Whitten 3362 (FLAS)
Maxillaria calantha Schltr. DQ210900 KF660456 Whitten 2550 (FLAS)
Maxillaria canarina D.E.Benn. & Christenson KF660289 KF660518 Whitten 3256 (FLAS)
Maxillaria chionantha J.T.Atwood DQ210969 KF660472 Whitten 2649 (FLAS)
Maxillaria confusa Ames & C.Schweinf. DQ210994 KF660480 Whitten 2736 (FLAS)
Maxillaria dalessandroi Dodson DQ211024 KF660499 Whitten 2889 (FLAS)
Maxillaria dillonii D.E.Benn. & Christenson KF660290 KF660496 Whitten 2878 (FLAS)
Maxillaria ecuadorensis Schltr. DQ210989 KF660478 Whitten 2724 (FLAS)
Maxillaria elegantula Rolfe DQ210921 KF660460 Whitten 2576 (FLAS)

Table 1. Continues.
Maxillaria exaltata (Kraenzl.) C.Schweinf. DQ210818 KF660428 Whitten 2317 (FLAS)

Maxillaria gentryi Dodson DQ210975 KF660475 Whitten 2656 (FLAS)
Maxillaria grayi Dodson KF660291 KF660497 Whitten 2879 (FLAS)
Maxillaria guadalupensis Cogn. DQ210775 KF660415 Whitten 1593 (FLAS)
Maxillaria guadalupensis Cogn. KF660292 KF660445 Whitten 2468 (FLAS)
Maxillaria hennisiana Schltr. DQ210918 KF660459 Whitten 2572 (FLAS)
Maxillaria litensis Dodson KF660293 KF660498 Whitten 2888 (FLAS)
Maxillaria longipes Lindl. DQ210999 KF660484 Whitten 2751 (FLAS)
Maxillaria longissima Lindl. DQ210996 KF660482 Whitten 2745 (FLAS)
Maxillaria lueri Dodson DQ210954 KF660464 Whitten 2629 (FLAS)
Maxillaria meridensis Lindl. DQ210870 KF660443 Whitten 2451 (FLAS)
Maxillaria ochroleuca Lodd. ex Lindl. DQ210844 KF660435 Whitten 2378 (FLAS)
Maxillaria platypetala Ruiz & Pav. DQ211033 KF660502 Whitten 2909 (FLAS)
Maxillaria porrecta Lindl. DQ210948 KF660462 Whitten 2617 (FLAS)
Maxillaria pulla Linden & Rchb.f. DQ210872 KF660444 Whitten 2459 (FLAS)
Maxillaria silvana Campacci DQ210997 KF660483 Whitten 2747 (FLAS)
Maxillaria sp. nov. KF660294 KF660520 Whitten 3337 (FLAS)
Maxillaria splendens Poepp. & Endl. FJ565112 FJ563781 Whitten 2949 FLAS
Maxillaria triloris E.Morren DQ209887 KF660411 Blanco 1640 (USJ)
Maxillaria triloris E.Morren DQ211038 KF660503 Whitten 2917 (FLAS)
Maxillariella arbuscula (Lindl.) M.A.Blanco & Carnevali DQ211013 KF660491 Whitten 2810 (FLAS)
Maxillariella elatior (Rchb.f.) M.A.Blanco & Carnevali DQ210797 KF660420 Whitten 1986 (FLAS)
Maxillariella oreocharis (Schltr.) M.A.Blanco & Carnevali DQ210971 KF660473 Whitten 2652 (FLAS)
Maxillariella ponerantha (Rchb.f.) M.A.Blanco & Carnevali DQ210973 KF660474 Whitten 2654 (FLAS)
Maxillariella procurrens (Lindl.) M.A.Blanco & Carnevali DQ210854 KF660438 Whitten 2397 (FLAS)
Maxillariella variabilis (Bateman ex Lindl.) M.A.Blanco DQ210995 KF660481 Whitten 2737 (FLAS)
& Carnevali
Miltonia regnellii Rchb.f. AF239491 FJ563571 Chase 86059 (K)
Mormolyca peruviana C.Schweinf. DQ210885 KF660451 Whitten 2497 (FLAS)
Mormolyca polyphylla Garay & Wirth DQ211009 KF660489 Whitten 2789 (FLAS)
Mormolyca richii (Dodson) M.A.Blanco DQ210836 KF660434 Whitten 2362 (FLAS)
Mormolyca ringens (Lindl.) Gentil DQ210680 KF660493 Whitten 2857 (FLAS)
Mormolyca schlimii (Linden & Rchb.f.) M.A.Blanco DQ210847 KF660436 Whitten 2386 (FLAS)
Neogardneria murrayana (Gardner ex Hook.) Schltr. AY869997 KF660402 Gerlach s.n. (M)
ex Garay
Neomoorea wallisii (Rchb.f.) Schltr. DQ210743 EU490754 Whitten 3010 (FLAS)
Nitidobulbon nasutum (Rchb. f.) I.Ojeda & Carnevali DQ210756 KF660419 Whitten 1869 (FLAS)
Nitidobulbon proboscideum (Rchb. f.) I.Ojeda & Carnevali DQ209857 KF660303 Atwood & Whitten 5056 (SEL)
Notyliopsis beatricis P.Ortiz FJ565086 FJ563753 Whitten 2674 FLAS
Oeceoclades maculata (Lindl.) Lindl. KF660295 KF660519 Whitten 3333 (FLAS)
Oncidium cirrhosum (Lindl.) Beer FJ563845 FJ562480 Chase 86235 (K)
Oncidium sphacelatum Lindl. FJ563863 FJ563267 Whitten 3467 (FLAS

382 LANKESTERIANA
Table 1. Continues.
Oncidium weinmannianum (Königer) M.W. Chase FJ565036 FJ563701 Whitten 2328 FLAS
& N.H. Williams
Ornithidium aggregatum Rchb.f. DQ210880 KF660449 Whitten 2488 (FLAS)

Ornithidium canarense (J.T.Atwood) M.A.Blanco & Ojeda DQ209959 KF660440 Whitten 2437 (FLAS)
Ornithidium coccineum (Jacq.) Salisb. ex R.Br. DQ209875 KF660494 Whitten 2860 (FLAS)
Ornithidium donaldeedodii Ackerman & Whitten KF660296 KF660527 Forbes s.n. (UC)
Ornithidium fulgens Rchb.f. DQ209968 KF660465 Whitten 2630 (FLAS)
Ornithidium giganteum Lindl. DQ210817 KF660427 Whitten 2316 (FLAS)
Ornithidium multicaule (Poepp. & Endl.) Rchb.f. DQ211032 KF660501 Whitten 2905 (FLAS)
Ornithidium serrulatum Lindl. DQ211010 KF660490 Whitten 2800 (FLAS)
Ornithidium sophronitis Rchb.f. DQ210809 KF660425 Whitten 2296 (FLAS)
Ornithocephalus dalstroemii (Dodson) Toscano & Dressler FJ564705 FJ563134 Blanco 2980 FLAS
Ornithocephalus dalstroemii (Dodson) Toscano & Dressler FJ564705 FJ563761 Blanco 2980 FLAS
Ornithocephalus inflexus Lindl. DQ315891 FJ563120 Blanco 2545 (FLAS)
Otoglossum globuliferum (Kunth) N.H.Williams & M.W.Chase FJ564700 FJ563129 Blanco 2856 (FLAS)
Otoglossum globuliferum (Kunth) N.H.Williams & M.W.Chase FJ564700 FJ563129 Blanco 2856 FLAS
Otostylis lepida (Linden & Rchb.f.) Schltr. AY870009 KF660399 Gerlach 94-968 (M)
Otostylis paludosa (Cogn.) Schltr. KF660297 KF660517 Whitten 3250 (FLAS)
Paphinia clausula Dressler KF660298 EU490758 Whitten 3600 (FLAS)
Paphinia neudeckeri Jenny AF239471 KF660371 Whitten 88041 (FLAS)
Peristeria elata Hook. AF239442 EU490761 Whitten 90158 (FLAS)
Pescatoria cerina (Lindl. & Paxton) Rchb.f. AY869952 KF660384 Whitten s.n. (FLAS)
Pescatoria coronaria Rchb.f. AY869954 KF660368 Whitten 1758 (FLAS)
Pescatoria lamellosa Rchb.f. AY869953 KF660369 Whitten 1755 (FLAS)
Pescatoria lawrenceana (Rchb.f.) Dressler AF350662 KF660393 Whitten 1636 (FLAS)
Pescatoria lehmannii Rchb.f. AF239422 KF660492 Whitten 2848 (FLAS)
Pescatoria pulvinaris (Rchb.f.) Dressler AY869950 KF660388 Whitten 1748 (FLAS)
Pityphyllum huancabambae (Kraenzl.) Whitten DQ209957 KF660439 Whitten 2402 (FLAS)
Pityphyllum laricinum (Kraenzl.) Schltr. DQ209961 KF660446 Whitten 2473 (FLAS)
Pityphyllum saragurense (Dodson) Whitten DQ461805 KF660514 Whitten 3084 (QCA)
Polycycnis gratiosa Endres & Rchb.f. AF239469 EU490769 Whitten 93178 (FLAS)
Polycycnis gratiosa Endres & Rchb.f. AF239469 EU490769 Whitten 93178 (FLAS)
Polyotidium huebneri (Mansf.) Garay FJ563960 FJ563598 Romero 3124 AMES
Polystachya cultriformis (Thouars) Lindl. ex Spreng. DQ091312 KF660306 Carlsward 213 (SEL)
Promenaea stapelioides (Link & Otto) Lindl. AY870002 EU123797 Whitten 94102 (FLAS)
Promenaea xanthina (Lindl.) Lindl. AY870000 KF660366 Whitten 1860 (FLAS)
Psychopsiella limminghei (E.Morren ex Lindl.) Lückel FJ565152 FJ563820 Whitten 3561 FLAS
& Braem
Psychopsis sanderae (Rolfe) Lückel & Braem FJ564712 FJ563158 Chase 86126 (K)
Rhetinantha acuminata (Lindl.) M.A.Blanco DQ210981 KF660477 Whitten 2698 (FLAS)
Rhetinantha notylioglossa (Rchb.f.) M.A.Blanco DQ210645 KF660351 Koehler 0033 (UEC)

Table 1. Continues.
Rossioglossum krameri (Rchb. f.) M.W. Chase FJ563847 FJ562488 Chase 83166 (K)
& N.H. Williams
Rudolfiella floribunda (Schltr.) Hoehne AF239433 EU490776 Whitten 97020 (FLAS)
Rudolfiella sp. FJ564977 FJ563642 Whitten 1618 FLAS
Sauvetrea chicana (Dodson) M.A.Blanco DQ461813 KF660516 Whitten 3187 (QCA)
Sauvetrea chicana (Dodson) M.A.Blanco KF660299 KF660521 Whitten 3338 (FLAS)
Sauvetrea laevilabris (Lindl.) M.A.Blanco DQ210832 KF660433 Whitten 2358 (FLAS)
Schlimmia alpina Rchb.f. & Warsz. KF660300 KF660345 Bennett 5130 (MOL)
Schlimmia stevensonii Dodson AF239463 KF660343 Whitten 94107 (FLAS)
Scuticaria hadwenii (Lindl.) Planch. AF239424 KF660370 Whitten 97109 (FLAS)
Scuticaria salesiana Dressler DQ210875 KF660447 Whitten 2478 (FLAS)
Sievekingia herrenhusana Jenny AF239453 KF660336 Whitten 93010 (FLAS)
Soterosanthus shepheardii (Rolfe) Jenny AF239457 EU490784. Dodson 18580-3 (FLAS)
Stanhopea anfracta Rolfe AF239450 KF660511 Whitten 3022 (FLAS)
Stanhopea annulata Mansf. AF239444 EU490786 Whitten 87242 (FLAS)
Stanhopea cirrhata Lindl. AF239464 KF660360 Whitten F1296 (FLAS)
Stanhopea confusa G.Gerlach & Beeche AF239449 KF660359 Whitten 94006 (FLAS)
Stanhopea ecornuta Lem. AF239445 KF660362 Whitten 90026 (FLAS)
Stanhopea pulla Rchb.f. AF239451 KF660361 Whitten 93117 (FLAS)
Stanhopea tigrina Bateman ex Lindl. FJ564736 FJ563222 Whitten 3585 FLAS
Stenia bismarckii Dodson & D.E.Benn. AY869920 KF660392 Whitten 1698 (FLAS)
Stenia calceolaris (Garay) Dodson & D.E.Benn. AY869919 KF660394 Whitten 1699 (FLAS)
Stenotyla lankesteriana (Pupulin) Dressler AY869962 KF660383 Dressler 6363 (FLAS)
Stenotyla lendyana (Rchb.f.) Dressler AY869963 KF660381 Dressler 6228 (FLAS)
Stenotyla picta (Rchb.f.) Dressler AY869961 KF660395 Dressler 6235 (FLAS)
Sudamerlycaste ciliata (Ruiz & Pav.) Archila KF660301 KF660495 Whitten 2877 (FLAS)
Telipogon hystrix (Dodson) N.H.Williams & Dressler DQ315899 FJ563601 Whitten 1824 (FLAS)
Telipogon parvulus C.Schweinf. DQ315909 FJ563574 Whitten 99259 (FLAS)
Telipogon pogonostalix Rchb.f. AF239488 FJ562506 Chase O-123 (K)
Tolumnia gundlachii (C.Wright ex Griseb.) N.H.Williams FJ565132 FJ563801 Whitten 3358 FLAS
& Ackerman
Tolumnia pulchella (Hook.) Raf. FJ564820 FJ563411 Whitten 3499 (FLAS)
Trevoria zahlbruckneriana (Schltr.) Garay KF660302 KF660324 Dodson 17309 (MO)
Trichocentrum jonesianum (Rchb.f.) M.W.Chase AF350653 FJ562496 Chase 86118 (K)
& N.H.Williams
Trichocentrum luridum (Lindl.) M.W.Chase & N.H.Williams FJ564957 FJ563449 Carnevali 6243 (CICY)
Trichoceros antennifer (Humb. & Bonpl.) Kunth FJ564953 FJ563612 Whitten 1803 (FLAS)
Trigonidium acuminatum Bateman ex Lindl. DQ210640 KF660358 Koehler 363 (UEC)
Trigonidium acuminatum Bateman ex Lindl. DQ210867 KF660442 Whitten 2442 (FLAS)
Trigonidium egertonianum Bateman ex Lindl. DQ210714 KF660356 Koehler 317 (UEC)
Trigonidium egertonianum Bateman ex Lindl. DQ210730 KF660357 Koehler 361 (UEC)
Trigonidium insigne Rchb.f. ex Benth. & Hook.f. DQ211041 KF660504 Whitten 2926 (FLAS)

384 LANKESTERIANA
Table 1. Continues.
Trigonidium turbinatum Rchb.f. DQ210713 KF660355 Koehler 315 (UEC)

Trizeuxis falcata Lindl. FJ563850 FJ563198 Chase O-129 (K)
Vasqueziella boliviana Dodson AF239473 KF660344 Vasquez s.n. (FLAS)
Warczewiczella discolor (Lindl.) Rchb.f. AY869959 KF660412 Whitten 1859 (FLAS)
Warczewiczella marginata Rchb.f. AY869958 EU490794 Whitten s.n. (FLAS)
Warczewiczella wailesiana (Lindl.) E.Morren AY869960 KF660387 Gerlach 93-3314 (M)
Warrea warreana (Lodd. ex Lindl.) C.Schweinf. AF239417 EU123798 Whitten 1752 (FLAS)
Xylobium leontoglossum (Rchb.f.) Benth. ex Rolfe DQ209970 KF660413 Whitten 2683 (FLAS)
Xylobium pallidiflorum (Hook.) G.Nicholson AF239434 EU490795 Whitten 1876 (FLAS)
Xylobium zarumense Dodson AF239435 KF660380 Whitten 1881 (FLAS)
Zygopetalum maxillare Lodd. AY869996 FJ562864 Whitten 94103 (FLAS)
Zygosepalum tatei (Ames & C.Schweinf.) Garay & Dunst. AY869994 KF660409 Maguire & Politi 27494 (AMES)
Zygopetalinae — (Fig. 2). Our results are largely but weakly sister to Stanhopeinae in agreement with
congruent with our previous study (Whitten et al. Whitten et al. (2000).
2005) based on matK/trnL-F/ITS data, although Stanhopeinae — (Fig. 3). Although the circumscription
there is less support for many genera. The non- of generic boundaries within this subtribe are highly
monophyly of Warczewiczella is unusual, and might congruent with morphology-based classifications, this
be due to mislabeled DNA samples; resampling subtribe has the lowest BS support (87%). The odd
with new collections is needed. Relationships within monotypic Braemia vittata (Lindl.) Jenny is sister to
Dichaea were clarified by Neubig et al. (2009b). all other genera. These data are highly congruent with
Subtribe Vargasiellinae consists of one genus with the trees of Whitten et al. (2000), but the placement
two poorly collected species, one from the tepuis of of Sievekingia requires more study. In the Whitten
Venezuela and the other from eastern Peru. We were et al. (2000) analyses based upon matK/trnL-F/
unable to obtain DNA of these taxa. Dressler (1993) nrITS, Sievekingia is strongly sister to Coryanthes.
included Vargasiella C.Schweinf. in Zygopetalinae but In the plastid matK/ycf1 trees, the single sample of
suggested it might warrant subtribal status. Romero- Sievekingia is sister to the multiflowered clade of
González and Carnevali (1993) validated the subtribal Stanhopea (creating a paraphyletic Stanhopea). More
name and suggested that it should remain in its own extensive sampling with nuclear and plastid regions is
subtribe pending better specimens and molecular needed to resolve this, because it appears to be one of
data. Recent collections and DNA sequences of the few instances of conflict between nrITS and plastid
Vargasiella peruviana C.Schweinf. place it with high trees in Cymbidieae. One possible source of error
support in Zygopetalinae in an unresolved clade with within the Stanhopea/Coryanthes/Sievekingia clade is
Warrea warreana (Lodd. ex Lindl.) C.Schweinf. from missing data in ycf1 for Coryanthes; the 3720F
and Warreopsis spp. (Szlachetko et al., in press; M. primer did not amplify for Coryanthes; consequently,
Kolanowska, pers. comm.). Vargasiella is sister to about half of the ycf1 sequence data are missing for
Warrea but with weak support. These data confirm Coryanthes species.
Dressler’s intuition (Dressler 1993) regarding its
Maxillariinae — (Figs. 4, 5). Relationships within
subtribal position; therefore, Vargasiellinae should not
Maxillariinae were addressed in greater detail by
be recognized.
Whitten et al. (2007), Blanco et al. (2007; 2008), and
Coeliopsidinae — (Fig. 3). Our sampling included Blanco (2013) based upon a larger taxon sampling
one species of each of the three genera comprising of matK/nrITS1&2/atpB-rbcL spacer. Our sampling
this small subtribe. The subtribe is highly supported with matK/ycf1 was smaller (119 taxa vs. over 600),
100
Maxillariinae (Fig. 4 & 5)
87
Stanhopeinae (Fig. 3)
100
100
Coeliopsidinae (Fig. 3)
100
Zygopetalinae (Fig. 2)
100
Eriopsidinae (Fig. 2)
97 Polyotidium huebneri
90 Trizeuxis falcata
84 Comparettia macroplectron
75 Comparettia falcata
100 Tolumnia gundlachii
Tolumnia pulchella
Notyliopsis beatricis
Miltonia regnellii
Cischweinfia pusilla
89 Brassia jipijapensis
Brassia aurantiaca
100 Otoglossum globuliferum 1
Otoglossum globuliferum 2
100 Cyrtochilum serratum
96 Oncidium weinmannianum
100 Oncidium cirrhosum
Oncidium sphacelatum
Oncidiinae
Erycina pusilla
100 Trichocentrum jonesianum
Trichocentrum luridum
Grandiphyllum robustissimum
100 Ornithocephalus dalstroemii 1
98 Ornithocephalus dalstroemii 2
100
Ornithocephalus inflexus
100 Hintonella mexicana
100
Chytroglossa marileoniae
98 Dipteranthus grandiflorus
90 Fernandezia sanguinea
100 Fernandezia cuencae
95 99 Fernandezia tica
100 Telipogon pognonostalix
100 Telipogon hystrix
100 100 Telipogon parvulus
100
Trichoceros antennifer
Lockhartia amoena
Rossioglossum krameri
100 Psychopsiella limminghei
Psychopsis sanderae
Cyrtopodium flavum
100 Cyrtopodium andersonii Cyrtopodiinae
Cyrtopodium longibulbosum
96 Cycnoches lehmannii
100 Cycnoches pachydactylon
Catasetinae
100 Cycnoches cooperi

100 Cycnoches manoelae
Dressleria dilecta
82 100 Dressleria helleri
Dressleria fragrans
100 100 Catasetum expansum
Clowesia dodsoniana
Galeandra devoniana
100 Eulophia petersii
100 Eulophia guineensis
Oeceoclades maculata Eulophiinae
Cymbidium devonianum Cymbidiinae
Polystachya cultriformis
0.02
Figure 1. Best ML tree with bootstrap values added, showing Cymbidiinae, Eulophiinae, Catasetinae, Cyrtopodiinae, and
Oncidiinae.
but the two data sets recovered the same major clades, beckendorfii Carnevali and Maxillaria cacaoensis
supporting the generic concepts presented by Blanco J.T.Atwood. Cryptocentrum beckendorfii, an anoma-
et al. (2007). Our sampling included two individuals lous species with large pseudobulbs, is placed within
of several species; in each pair, there are nucleotide Cryptocentrum with 100% BS support (Fig. 5).
differences separating the two, indicating that ycf1/ Maxillaria cacaoensis was hypothesized by Atwood
matK is often capable of resolving not only closely to be a member of the Camaridium cucullatum
related species but also intraspecific variation. (Lindl.) M.A.Blanco clade (=Psittacoglossum
Several taxa not present in the 2007 sampling were La Llave & Lex., but DNA samples of this rare
added to this study. These include Cryptocentrum taxon became available only recently. Maxillaria
386 LANKESTERIANA
100
87
100
Stenotyla lankesteriana
Stenotyla picta
Stenotyla lendyana
Cochleanthes flabelliformis
Warczewiczella discolor
Warczewiczella marginata
Chaubardiella subquadrata
Chaubardiella pubescens
Chaubardiella tigrina
Ixyophora viridisepala
Chondroscaphe laevis
Chondroscaphe eburnea
Chondroscaphe flaveola
Chondroscaphe amabilis
Aetheorhyncha andreetae
Pescatoria lamellosa
Pescatoria coronaria
89 Pescatoria cerina
Pescatoria lawrenciana
84 Pescatoria lehmannii
Pescatoria pulvinaris
Warczewiczella wailesiana
Chondrorhyncha rosea
99 Chondrorhyncha hirtzii 1
Chondrorhyncha hirtzii 2
Stenia calceolaris
Stenia bismarkii
Zygopetalinae
Benzingia hajekii
Benzingia cornuta
100
Benzingia estradae
Benzingia reichenbachiana
Daiotyla albicans
Kefersteinia maculosa
Kefersteinia trullata
98
Kefersteinia excentrica
Kefersteinia microcharis
100 Chaubardia klugii
85 Chaubardia surinamensis
Huntleya wallisii
Dichaea eligulata
96 Dichaea trulla
100 Dichaea fragrantissima
Dichaea panamensis
100 Cryptarrhena lunata
Cryptarrhena guatemalensis
Batemannia lepida
Galeottia ciliata
100 Galeottia burkei
Galeottia colombiana
89 100 Neogardneria murrayana
Zygopetalum maxillare
Zygosepalum tatei
100 100 Aganisia pulchella
Koellensteinia graminea
Aganisia fimbriata
100 Promenaea stapelioides
Promenaea xanthina
100 Otostylis lepida
Otostylis paludosa
Warrea warreana
Eriopsis biloba 1
100 Eriopsis biloba 2 Eriopsidinae
Eriopsis biloba 3
100
Oncidiinae (Fig. 1)
100
100
Cyrtopodiinae (Fig. 1)
100
Catasetinae (Fig. 1)
100
Eulophiinae (Fig. 1)
Cymbidiinae (Fig. 1)
0.02
Figure 2. Best ML tree with bootstrap values added, showing Eriopsidinae and Zygopetalinae.

100
100 Acineta chrysantha
100 Acineta superba
99 Vasqueziella boliviana
95
Lueddemannia pescatorei
Lacaena spectabilis
Lueckelia breviloba
94 87 Soterosanthus shepheardii
Kegeliella atropilosa
96 Kegeliella kupperi
Polycycnis gratiosa 1
Houlletia brocklehurstiana
Houlletia odoratissima
Houlletia sanderi
Houlletia tigrina
100 Schlimmia alpina
100 Schlimmia stevensonii
100 Trevoria zahlbruckneriana
Horichia dressleri
100 Paphinia clausula
100
Paphinia neudeckeri
Stanhopeinae
Stanhopea pulla
Stanhopea annulata
100 Stanhopea ecornuta
97
Stanhopea cirrhata
Stanhopea tigrina
98 Stanhopea confusa
Stanhopea anfracta
100 Sievekingia reichenbachiana
Coryanthes verrucolineata
100 Coryanthes macrantha
78 Coryanthes elegantium
78 100 Embreea herrenhusana
Embreea rodigasiana
Gongora tridentata
Gongora seideliana
90 Gongora armeniaca 1
Gongora armeniaca 2
100 Gongora amparoana
87 Gongora hirtzii
100 Gongora sphaerica
100
Gongora ilense
Gongora portentosa 1
100 100 Gongora portentosa 2
Gongora escobariana
100 Cirrhaea seidelii
Cirrhaea fuscolutea
Braemia vittata
Coeliopsis hyacinthosma
100 Lycomormium fiskei Coeliopsidinae
Peristeria elata
100
100
100 Eriopsidinae (Fig. 2)
100
Oncidiinae (Fig. 1)
100
100
100
100
0.02
Figure 3. Best ML tree with bootstrap values added, showing Coeliopsidinae and Stanhopeinae.
cacaoensis is sister to C. cucullatum in our ycf1/ C. cucullatum, and the capsule has apical dehiscence,
matK trees (Fig. 5), and requires a new combination a trait shared by all Camaridium species for which
in Camaridium. It was erroneously transferred to we have observed mature fruits. Based upon these
Mapinguari Carnevali & R.B.Singer by Szlachetko molecular and morphological data, we transfer this
et al. (2012). Morphologically, it resembles a dwarf species to Camaridium.
388 LANKESTERIANA
100
remainder of Maxillariinae (Fig. 5)
100 100
Ornithidium coccineum
98 Ornithidium donaldeedodii
Ornithidium multicaule
Ornithidium giganteum
77 Ornithidium serrulatum
Ornithidium canarensis
Ornithidium aggregatum
Ornithidium fulgens
Ornithidium sophronitis
99 100 Heterotaxis maleolens
Heterotaxis violaceopunctata
Heterotaxis valenzuelana
Maxillariinae (in part)

Nitidobulbon nasutum
Nitidobulbon proboscideum
100 Heterotaxis crassifolia
94 Heterotaxis equitans
Heterotaxis santanae
Guanchezia maguirei
100 Xylobium zarumense
100 Xylobium pallidiflorum
Xylobium leontoglossum
Neomoorea wallisii
100 Anguloa uniflora
100 99 Anguloa hohenlohii
Sudamerlycaste fimbriata
90 Lycaste aromatica
Bifrenaria inodora
100 Bifrenaria tyrianthina
Bifrenaria tetragona
Hylaeorchis petiolaris
Scuticaria salesiana
100 100 Rudolfiella sp.
Rudolfiella saxicola
Scuticaria hadwenii
87
100
100
100
100
Oncidiinae (Fig. 1)
100
100
100
100
0.02
Figure 4. Best ML tree with bootstrap values added, showing basal portion of Maxillariinae.
Camaridium cacaoense (J.T.Atwood) Whitten, comb. classification was based on analyses of a 249-taxon
nov. nrITS matrix that is largely congruent (though less

resolved) than the Whitten et al. trees. The resulting
Basionym: Maxillaria cacaoensis J.T.Atwood,
Szlachetko classification accepts most of the genera
Selbyana 19(2):254. 1999 (1998, pub. 1999).
proposed by Blanco et al. (2007) but splits many of
Mapinguari cacaoense (J.T.Atwood) Szlach. & Sitko,
them to increase the number of genera from 17 to 37.
Biodiv. Res. Conservation 25:30. 2012, syn. nov.
A detailed, genus-by-genus critique of the
The Whitten et al. (2007) and Blanco et al. (2007) Szlachetko et al. (2012) classification falls outside
classifications of Maxillariinae were based upon the scope of this paper, but we reject the generic
analyses of nrITS/matK+trnK/atpB-rbcL spacer for concepts presented in their paper. Szlachetko and
over 600 individuals. An alternative classification was coworkers reject monophyly as a criterion for generic
published by Szlachetko et al. (2012). The Szlachetko rank; therefore, many of their genera are paraphyletic
100
100 Acineta chrysantha
100 Acineta superba
99 Vasqueziella boliviana
95
Lueddemannia pescatorei
Lacaena spectabilis
Lueckelia breviloba
94 87 Soterosanthus shepheardii
Kegeliella atropilosa
96 Kegeliella kupperi
Houlletia brocklehurstiana
Houlletia odoratissima
Houlletia sanderi
Houlletia tigrina
100 Schlimmia alpina
100 Schlimmia stevensonii
100 Trevoria zahlbruckneriana
Horichia dressleri
100 Paphinia clausula
100
Paphinia neudeckeri
Stanhopeinae
Stanhopea pulla
Stanhopea annulata
100 Stanhopea ecornuta
97
Stanhopea cirrhata
Stanhopea tigrina
98 Stanhopea confusa
Stanhopea anfracta
100 Sievekingia reichenbachiana
Coryanthes verrucolineata
100 Coryanthes macrantha
78 Coryanthes elegantium
78 100 Embreea herrenhusana
Embreea rodigasiana
Gongora tridentata
Gongora seideliana
90 Gongora armeniaca 1
Gongora armeniaca 2
100 Gongora amparoana
87 Gongora hirtzii
100 Gongora sphaerica
100
Gongora ilense
Gongora portentosa 1
100 100 Gongora portentosa 2
Gongora escobariana
100 Cirrhaea seidelii
Cirrhaea fuscolutea
Braemia vittata
Coeliopsis hyacinthosma
100 Lycomormium fiskei Coeliopsidinae
Peristeria elata
100
100
100
Oncidiinae (Fig. 1)
100
100
100
100
0.02
Figure 5. Best ML tree with bootstrap values added, showing remainder of Maxillariinae.
or polyphyletic as plotted onto any molecular or Many of their new genera consist of one
morphological tree and are based on idiosyncratically or two morphologically odd species embedded
selected morphological characters (floral and/or within larger genera [e.g., Marsupiaria Hoehne
vegetative), often without molecular data or with = Heterotaxis valenzuelana (A.Rich.) Ojeda &
contradicting molecular evidence. Carnevali; Vazquezella Szlach. & Sitko = Heterotaxis
390 LANKESTERIANA
equitans (Schltr.) Ojeda & Carnevali; Chrysocycnis fail to provide resolution and support of relationships
Linden & Rchb.f., Anthosiphon Schltr., Hoehnella among subtribes.
Szlach. & Sitko = Rhetinantha witseniodes (Schltr.) Givnish et al. (2013) recently utilized complete
M.A.Blanco; Pseudocymbidium Szlach. & Sitko = plastomes to estimate phylogenetic relationships
Maxillaria lueri Dodson]. Other genera are composed among 39 orchid taxa. Although only a few subtribes
of 15 or more species that are monophyletic but of Cymbidieae were represented in their data set,
are embedded within other genera (e.g. Calawaya subtribal relationships were still unresolved. Their
Szlach. & Sitko, embedded in Maxillaria Ruiz & results imply that the addition of more plastid genes
Pav.). Camaridium Lindl. is split into at least eight with the objective of resolving these nodes may be
genera. Some segregates (e.g., Chaseopsis Szlach. futile and that these relationships will only be resolved
& Sitko) are based solely upon morphological by the addition of nuclear data sets. Clearly, much
traits and include species that were not included in more data are needed before we fully understand the
either molecular study [e.g., Camaridium burgeri patterns of evolution within Cymbidieae.
(J.T.Atwood) M.A.Blanco]. Their circumscription of We hope to add more representatives of
Chaseopsis omits taxa that are sister to the generitype Cymbidiinae, Eulophiinae, and Catasetinae.
in the molecular trees but lack the defining essential Catasetinae might provide an excellent system for
study of the evolution of diverse floral reward systems;
“generic” characters (e.g., Maxillaria flava Ames,
it includes five genera that are all androeuglossophilous
F.T.Hubb. & C.Schweinf. = Camaridium ramonense
fragrance-reward flowers (Catasetum, Cycnoches,
(Schltr.) M.A.Blanco; Maxillaria lankesteri Ames =
Clowesia, Dressleria, Mormodes); these five genera
Camaridium aurantiacum (Schltr.) M.A.Blanco). The
are sister to Galeandra, with nectar deceit flowers, to
Szlachetko et al. classification produces genera that
Grobya, with oil-reward flowers (Pansarin et al., 2009),
are easily suited to production of dichotomous keys,
and to Cyanaeorchis, with unknown pollinators.
because any morphologically anomalous species are
Previous attempts to utilize molecular clock
automatically placed into another genus. Because
methods to estimate the age of subtribes within
there is no objective basis for selecting “critical”
Cymbidieae (Ramírez et al. 2011) utilized more
characters that define genera, their classification is
limited taxon sampling that was biased towards
without merit.
androeuglossophilous taxa. Our more complete
sampling of generic relationships based on more
Conclusions
sequence data might warrant reexamination of these
The matK/ycf1 data produce trees that are highly age estimates.
congruent with the classification presented in volume
5 Genera Orchidacearum. Most subtribes have Acknowledgments. We thank Günter Gerlach (Munich
high bootstrap support, and generic relationships Botanical Garden), Ron Determann, Becky Brinkman
are congruent with previous molecular studies. In (Atlanta Botanical Garden), Gustavo Romero (AMES),
comparison to plastid intron/spacer regions (e.g., Andy and Harry Phillips (Andy’s Orchids) and the Portilla
trnL-F, atpB-rbcL), these coding regions can be family (Ecuagenera) for generous access and help in
aligned with much more confidence across larger obtaining specimens and vouchers. Lorena Endara provided
taxonomic groups (e.g., tribes), especially if they valuable assistance in Ecuador, and Mario Blanco and
are aligned using amino acid translations. This Robert Dressler (Lankester Garden) provided specimens
combination also appears capable of providing and valuable discussions. Kent Perkins was invaluable in
species-level discrimination in some genera, accessioning and imaging specimens. Marta Kolanowska
although more detailed sampling is needed to generously shared unpublished information on the
evaluate this fully. In terms of sequencing ease and placement of Vargasiella. Alec Pridgeon provided valuable
cost effectiveness vs. phylogenetic resolution, the criticisms and edits. We thank Savita Shanker and Patrick
combination of matK/ycf1/nrITS may prove efficient Thimote at the Interdisciplinary Center for Biotechnology
within Orchidaceae. Nevertheless, these plastid trees Research at UF for DNA sequencing services.

Literature cited
Batista, J.A. N.,A. C. M. Mota, K. Proite, L. de Bem Bianchetti, Phylogenetics and Evolution 56:784-795.
G. A. Romero-Gonzalez, H. Huerta, and G. Salazar. Koehler, S., N. H. Williams, W. M. Whitten, and M. D.
In press. Molecular phylogenetics of Cyanaeorchis E. do Amaral. 2002. Phylogeny of the Bifrenaria
(Cymbidieae, Epidendroideae,Orchidaceae) and a new (Orchidaceae) complex based on morphology and
species from the cerrado of central and southeastern sequence data from nuclear rDNA internal transcribed
Brazil. Phytotaxa. spacers (ITS) and chloroplast trnL-trnF region.
Blanco, M., G. Carnevali, W. M. Whitten, R. B. Singer, S. International Journal of Plant Sciences 163:1055-1066.
Koehler, N. H. Williams, I. Ojeda, K. Neubig, and L. Monteiro, S. H. N., A. Selbach-Schnadelbach, R. P. d.
Endara. 2007. Generic realignments in Maxillariinae Oliveira, and C. van den Berg. 2010. Molecular
(Orchidaceae). Lankesteriana 7:515-537. phylogenetics of Galeandra (Orchidaceae: Catasetinae)
Blanco, M. A. 2013. New combinations and synonyms in based on plastid and nuclear DNA Sequences.
the Maxillariiinae (Orchidaceae). Selbyana 31:52-59. Systematic Botany 35:476-486.
Blanco, M. A., G. Carnevali, W. M. Whitten, R. B. Singer, Neubig, K. M., W. M. Whitten, B. S. Carlsward, M. A.
S. Koehler, N. H. Williams, I. Ojeda, K. M. Neubig, and Blanco, L. Endara, N. H. Williams, and M. Moore.
L. Endara. 2008. Generic realignments in Maxillariinae 2009a. Phylogenetic utility of ycf1 in orchids: a plastid
(Orchidaceae): Corrigenda et addenda. Lankesteriana gene more variable than matK. Plant Systematics and
8:15. Evolution 277:75-84.
Chase, M. W., K. M. Cameron, R. L. Barrett, and J. V. Neubig, K. M., W. M. Whitten, N. H. Williams, M. A. Blanco,
Freudenstein. 2003. DNA data and Orchidaceae L. Endara, J. G. Burleigh, K. Silvera, J. C. Cushman,
systematics: a new phylogenetic classification. Pages and M. W. Chase. 2012. Generic recircumscriptions
69–89 in Orchid Conservation (K. W. Dixon, S. P. Kell, of Oncidiinae (Orchidaceae: Cymbidieae) based on
R. L. Barrett, and P. J. Cribb, eds.). Natural History maximum likelihood analysis of combined DNA
Publications, Kota Kinabalu, Sabah, Malaysia. datasets. Botanical Journal of the Linnean Society
Dressler, R. L. 1981. The Orchids: Natural History and 168:117-146.
Classification. Harvard University Press, Cambridge, Neubig, K. M., N. H. Williams, W. M. Whitten, and F.
Massachusetts, USA. Pupulin. 2009b. Molecular phylogenetics and the
Dressler, R. L. 1993. Phylogeny and Classification of the evolution of fruit and leaf morphology of Dichaea
Orchid Family. Dioscorides Press, Portland, Oregon, (Orchidaceae: Zygopetalinae). Annals of Botany
USA. 104:457-467.
Edgar, R. 2004. MUSCLE: a multiple sequence alignment Pansarin, L. M., M. D. Castro, and M. Sazima. 2009.
method with reduced time and space complexity. Osmophore and elaiophores of Grobya amherstiae
doi:10.1186/1471-2105-5-113. BMC Bioinformatics 5: (Catasetinae, Orchidaceae) and their relation to
113. pollination. Botanical Journal of the Linnean Society
Freudenstein, J. V., C. van den Berg, D. H. Goldman, P. 159:408-415.
J. Kores, M. Molvray, and M. W. Chase. 2004. An Pridgeon, A. M., and M. W. Chase. 1998. Phylogenetics
expanded plastid DNA phylogeny of Orchidaceae and of subtribe Catasetinae (Orchidaceae) from nuclear
analysis of jackknife branch support strategy. American and chloroplast DNA sequences. Pages pp. 275-281
Journal of Botany 91:149-157. in Proceedings of the 15th World Orchid Conference
Givnish, T. J., M. Ames, S. P. Lyon, K. M. Cameron, K. (C. E. de Britto Pereira, ed.) Naturalia Publications,
M. Neubig, W. M. Whitten, M. K. Arroyo, J. Leebens- Turriers, France.
Mack, M. A. Clemets, and N. H. Williams. Year. The Pridgeon, A. M., P.J. Cribb, M. W. Chase, and F.N.
39 Steps: A plastome phylogeny for orchid tribes, with Rasmussen. 2009. Genera Orchidacearum Volume 5
implications for the evolution of epiphytism, CAM Epidendroideae (Part Two). Oxford University Press,
photosynthesis, and net rates of species diversification Inc., New York.
in Monocots V: 5th International Conference on Rambaut, A. 1996. Se-Al: Sequence Alignment Editor.
Comparative Biology of Monocotyledons, New York Available at http://evolve.zoo.ox.ac.uk/.
Botanical Gardens:48-49. Rambaut, A. 2013. FigTree, version 1.4.0.
Górniak, M., O. Paun, and M. W. Chase. 2010. Phylogenetic Ramírez, S. R., T. Eltz, M. K. Fujiwara, G. Gerlach, B.
relationships within Orchidaceae based on a low-copy Goldman-Huertas, N. D. Tsutsui, and N. E. Pierce.
nuclear coding gene, Xdh: Congruence with organellar 2011. Asynchronous diversification in a specialized
and nuclear ribosomal DNA results. Molecular plant-pollinator mutualism. Science 333:1742-1746.

392 LANKESTERIANA
Reis, M. G., A. D. de Faria, V. Bittrich, M. D. E. Amaral, Floristica et Geobotanica. Supplementum 3. W. Szafer

and A. J. Marsaioli. 2000. The chemistry of flower Institute of Botany, Polish Academy of Sciences,
rewards - Oncidium (Orchidaceae). Journal Of The Kraków, Poland.
Brazilian Chemical Society 11:600-608. Szlachetko, D. L., M. Górniak, M. Kolanowska, J. Mytnik-
Romero-Gonzalez, G. A., and G. Carnevali. 1993. Ejsmont, A. K. Kowalkowska, and T. Koliński. in
Reappraisal of subtribe Vargasiellinae (Maxillarieae, press. Taxonomic position of the genus Vargasiella
Orchidaceae). Novon 3:79-80. (Orchidaceae, Vandoideae) based on molecular and
Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. morphological evidence. Molecular Phylogenetics and
Miller, K. C. Siripun, C. T. Winder, E. E. Schilling, and Evolution.
R. L. Small. 2005. The tortoise and the hare II: relative Whitten, M. W., N. H. Williams, R. L. Dressler, G.
utility of 21 noncoding chloroplast DNA sequences for Gerlach, and F. Pupulin. 2005. Generic relationships of
phylogenetic analysis. Am. J. Bot. 92:142-166. Zygopetalinae (Orchidaceae: Cymbideae): Combined
Stamatakis, A. 2006. RAxML-VI-HPC: maximum molecular evidence. Lankesteriana 5:87-107.
likelihood-based phylogenetic analyses with thousands Whitten, W. M., M. A. Blanco, N. H. Williams, S. Koehler,
of taxa and mixed models. Bioinformatics 22:2688- G. Carnevali, R. B. Singer, L. Endara, and K. M.
2690. Neubig. 2007. Molecular phylogenetics of Maxillaria
Swofford, D. L. 2003. PAUP*: Phylogenetic Analysis and related genera (Orchidaceae: Cymbidieae) based
Using Parsimony (*and other methods), version 4.0b10. on combined molecular data sets. American Journal of
Sinauer. Botany 94:1860-1889.
Szlachetko, D., M. Sitko, PTukallo, and J. Mytnik- Whitten, W. M., N. H. Williams, and M. W. Chase. 2000.
Ejsmont. 2012. Taxonomy of the subtribe Maxillariinae Subtribal and generic relationship of Maxillarieae
(Orchidaceae, Vandoideae) revised. Biodiversity (Orchidaceae) with emphasis on Stanhopeinae:
Research and Conservation 25:13-38. combined molecular evidence. American Journal of
Szlachetko, D. L. 1995. Systema Orchidalium, Fragmenta Botany 87:1842-1856.

LANKESTERIANA 13(3) — January 2014
R E G U LAR PAP E R S
LANKESTERIANA 13(3): 395—399. 2014.
A NEW LARGE-FLOWERED ODONTOGLOSSUM (ORCHIDACEAE:

ONCIDIINAE) FROM THE CUSCO REGION IN PERU
Stig Dalström1,3 & Saul Ruíz Pérez2

1
2304 Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A.
2
Allamanda 142, Surco, Lima 33, Peru
3
Corresponding author: stigdalstrom@juno.com
Abstract. Plants of a colorful Odontoglossum were recently found by separate parties in the Cusco region of
central Peru. The species was incorrectly identified as Odontoglossum epidendroides, independently by both
parties. Although similar in appearance, a closer examination of the flower reveals that it represents a new
species, which is scientifically described here and compared with similar species. The new taxon is distinguished
from the similar O. cruentum and O. juninense by morphological features of the column, such as the lateral
curvature profile, with larger and more rectangular wings, and in combination with the well developed falcate
callus structure on the lip. Our new species is also distinguished from the rather similar O. epidendroides by
having flowers with a shorter column with shorter wings.
Key words: Orchidaceae, Oncidiinae, Odontoglossum, new species, Cusco, Peru, taxonomy
The genus Odontoglossum Kunth (treated by some 10–11 mm long versus 13– 14 mm), and differently
authors as Oncidium), has revealed miscellaneous curved column with shorter wings. It differs from
new species in recent time. Some are rather similar O. cruentum Rchb.f., (Figs. 2B, 2B1, 2B2, 6), and
to closely related taxa while others show surprisingly O. juninense Schltr. (Figs. 2D, 2D1, 2D2, 7), by a
distinct morphologic features, such as the floristically different lateral curvature profile of the column, with
diminutive Oncidium koechlinianum Collantes broader and more rectangular column wings as well as
& G.Gerlach (2011), which was transferred to a less lobulate anther-cap.
Odontoglossum by Dalström (2012a, where valid
reasons for maintaining the taxonomic status of the Epiphytic herb. Pseudobulbs caespitose, ancipi-
genus is argued and outlined). Recent fieldwork tous, ovoid to pyriform, glossy, bifoliate, 4–5 × 7–8
performed by the authors and others also show that cm, surrounded basally by 5 to 7 distichous sheaths,
some previously lumped or misidentified taxa deserve the uppermost foliaceous. Leaves subpetiolate,
an elevated taxonomic status, such as Odontoglossum conduplicate, elongate elliptic to slightly obovate,
furcatum Dalström (2012b), and the species published acuminate 27–31 × 2.5–3.0 cm. Inflorescences
here. axillary from the uppermost sheaths, erect to arching,
weakly fractiflex 12- to 15-flowered racemes, or
Odontoglossum auroincarum Dalström & Ruíz- up to 25-flowered widely branched panicles (old
Pérez, sp. nov. inflorescences on type specimen). Pedicel with ovary
2.0 – 2.5 cm long. Floral bracts appressed, scale-
TYPE: Peru. Cusco. Alfamayo, ca. 2600 m, S 13°
like to ca. 1 cm long. Flower relatively large and
03.647’; W 72° 24.351’, Dec. 3, 2011. S. Dalström
showy, stellate; dorsal sepal dark yellow with large
3594 (holotype, USM). Figs. 1, 2A, 2A1, 2A2, 3, 4).
irregular red-brown spotting, cuneate, ovate laminate,
Diagnosis: Odontoglossum auroincarum is similar to acuminate and slightly oblique, ca. 35 × 10–11 mm;
O. epidendroides Kunth (Figs. 2E, 2E1, 2E2, 5), but lateral sepals similar in color, slightly unguiculate,
differs from it by having flowers with a shorter (ca. ovate laminate, acuminate, slightly oblique, ca.
396 LANKESTERIANA
Figure 1. Odontoglossum auroincarum. A — Plant habit. B — Column and lip, lateral view. C — Lip, frontal view. D —
Column, lateral and ventral views. E— Anther cap, dorsal view, and pollinarium, lateral and back views. F — Flower
dissected. Drawn from holotype by Stig Dalström.

Dalström & Ruíz Pérez - A new Odontoglossum from the Cusco region 397
Figure 2. A. Odontoglossum auroincarum, (S. Dalström 3594, USM), column lateral view. A1. Anther cap dorsal view.
A2. Pollinarium lateral and back views. B. Odontoglossum cruentum (S. Dalström 481, SEL), column lateral view. B1.
Anther cap dorsal view. B2 Pollinarium lateral and back views. C. Odontoglossum subuligerum (S. Dalström 3611,
USM), column lateral view. C1. Anther cap dorsal view. C2. Pollinarium lateral and back views. D. Odontoglossum
juninense (S. Dalström 2378, Dalström archives), column lateral view. D1. Anther cap dorsal view. D2. Pollinarium
lateral and back views. E. Odontoglossum epidendroides (S. Dalström 3282, USM), column lateral view. E1. Anther
cap dorsal view. E2. Pollinarium lateral and back views. Drawn by Stig Dalström.

398 LANKESTERIANA
Figure 3. Odontoglossum auroincarum, plant habit. Photo Figure 4. Odontoglossum auroincarum, flower in close-up.
by Stig Dalström. Photo by Stig Dalström.
33 × 10–11 mm; petals similar in color, broadly “Orquideas en Inkaterra Machu Picchu Pueblo Hotel”
unguiculate, ovate laminate, acuminate, oblique, ca. (Collantes et al. 2007).
27 × 8–10 mm; lip similar in color, adnate to the basal
Distribution: Known only from the cloud forests of
and lateral flanks of the column for ca. 2.0–2.5 mm,
Alfamayo, and from the Machu Picchu sanctuary in
then free and strap-like for ca. 1 mm, apical portion
the Urubamba region of Cusco, central Peru.
angled downwards into a large, pandurate lamina,
with serrate to lacerate frontlobes, and a folded, Etymology: The name refers to the golden yellow
canaliculate, apiculate apex, ca. 17–18 × 7–8 mm; color of the flowers of this species and is a tribute to
callus white, of a fleshy, basally minutely pubescent, ‘botanical Inca gold’, which comes from the area in
central, longitudinal, flattened keel, emerging from Peru that once was the center of the powerful Inca
the base to ca. one third of the length of the lamina, culture.
terminating in a shallowly canaliculate, raised ridge,
The first plants of Odontoglossum auroincarum
ending with several pairs of acute, projecting angles,
were collected within the borders of the Machu
with a larger, erect, irregular, denticulate knob, and 3
Picchu sanctuary by the staff of the INKATERRA
to 4 pairs of lateral, falcate, variously sized spreading
hotel. Plants were replanted in the orchid garden of
keels; column pale greenish white with some minor
the hotel and flowered there. Photos of the flowers
brown ventral dots, erect and straight for ca. 2/3
were then taken by Benjamín Collantes and published,
of its length, then curved towards the lip, ventrally
labeled “Odontoglossum epidendroides” (Collantes
canaliculate, basally micro-pubescent, with distinct
et al. 2007). A few years later, plants were found
ventral angles below the stigma, which is covered
in the Alfamayo region by the second author of this
laterally by a pair of almost rectangular, serrate
paper, and brought into cultivation for propagation.
wings, ca. 10–11 mm long; anther cap pale yellow,
When the plants flowered they were still believed to
campanulate, rostrate, with a minute and low apical
be O. epidendroides, but with some question marks.
lobule; pollinarium of two pyriform, cleft/folded
Eventually a detailed drawing of the flower could
pollinia on a yellow colored, almost rectangular,
be made, which was compared with drawings of
ca. 1.8 mm long stipe, on a hooked and pulvinate
similar species. The conclusion was that a new and
viscidium.
attractive species had been discovered. Although
Other material studied: Peru. Cusco, Urubamba, superficially and rather confusingly similar to several
Machu Picchu, collected in the Machu Picchu Sanctuary other yellow flowered species, the morphological
and cultivated in the garden of the Inkaterra Machu features of the column and lip structure as well as the
Picchu Pueblo Hotel, photo by Benjamín Collantes in anther and pollinarium are quite distinct and display
Dalström & Ruíz Pérez - A new Odontoglossum from the Cusco region 399
Figure 5. Odontoglossum epidendroides, flower in close-up. Figure 6. Odontoglossum cruentum, flower in close-up.
Photo by Stig Dalström. Photo by Stig Dalström.
Figure 7. Odontoglossum juninense, flower in close-up.

Photo by Stig Dalström.
a combination of characteristics that create a unique

species profile. The only sympatric Odontoglossum
species of this particular complex with a flexible lip
is O. subuligerum Rchb.f. (Figs. 2C, 2C1, 2C2, 8) Figure 8. Odontoglossum subuligerum, Chapare, Bolivia,
flowers close-up. Photo by Jan Sönnemark.
which is easily distinguished by the large knob on the
anther cap and by the extremely narrow pollinarium Literature cited
stipe. Collantes, B., C. Soto & J. Koechlin. 2007. Orchids
Orquídeas en Inkaterra Machu Picchu Pueblo Hotel.
Acknowledgements. The authors wish to thank the Inkaterra Asociación, Lima, Perú.
staff at the Instituto Recursos Naturales (INRENA), and Collantes, B. & G. Gerlach. 2011. Über zwei neue Orchideen
Betty Millán at the Universidad de San Marcos, Museo aus Machu Picchu (Peru) aus der Subtribus Oncidiinae.
de Historia Natural, Lima, for aiding in providing the OrchideenJournal (2): 79-81.
necessary collecting permits. We also thank Wesley Dalström, S. 2012a. New combinations in Odontoglossum
Higgins for commenting on the manuscript, Steve (Orchidaceae: Oncidiinae) and a solution to a taxonomic
Beckendorf, Guido and Karel Deburghgraeve for conundrum. Lankesteriana 12(1): 53–60.
stimulating company in the field, and Manolo Arias Dalström, S. 2012b. A well-known but previously
together with his staff and family in Lima for gracious misidentified Odontoglossum (Orchidaceae: Oncidii-
logistic support. nae) from Ecuador. Lankesteriana 12(3): 155–160.

LANKESTERIANA
LANKESTERIANA 13(3): 401—405. 2014.
A NEW AND STRIKING ODONTOGLOSSUM

(ORCHIDACEAE: ONCIDIINAE) FROM PERU
Stig Dalström1,3 & Saul Ruíz Pérez2

1
2304 Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A.
2
Allamanda 142, Surco, Lima 33, Peru
3
Corresponding author: stigdalstrom@juno.com
Abstract. A new species of Odontoglossum with an extraordinary long column and filamentose lip callus is
described, illustrated with a photograph and a line drawing, and compared with similar and presumably closely
related species, such as O. epidendroides and O. juninense. The new species belongs to the Odontoglossum
complex with a flexible lip-base attachment, but differs from all other species in that complex primarily by the
elongate base of the column, below the attachment of the strap-like lip-base.
Key words: Oncidiinae, Odontoglossum, new species, Pasco, Peru, taxonomy
In the accompanying text to the plate of been heard in subsequent discussions, is not really true
Odontoglossum wattianum Rolfe, which was published once you become more familiar with these plants.
in Reichenbachia (Sander 1892), we can read: “It is a The first author of the present paper has outlined
great thing now-a-days to be able to introduce species an alternative taxonomic treatment (Dalström 2012a),
of Odontoglossums absolutely new to science. Years which explains why keeping a slightly enlarged genus
ago, when the wilds of Columbia were more untrodden Odontoglossum is preferable, and also how to separate
than they are now, we found less difficulty, but year by this genus from Oncidium based on a combination
year such prizes get rarer. The time is not far distant of morphological, ecological and geographical
when home skill in hybridization will have to supply characteristics. This is supported by the same
novelties in Odontoglossums.” molecular evidence used by Chase et al. (2009) in
This quote illustrates an often heard opinion about their transfer of Odontoglossum species to Oncidium.
the scarce possibilities of finding new species of Another argument that has been heard in the debate
Odontoglossum (treated as Oncidium by some authors, about how to best treat these orchids is that many new
see below). Even today experienced “orchid hunters” names have to be created for various smaller groups
seem to think that there is not much more to discover of plants if we want to keep Odontoglossum as a valid
when it comes to this attractive genus. But this has been genus. However, the only new names that eventually
proven to be a hasty conclusion thanks to the discovery may have to be created concern two smaller groups of
of several new species in later years (Dalström 1993, species (here referred to as the ‘boothianum clade’ and
1996, 1999, 2010, 2012b, 2013) although in honesty, the ‘chrysomorphum clade’ respectively) that for some
it must be said that Odontoglossum taxonomy needs intriguing reasons are placed near the base of the larger
some special effort to be understood properly. This Odontoglossum clade. In contrast to using this as an
also appears to be one of the main reasons why argument for lumping all concerned taxa into a large
genera Cochlioda Lindl., Odontoglossum Kunth, ‘waste basket’ Oncidium, we believe that this is really
Sigmatostalix Rchb.f. and Solenidiopsis Senghas were a strong reason to do the opposite and further study
transferred to Oncidium (Chase et al. 2008, 2009). This these smaller clades in order to find out why they are
transfer may well have been allowed by molecular placed where they are.
analysis but the argument that few people can separate Morphological analysis of the species in the O.
an Odontoglossum from an Oncidium Sw., which has boothianum and O. chrysomorphum clades show
402 LANKESTERIANA
Figure 1. Odontoglossum filamentosum. A — Plant habit. B — Column and lip lateral view. C — Column lateral and ventral
views. D — Lip dorsal and frontal views. E — Anther cap frontal view, and pollinarium ventral and lateral views. F —
Flower dissected. Drawn from the plant that served as holotype by S. Dalström.
Dalström & Ruíz Pérez - A new Odontoglossum from Peru 403
some interesting and distinctive features, such as plant flowered in cultivation 10 Feb. 2013, G.
the compressed, glossy and often purple-mottled, Deburghgraeve 282 (holotype: W).
unifoliate pseudobulbs, that seem intermediate
Diagnosis: Odontoglossum filamentosum differs from
between some species of Odontoglossum sensu strictu,
the similar O. epidendroides Kunth (Fig. 3), and O.
and species from some ‘Oncidium sensu lato’ clades,
juninense Schltr. (Fig. 4), by the unique combination
particularly the clade that produce aborted flowers
of the elongated column, ca. 1.7 cm long versus ca.
(here referred to as species of Heteranthocidium
1.0–1.1 cm (O. epidendroides), and ca. 1 cm (O.
Szlach., Mytnik & Romowicz, also known as the
juninense) together with the extremely long and
‘Oncidium abortivum group’). Some of the species
filament-shaped callus on the lip, versus much less
in the chrysomorphum clade also produce aborted
devloped and shortly digitate to curved and spinose
flowers occasionally, in addition to displaying
morphological similarities in the pollination apparatus callus teeth for the others.
(column, rostellum and pollinarium shapes primarily) Epiphytic herb. Pseudobulbs caespitose, oblong
to species in the Heteranthocidium complex. Since ovoid, bifoliate, ca. 5– 8 × 2–3 cm, surrounded basally
many Heteranthocidium species grow together and by 6 to 8 distichous sheaths, the uppermost foliaceous.
flower simultaneously with many Odontoglossum Leaves subpetiolate, conduplicate, elongate elliptic to
species, while more ‘typical’ Oncidium species do not, obovate, narrowly acute to shortly acuminate, 19–27
the possibilities of ancient natural hybridization seem × 2.0–3.3 cm. Inflorescences 1 to 3, axillary from the
plausible, which may explain the origin and placement base of the uppermost sheaths, arching to subpendent,
of this clade. Plants in the boothianum clade also show loosely flowered, flexuous, few to many flowered
similar intermediate features and only marginally racemes or loosely paniculate with few basal few-
differ from the chrysomorphum clade. The fact that flowered side-branches, to ca. 60 cm long; bracts
these two smaller groups occur one after the other near 0.5– 1.3 cm long. Pedicel with ovary 2.5–3.5 cm long.
the base of the Odontoglossum clade may perhaps be Flower stellate to slightly campanulate and rather
the result from several occasions of ancient natural arachnoid; dorsal sepal yellow almost covered with
hybridization. These speculations, however, should large brown spots, subunguiculate, elliptic to ovate,
not be taken for anything other than just that at this acuminate, ca. 4.4 × 1.0 cm; lateral sepals similar in
time, but rather than to close the door (and settle the color, slightly obliquely elliptic, narrowly acute, ca.
debate) to a deeper understanding of the evolution of 4.5 × 1.1 cm; petals similar in color but less brown,
these orchids, they should be seen as encouragements obliquely elliptic, acuminate, ca. 3.8–4.0 × 1.0 cm; lip
to further studies. basally pale yellow with a large brown spot covering
Although many Odontoglossum species may most of the lamina, and with a pale yellow to white
appear superficially similar, the one described here
edge, unguiculate, adnate to the base and lateral flanks
does not need any particular effort to be recognized
of the column by a linear ca. 8 mm long claw/unguis,
as new and different. It is characterized by a unique
then free, developing very short, erect sidelobes,
combination of morphologic features such as the
abruptly plicate and laminate, indistinctively cordate,
elongated column together with the extremely long
obovate to oblong pandurate, apical part of lamina more
and irregularly filamentose callus teeth on the lip,
or less concave, erose to fimbriate, apically slightly
which readily set it apart from its closest relatives;
canaliculate or convolute, acuminate, ca. 3.0 – 3.4 × 1.0
O. epidendroides Kunth (Fig. 3), and O. juninense.
cm; callus white, of a low, median, longitudinal, fleshy,
Schltr (Fig 4).
glabrous keel, emerging from the base and extending to
the lamina where it develops into a series of spreading,
Odontoglossum filamentosum Dalström & Ruíz-
more or less falcate, narrowly denticulate to spinose,
Pérez, sp. nov. Figs. 1–3.
or filamentose keels, with a larger, multi-lacerate and
TYPE: Peru. Pasco: Exact locality unknown but filamentose, laterally compressed projecting pair in the
recent observations suggest that the true origin is middle, with a small tooth in between; column basally
somewhere near the town of Oxapampa. The type pale green, then white with some brown marking near
404 LANKESTERIANA
Figure 2. Odontoglossum filamentosum, floral diagram (G. Deburghgraeve 282). Photo: G. Deburghgraeve.
the apex, erect, clavate, straight for 3/4th of the length,

then weakly curved towards the lip, canaliculate
ventrally, the ventral flanks ending in distinct angles
below the stigma, and with a pair of rather short,
lacerate to palmate wings on each side of the stigma,
ca. 1.7 cm long; anther cap white, more or less marked
with brown, campanulate, rostrate, dorsally lobulate;
pollinarium of two obovoid to pyriform, cleft/folded
pollinia on an oblong-rectangular ca. 2.5 mm long
stipe on a hooked, pulvinate viscidium.
The type plant was originally imported to Europe
as “Odontoglossum epidendroides”, or possibly “O.
juninense” (the details were lost with time). The original
identification was probably based on similarities to
then known Odontoglossum species. Due to legislative
complications it has not yet been possible to deposit a
type specimen in a Peruvian herbarium (USM) at this
time. When, and if, the government of Peru establish
the first CITES registered institution in their’ country,
this issue may be solved in a favorable way.
Figure 3. Odontoglossum filamentosum, plant habit (G. Additional records: Peru. Pasco (?): Exact origin
Deburghgraeve 282). Photo: G. Deburghgraeve. unknown but probably from the area near Oxapampa,
Dalström & Ruíz Pérez - A new Odontoglossum from Peru 405
Figure 4. Odontoglossum epidendroides. Photo: S. Dalström. Figure 5. Odontoglossum juninense. Photo: S. Dalström.
flowered in cultivation in Palca, Peru, by Manuel Arias, Chase, M.W. 2009. Subtribe Oncidiinae. In Pridgeon, A.M.,
Dec. 2002, S. Dalström 2765 (color transparency in M.W. Chase, P.J. Cribb, & F.N. Rasmussen [eds].
Dalström Archives). Genera Orchidacearum, Vol. 5. Epidendroideae. Oxford
University Press.
Distribution: Recent observations suggest that this Dalström. S. 1993. A new species of Odontoglossum
species is limited to seasonally wet cloud forests near (Orchidaceae; Oncidiinae) from Bolivia. Lindleyana
the town of Oxapampa, Pasco, Peru, at approximate 8(1): 15-19.
elevations of 2400 – 2500 m. Dalström. S. 1996. A New Small Flowered Species of
Odontoglossum (Orchidaceae; Oncidiinae) of the O.
Etymology: The name refers to the extraordinarily astranthum complex from Bolivia. Lindleyana 11(2):
long and filament-shaped lip callus. 114-117.
Dalström. S. 1999. A new Bolivian species of Odontoglossum
(Orchidaceae; Oncidiinae) in the astranthum complex.
Acknowledgements. The authors thank Wesley Higgins
Lindleyana 14(2): 87-91.
for commenting on the manuscript, Guido Deburghgraeve
Dalström. S. 2010. A new species of Odontoglossum
for cultivating the type plant, and Manolo Arias together with (Orchidaceae: Oncidiinae) from Ecuador. Lankesteriana
his staff and family in Lima for gracious logistic support. 9(3): 505-508.
The authors also thank the staff at the Instituto Recursos Dalström. S. 2012a. New combinations in Odontoglossum
Naturales (INRENA) for aiding in providing necessary (Orchidaceae: Oncidiinae) and a solution to a taxonomic
permits, and Betty Millán and Ricardo Fernández at the conundrum. Lankesteriana 12(1): 53-60.
Dalström. S. 2012b. A well-known but previously
Universidad de San Marcos, Museo de Historia Natural,
misidentified Odontoglossum (Orchidaceae:
Lima, for supporting ongoing orchid research projects and
Oncidiinae) from Ecuador. Lankesteriana 12(3): 155-
making herbarium material available for studies. 160.
Dalström. S. 2013. Eine neues, seltsames Odontoglossum as
Literature cited dem Astranthum-Komplex (Orchidaceae: Oncidiinae)
Chase, M. W., N. H. Williams, K. M. Neubig & W. M. der Amazonas-Region in Peru. Orchideenjournal (2):
Whitten. 2008. Taxonomic transfers in Oncidiinae to 62-67
accord with Genera Orchidacearum, vol. 5. Lindleyana Sander, F. 1892. Odontoglossum wattianum. Reichenbachia
in Orchids (West Palm Beach) 77(12): 20-31. 1(2), sub Pl. 9. H. Sotheran & Co., London.

LANKESTERIANA
LANKESTERIANA 13(3): 407—417. 2014.
nocturnal pollination by Fungus Gnats

of the Colombian endemic species, Pleurothallis marthae
(ORCHIDACEAE: PLEUROTHALLIDINAE)
Carol Andrea Duque-Buitrago1, Néstor Fabio Alzate-Quintero1 & J. Tupac Otero2, 3, 4

1
Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas y Naturales, Herbario FAUC,
Universidad de Caldas, PO Box 275, Manizales, Colombia
2
Departamento de Ciencias Biológicas, Facultad de Ciencias Agropecuarias, Universidad Nacional de
Colombia, Sede Palmira
3
Instituto de Estudios Ambientales IDEA, Universidad Nacional de Colombia, Sede Palmira
4
Author for correspondence: jtoteroo@unal.edu.co
Abstract. Contemporary patterns of plant biodiversity result from the ecological and evolutionary processes
generated by species interactions. Understanding these interactions is key for effective biodiversity conservation
at the species and the ecosystem level. Orchid species often have highly specialised pollinator interactions, and
the preservation of these is critical for in situ orchid conservation. The majority of orchid species occur in
tropical regions, and information regarding their interactions is limited. We present data on pollinator identities,
pollination mechanisms and flowering phenology of the Colombian endemic orchid, Pleurothallis marthae.
We evaluated the mechanisms of attraction, the presence of osmophores, and the reproductive system of
the species. Pleurothallis marthae is self-compatible with nocturnal anthesis pollinated by Mycetophila sp.
(Mycetophilidae), probably attracted by a string fungus like smell liberated by the flower and Bradysia sp.
(Sciaridae) that feed on nectar in the labellum. Osmophores and nectaries were detected in the epidermis of the
sepals and petals. We present new evidence that the genus Pleurothallis is adapted to Diptera pollination. Our
study indicates that the pollination mechanism of P. marthae is based on the nocturnal attraction of two species
of fungus gnats, probably combining food attraction and brood place deception.
Resumen. Los patrones contemporáneos de biodiversidad vegetal son el resultado de procesos ecológicos y
evolutivos generados por la interacción entre especies. El entendimiento de estas interacciones es clave para la
conservación de la biodiversidad a nivel de especies y ecosistemas. A menudo las orquídeas tienen interacciones
de polinización altamente especializadas, y su preservación es crucial para la conservación de orquídeas in situ.
La mayoría de las especies de orquídeas ocurren en regiones tropicales, y la información sobre sus polinizadores
es limitada. Aquí presentamos datos sobre la identidad de polinizadores, mecanismos de polinización y fenología
floral de la orquídea Pleurothallis marthae, endémica de Colombia. Evaluamos los mecanismos de atracción,
la presencia de osmóforos, y su sistema reproductivo. Encontramos que se trata de una especie auto-compatible
con antesis nocturna polinizada por Mycetophila sp. (Mycetophilidae), especie atraída probablemente por el
olor a hongo que libera la orquídea y Bradysia sp. (Sciaridae), la cual se alimenta de gotas de néctar en el
labelo. Los osmóforos y nectarios fueron detectados en la epidermis de los sépalos y pétalos. El mecanismo
de polinización de P. marthae se basa en la atracción nocturna de moscas especializadas en hongos, y combina
atracción alimenticia y mimetismo de sitios de apareamiento.
Key words: Bradysia, orchid pollination, fungus gnats, pollinators, Mycetophila, olfactory mimicry
Introduction. As we are facing the sixth global species requires a deep taxonomic understanding
biodiversity extinction (Canadell & Noble 2001), the (Flanagan et al. 2006), especially among those groups
ultimate goal of plant conservation biology is to preserve highly diversified such as Pleurothallidinae. It also
an adequate environment in which species can persist demands the maintenance of species interactions in
(Swarts & Dixon 2009), with continued evolutionary natural environments. One of the critical interactions
change. The effective conservation of individual for many plants is pollination by animals. It is also
408 LANKESTERIANA
one of the interactions that have provided substantial most common means of deception, sexual mimicry, is
evidence of evolutionary processes in the wild; reported in about 20 genera of Orchidaceae with various
revealing amazing adaptations associated with pollen pollinator types such as solitary and social bees, wasps,
transport (Darwin 1885). Nevertheless, pollination had beetles and flies (Dafni 1984; Sasaki et al. 1991). This
been nominated as an endangered interaction due to mechanism includes visual and/or olfactory features
losses of plant species and their pollinators as well as attracting insects. The best known cases of reproductive
their natural habitats (Kearns et al. 1993). A flowering deception involve pseudo-copulation, a phenomenon
plant family that combines both, threat conservation in unique to orchids (Nilsson 1992). Where, flowers
some species and interesting pollination interactions is mimic female structures and chemical pheromones of
the Orchidaceae. certain insects (Singer et al. 2004; Blanco & Barboza
Orchidaceae is the largest family of flowering 2005), and are pollinated by male insects seeking
plants with about 800 genera and more than 28,000 a mate (Dressler 1981; Williams & Whitten 1983;
species (Govaerts et al. 2012); many species are Singer 2002). The emission of fragrances that resemble
endangered, and listed in biodiversity red lists; for the insect sexual pheromones for reproduction is an
example, in Colombia there is a partial list of 207 important factor associated with the mimicry, including
endangered orchids (Calderón 2007). There are several mating or oviposition sites (Albores-Ortiz & Sosa 2006;
critical aspects of orchid biology that contribute Barbosa et al. 2009; Barriault et al. 2010; Endara et al.
to those threats. Orchid conservation requires the 2010 Peakall et al. 2010).
consideration of two bottlenecks in the orchid’s life Some studies suggest that the subtribe
cycle: seed germination and pollination (Tremblay & Pleurothallidinae (Orchidaceae: Epidendreae) is
Otero 2009). Orchids depend on specific fungi for seed mainly adapted to pollination by Diptera species
germination (Otero et al. 2002; 2004; 2007) that may (van der Pijl & Dodson 1966; Chase 1985; Duque
have had complex co-cladogenic processes (Otero et 1993; Borba & Semir 2001; Blanco & Barboza
al. 2011); however, there is still much to learn about 2005; Pupulin et al. 2012), with several reports of
many orchid mycorrhizal interactions, especially in deception by sexual mimicry (Christensen 1994;
the tropics (Otero & Bayman 2007). In the Andes, the Blanco & Barboza 2005). Borba & Semir (2001)
highest threat to orchid conservation is habitat loss; studied four Brazilian species and reported different
nevertheless, pollination is also crucial. fragrances and pollinator activities. Acianthera
Orchids are renowned for the complex and johannensis (Barb. Rodr.) Pridgeon & M.W. Chase (as
intriguing pollination mechanisms adapted to Pleurothallis johannensis Barb. Rodr.) and Acianthera
pollination by animals (Darwin 1885, van der Pijl & fabiobarrosii (Borba & Semir) F. Barros & F. Pinheiro
Dodson 1966, Singer 2002, Borba & Braga 2003), (as P. fabiobarrosii Borba & Semir) are pollinated by
especially insects (Dressler 1981). It is now well known females of the genera Tricimba (Chloropidae) and have
that bees and wasps are responsible for about 60% of a diurnal smell of fish and no nectar production, while
the pollination of the family (Williams 1982, Ackerman Acianthera teres (Lindl.) Borba (as P. teres Lindl.) and
1983; Whitten et al. 1993; Camargo et al. 2006), flies Acianthera ochreata (Lindl.) Pridgeon & M.W. Chase
pollinate 15-25% of species (Borba & Semir 2001), and (as P. ochreata Lindl.) have a diurnal smell of rancid
Lepidoptera, Coleoptera and birds pollinate about 15- cheese and produce nectar like liquid at the base of
25% remaining (van der Pijl & Dodson 1966; Singer et the labellum. The latter are pollinated by Megaselia
al. 2007; Cuartas-Domínguez & Medel 2010). Orchids spp. (Phoridae) (Borba & Semir 2001), Acianthera
may provide a variety of rewards to their pollinators, adamantinensis (Brade) F. Barros (as Pleurothallis
such as oils, floral fragrances and occasionally pollen- adamantinensis Brade) has a dog feces odor and is
like substances (Neiland & Wilcock 1998; Pansarin pollinated by flies Hippelate ssp. (Chloropidae) (Borba
2008); however, nearly a third of orchid species & Semir 2001). Those five species had high genetic
provide no floral resources, and depend on various variability showing a high percentage of polymorphic
forms of deception for pollination (Ackerman 1986; loci ranged from 50 to 83%, with a mean number of
Nilsson 1992; Cozzolino & Widmer 2005). One of the alleles per locus between 2.1 and 3.8, and a mean
Duque-Buitrago et al. - Nocturnal pollination of Pleurothallis marthae by fyngus gnats 409
heterozygosity (He) ranged from 0.25 to 0.43 (Borba the column is short and cream-colored with an apical
et al. 2001). Acianthera johannensis, A. fabiobarrosii, anther and a bilobed stigma (Fig. 1).
and A. adamantinensis showed a low level of genetic
Study site. — We did this study at the Yotoco Forest
structuring while A. teres and A. ochreata showed high
Reserve (YFR), located on the eastern slope of the
genetic structuring (Borba et al. 2001). However, the
western Cordillera de Los Andes in Colombia, in
actual evidence has not been applied for conservation
the municipality of Yotoco. The site was situated in
purposes, but in recent years the genus had been
remnants of the subtropical wet-dry transition forest of
subdivided in smaller groups.
Valle del Cauca (3°50’N, 76°20’W) at an elevation of
Pleurothallis marthae (Luer & Escobar) Luer is
1400-1600 m. Average annual temperature is 20° C;
an interesting research model because it has relatively
average annual precipitation is 1500 mm; and relative
large flowers of 2 cm that facilitate observation and is a humidity averages 85% (Escobar 2001).
frequent species in Yotoco Nature Reserve, Colombia. Two populations were surveyed, accounting 250
Little information is reported in the literature on individuals in total; each individual was marked
this species. It is listed in the CITES Appendix II with an aluminum tag with a previously assigned
(W3Tropicos, accessed on Dec 2012) and is endemic code. Individuals were considered genets if all
to Colombia. Recently it was recorded from Yotoco shoots were attached to a single rhizome and were
Nature Reserve (Escobar 2001; Pérez-Escobar et al. physically separate from other plants. Individuals were
2009). The species grows as both an epiphyte near the characterized by size class according to the length of
ground (no more than one meter high) and a terrestrial the longest shoot. The classes are the following: SIZE
plant, at 1400-1800 m elevation in mountain forest. I (6-20 cm), SIZE II (21-40 cm), SIZE III (41-60 cm),
The objectives of this study are to describe the SIZE IV (> 61 cm).
pollination system and mechanisms of pollinator
attraction of P. marthae. Reproductive events. — The numbers of open flowers
(OF), pollinaria removed (PR), closed stigmas (CS)
Material and Methods and swollen ovaries (SO) were recorded weekly as
Study species. — Pleurothallis marthae is a terrestrial indirect evidence of reproductive effort and pollination
species or rarely epiphytic, without pseudobulbs, leaves events. As the data were not normally distributed, the
broad, deeply cordate (Luer & Escobar 1996), it has a differences between size classes for each reproductive
little bundle of pink flowers on the base of the leaf. The event were analyzed using a Kruskal-Wallis test. The
flowers are relatively large for the genus. This species correlation between pollinator activity and flowering
was described as P. marthae by Luer & Escobar from anthesis was evaluated with a linear regression. All data
a collection by E. Valencia from Garrapatas (Valle del were analyzed with Statgraphics ® Plus Version 5.1®.
Cauca, Colombia) (Luer & Escobar 1996) and then Flower visits. — Observations were initially made
transferred to Acronia Luer (2005). As Acronia is not between 0600 and 1800 h to identify periods of activity
broadly accepted we use Pleurothallis. P. marthae of flower visitors and pollinators. Very low activity was
has flowers with two different coloration patterns observed during the day, so the observation period were
and morphology (morphs). The first (yellow-morph) extended until 2000 h. Visitors were observed using
has yellowish dorsal sepal the broadly ovate, obtuse, red light located two meters from the plants to broaden
concave, with translucent horizontal lines and dots, the the spectrum of light to avoid pollinator disturbance
lateral sepals completely connate (synsepal) is lilac, they were highly sensitive to direct illumination. With
with glandular trichomes, petals rose, concave, with these additional hours we discovered visitation was
glandular trichomes too, lip light rose, thick, convex, nocturnal, so all further nocturnal observation periods
transversely obovate. The second (pink-morph) has a were done between 1800 - 0600 h, for a total of 97
pink dorsal sepal with translucent horizontal lines and hours of observation (not including the diurnal times).
dots, the synsepal is magenta with glandular trichomes, For 30 individuals, the time of arrival of visitors was
the petals are larger than the yellow-morph (Fig. 1) recorded, duration of visit, behavior within the flower,
and the lip is similar to yellow-morph. In both morphs and number of visitors, and additionally video and
410 LANKESTERIANA
Figure 1. Flower of Pleurothallis marthae: a) lateral view, b) frontal view, c) two color morphs, d) Habit of Pleurothallis
marthae.
photographic records. Flower visitors and pollinators the following hand-pollination treatments: autogamy
were differentiated by behavior. Floral visitors were (removal of pollinaria from a flower and pollen transfer
collected in plastic vials, transported to the zoology to the same flower); geitonogamy (removal of pollinaria
laboratory at Universidad of Caldas where high from one flower and pollen transfer to another flower
resolution macro photos were taken. As Colombian of the same plant); xenogamy (removal of pollinaria
law prohibits exportation of wild biological material, from a flower and pollen transfer to a flower of another
Dr Sarah Siqueira de Oliveira, at the University of São plant); and natural pollination. All treatments with the
Paulo identified the specimens from the photographs. exception of the natural pollination treatment were
bagged again to prevent insect visitors impacting
Osmophore detection.. — From each of the populations,
the results. Pollinations were monitored until fruits
we collected fresh flowers from 10 individuals and
matured or aborted. We analyzed differences among
stained in a bath of neutral red 1:1000 for 20 minutes
treatments with a non-parametric Kruskal-Wallis test.
(Stern et al. 1986) to detect scent-secreting glands
(osmophores) or nectaries as neutral red indicate sites
Results. Flower buds develop in 10-15 days, and
that is metabolically active (Kearns & Inouye 1993).
flowers remain open for 10-12 days, provided that
Reproductive system. — We bagged 40 flower buds of pollination did not occur. The flowers produce fungus-
20 plants with net mesh to exclude insect visitors. Once like odor and lightly sweet nectar at night time. Anthesis
the flowers were in anthesis and receptive, as indicated of P. marthae began at 18:30 when flowers began to
by a wet and sticky stigmatic surface, we performed release a fungus-like odor (as detected by the human
Figure 2. Linear regression of the number of flowers per Figure 3. Bradysia sp. with Pleurothallis marthae pollinaria
reproductive season vs. number of fruits. adhered to the dorsal side of the thorax.
nose) and nectar secreted by the lip. As time passed cydno cydnides Staudinger (Lepidoptera: Heliconidae)
the smell gradually increased in intensity, and peaked visiting several flowers in a typical foraging behavior
at 23:30. There after the intensity decreased until and two species of spiders, Araneidae and Thomisidae,
approximately 05:00, when it became imperceptible. families known to hunt pollinators. Occasionally, we
The fluid secreted from the lip remained in the flower observed ants eating the nectar from the lip.
from 19:00 until 09:00. We observed two pollinators species, Bradysia
sp. (Diptera: Sciaridae) and Mycetophila sp. (Diptera:
Reproductive events. — The species flowered from
early May through mid June (six weeks), with a peak at Mycetophilidae), both fungus gnats. The Bradysia sp.
the fourth week. There were significant differences in (Fig. 3) visited several flowers on the same plant (Fig.
weekly flower abundances among size classes (H test, 4) by first landing on the synsepal, and then crossing
P-value = 0.03) with small individuals producing fewer the petals to consume the nectar on the labellum for a
flowers than the large ones. Nevertheless, the number few seconds. Subsequently, the gnat contacted the apex
of pollinia removed (H test, P-value = 0.14), stigmas of the column and probably causing the pollinarium to
closed (H test, P-value = 0.31) and ovaries swelled adhere to the ventral section of the thorax. Visits of
(H test, P-value = 0.19) did not differ significantly. Bradysia sp. were very brief (10 seconds) and were
There was a significant relationship between weekly only observed on two occasions, in one of them, the
abundance of flowers and abundance of pollinators individual had two pollinaria attached.
visiting flowers during the anthesis period (H test, The Mycetophila sp. (Fig. 5) was presumably
P-value = 0.02). There was a correlation between attracted by the fungus-like floral fragrance. The gnats
number of pollinator visit and the number of flowers landed on the flower (synsepal, lip, petals, or column)
in anthesis per reproductive season (Fig. 2). The time and began a series of wing and thorax movements while
from pollination to fruit dehiscence was between 9 lifting the hind legs (Fig. 6), and sometimes moving the
and 10 weeks. The reproductive events did not differ abdomen as if to oviposit. Probably pollinaria adhere
statistically between two different coloration patterns to the ventral part of the thorax when individuals court
(morphs) observed (H test, P-value > 0.05). and mate. Individuals stayed on the flower for a long
Flower visitors. — The most common flower diurnal time (sometimes overnight). We often observed many
visitors were herbivorous caterpillars (Lepidoptera: individuals of Mycetophila sp. visiting the flower at the
Geometridae), which feed on buds, ovaries, and fruits same time (10 individuals), observed 47 individuals in
in early developmental stages. We also observed adults total. On several occasions we observed mating among
of two Orthoptera species: Eumastacidae and Acrididae the Mycetophila sp. but we did not observe pollination
feeding on flowers and foliage. We also saw Heliconius events. Nevertheless, indirect evidence of their
412 LANKESTERIANA
Figure 4. Visit sequences of Bradysia sp. in Pleurothallis marthae flowers. a — Bradysia sp. arriving to the petals and
facing to the labellum; b — Bradysia sp. consuming nectar from the labellum; c — Bradysia sp. crossing by the column
and climbing by the lower part of the dorsal sepal; d — Bradysia sp. crossing by the lower part of the dorsal sepal to
exit the flower.
pollination activity was obtained from the collection
from the field of these diptera species with P. marthae
pollinarium attached.
Osmophore detection. — Osmophores were detected
in the epidermis of synsepals, dorsal sepal and petals,
with an obvious presence in scattered spots located
mainly at the edges of the structure (Fig. 7). The petal
tips had glandular trichomes.
Reproductive system. — Our hand-pollination
experiments indicated that Pleurothallis marthae is
self-compatible. Self-pollination treatment within a
Figure 5. Mycetophila sp. with pollinaria of Pleurothallis
flower produced 60% fruit set; pollination between
marthae. a — Mycetophila sp. in a flower of Pleuro- flowers of the same clump produced 50% fruit set;
thallis marthae with a pollinarium in the ventral part cross-pollinations had 60% fruit set and natural
of the thorax. b — Close up of Mycetophila sp. and pollination produced 40%. No significant differences
pollinarium. The pollinarium was detached of the insect were observed between the different treatments (H
during the specimen manipulation. test, P value> 0,05).
Figure 6. Display of Mycetophila sp. in Pleurothallis marthae flowers.
Discussion. Base on the finding of Pleurothallis crassifolia is pollinated by Bradysia sp. in Brazil
marthae is probably pollinated by two species of (Barbosa et al. 2009). In California, Listera cordata
fungus gnats: Mycetophila sp. and Bradysia sp. Visitors (= Neottia cordata; Orchidoideae) is pollinated by
can remove pollinia and not necessarily be pollinators, Mycetophila sp. and Sciara sp. (Ackerman & Mesler
nevertheless, form in which deposited pollinia, court 1979).
and mate in the flowers, fungus-like odor, absence Mycetophila forms distinct groups of closely
of other species through visits and biology of fungus related species, which are within the group usually
gnat, we believe that they are pollinators. This case separable only by the characters on the male terminalia.
is similar to that found by Endara et al. (2010), in Mycetophila is one of the most abundant families of
this work on pollination of Dracula lafleurii Luer & order Diptera encompassing more than 3000 described
Dalström and Dracula felix (Luer) Luer, authors argue species, with a world-wide distribution (Gaston 1991).
that the pollination process occurs when individuals of Pleurothallis marthae has flowers with two different
Zygothrica perform court and mate in the flowers. coloration patterns (morphs). Pollination success was
The effectiveness of fungus gnats orchid as detected equally in both morphs, suggesting that color
pollinators had been briefly documented by van der Pijl is not a key factor determining reproductive success,
and Dodson (1966) on the pollination of Stelis aemula and supporting the hypothesis that both fragrances
Schltr. Most recently, other orchids had been reported and nectar are key attracting factors. Nevertheless,
as fungus gnats pollinated, for example Lepanthes we found a positive relationship between flower
glicensteinii is pollinated by Bradysia floribunda abundance and the number of pollinator visits. This
in Costa Rica (Blanco & Barboza 2005), Octomeria may be because with a greater number of flowers there
414 LANKESTERIANA
Figure 7. Portion of the dorsal sepal (a) before and (b) after staining with neutral red. Arrows shows the presence of
osmophores and/or nectaries in the adaxial side of the sepal.
is likely to be an increase in the emission of aroma pollination (de Melo et al. 2010).
and possibly a greater supply of nectar, making these Our results on the reproductive system suggest
flowers more effective at attracting pollinators. that P. marthae is self-compatible; this finding is
Pleurothallis marthae seems to mimic the smell of compatible with the observed behavior of pollinators,
a fungus; this case had been reported in Zootrophion whose continued presence at a single flower and at the
sp. (Orchidaceae) and coincides with the syndrome flowers of a single plant is likely to promote P. marthae
of sapromyophily (pollination syndrome of flowers reproduction. This phenomenon has also been observed
producing smell of decaying flesh) proposed by Faegri in other species (Mesler et al. 1980; Borba & Semir 2001;
& van der Pijl (1971). Singer 2001; Barbosa et al. 2009). While we did not
Although oviposition behavior was observed by conduct a pollination treatment to test for self-pollination,
Mycetophila sp., we did not observe eggs or larvae fruit and seed production in most self-compatible orchids
under microscope, which suggests a mechanism are pollinator-dependent, and P. marthae is likely no
in which the flowers attract female flies, and those exception (Rodríguez-Robles et al. 1992; Singer &
females at the same time attract males (Ackerman & Zasima 1999; Singer 2001; Singer et al. 2004).
Mesler 1979). Mycetophila sp. was observed mating The natural fruit set observed in this study was
on the flowers on several occasions. Displaying 60%. This value is higher than the ranges suggested
Mycetophila sp. were most commonly observed on by Neiland & Wilcock (1998) for tropical orchids,
the specific parts of the flower in which we located although those reported for Listera cordata 61-78%
the scent glands (osmophores), suggesting that the (Ackerman & Mesler 1979) and Habenaria parviflora
attraction of this species occurs by the emission of a 93.3-96.7% (Singer 2001), species pollinated by
fragrance. Additionally, floral display was also very Diptera, are higher. Together, these findings suggest
important as plants with more open flowers had higher that Diptera pollination can be a very favorable
fitness that may be complementary. strategy for orchids.
Both pollinator species are commonly known as We present new evidence of fly pollination in the
fungus gnats because they are almost always dependent genus Pleurothallis. Fly pollination had already been
upon fungal substrates for larval development. The reported for species Lepanthes glicensteinii Luer,
Bradysia sp. may have been initially attracted by Listera cordata (L.) R. Br., Tolmiea menziesii (Pursh)
the smell and then by the presence of nectar, which Torr. & A. Gray, Asarum caudatum Lindl., Dracula
may be a mechanism to keep the flies on flowers for lafleurii Luer & Dalström and Dracula felix (Luer)
longer periods of time to enhance the probability of Luer, Specklinia pfavii (Rchb.f.) Pupulin & Karremans
and Specklinia spectabilis (Ames & C.Schweinf.) Orchidaceae). Acta Botánica Mexicana 74: 155-168.
Pupulin & Karremans (Mesler et al. 1980; Lu 1982; Barbosa, A.R., M.C. de Melo & E.L. Borba. 2009.
Goldblatt et al. 2004; Okuyama et al. 2004; Endara Self-incompatibility and myophily in Octomeria
et al. 2010, Pupulin et al. 2012), revealing them (Orchidaceae, Pleurothallidinae) species. Plant
Systematics and Evolution 283: 1-8.
to be very important pollination vectors that have
Barriault, I, D. Barabe, L. Cloutier & M. Gibernau. 2010.
highly specialized relationships with the plants they
Pollination ecology and reproductive success in
pollinate. As far as we know, our study is the first
Jack-in-the-pulpit (Arisaema triphyllum) in Quebec
case suggesting fungal-like odors may be involved in (Canada). Plant Biology 12: 161-171.
attracting pollinators in Pleurothallis and the second Blanco, M.A. & G. Barboza. 2005. Pseudocopulatory
for the Subtribe Pleurothallidinae (Christensen 1994). Pollination in Lepanthes (Orchidaceae:
It is the first report of nocturnal pollination of the genus Pleurothallidinae) by Fungus Gnats. Annals of Botany
and species pollinated by fungus gnats. Lepanthes 95: 763-772.
may be nocturnally pollinated too (Tremblay & Borba, E.L. & P.I. Braga. 2003. Biologia reprodutiva de
Ackerman 2007). Further studies in our research group Pseudolaelia corcovadensis (Orchidaceae): melitofilia
are focused in the understanding of the fragrance e autocompatibilidade em uma Laeliinae. Revista
composition of of P. marthae flowers. The knowledge Brasileira de Botânica 26: 541-549.
Borba, E.L., J.M. Felix, V.N. Solferini & J. Semir. 2001.
of this obligatory interspecific interactions is critical
Fly-pollinated Pleurothallis (Orchidaceae) species
for the conservation management of this Colombian
have high genetic variability: evidence from isozyme
endemic orchid, P. marthae; of course, we have to markers. American Journal of Botany 88: 419-428.
include the conservation of their nocturnal fungus gnat Borba, E.L. & J. Semir. 2001. Pollinator Specificity
pollinators. and Convergence in Fly-pollinated Pleurothallis
(Orchidaceae) Species: A Multiple Population
Acknowledgements. The authors are thankful for the Approach. Annals of Botany 88: 75-88.
Mobility grant awarded to the first author by Santander Calderón-Saenz E. 2007. Libro rojo de plantas de
Universities. We thank Sarah Siqueira de Oliveira for the Colombia. Volumen 6: Orquídeas, primera parte. Serie
identification of Diptera; Carlos Alberto Jaramillo, Valentín de Libros Rojos de Especies Amenazadas de Colombia.
Hidalgo and the staff of the Yotoco Forest Reserve of the Bogotá, Colombia. Instituto Alexander von Humboldt-
Universidad Nacional de Colombia-Palmira for assistance Ministerio de Ambiente, vivienda y desarrollo
in the development of this study; James D. Ackerman, territorial. 828 p.
Nicola S. Flanagan, Paul Bayman, Nhora Helena Ospina Camargo, E., V, Silva & E. Leit. 2006. Reproductive biology
and Marcela Cuartas for their comments and contributions of two Cattleya (Orchidaceae) species endemic to
to the manuscript; and the Grupo de Investigación en north-eastern Brazil. Plant Species Biology 21: 85-91.
Orquídeas, Ecología y Sistematica Vegetal (COL 0066015) Canadell, J. & I. Noble. 2001. Challenges of a changing
of the Universidad Nacional de Colombia-Palmira for
earth. Trends in Ecology and Evolution 16: 664-
logistical support.
666.
Chase, M.W. 1985. Pollination of Pleurothallis endotrachys.
American Orchid Society-Bulletin 54: 431-434.
Literature cited Christensen, D.E. 1994. Fly pollination in the Orchidaceae.
Ackerman, J.D. 1983. Specificity and mutual dependency In J. Arditti [ed.], Orchid Biology: Reviews and
of the orchid-euglossine bee interaction. Biological perspectives, VI, 415-454. (John Wiley & Sons. New
Journal of the Linnean Society 20: 301-314. York, USA.
Ackerman, J.D. 1986. Mechanisms and evolution of food- Cozzolino, S. & A. Widmer. 2005. Orchid diversity: an
deceptive pollination systems in orchids. Lindleyana 1: evolutionary consequence of deception? Trends in
108-13. Ecology and Evolution 20: 487-494.
Ackerman, J.D. & M.R. Mesler. 1979. Pollination Biology Cuartas-Domínguez, M. & R. Medel. 2010. Pollinator-
of Listera cordata (Orchidaceae). American Journal of mediated selection and experimental manipulation of
Botany 66: 820-824. the flower phenotype in Chloraea bletioides. Functional
Albores-Ortiz, O. & V. Sosa. 2006. Polinización de dos Ecology 24: 1219 -1227. http://dx.doi.org/10.1111/
especies simpátricas de Stelis (Pleurothallidinae, j.1365-2435.2010.01737.x

416 LANKESTERIANA
Dafni, A. 1984. Mimicry and Deception in Pollination. Dracula, Dresslerella, Lepanthes and Masdevallia
Annual Review of Ecology and Systematic 15: 259- new taxa, validation of taxa, errata. Missouri Botanical
278. Garden, St. Louis.
Darwin, C.D. 1885. The various contrivances by which de Melo, M.C., E.L. Borba & P.E. Sousa. 2010.
orchids are fertilized by insects. John Murray, London, Morphological and histological characterization of the
UK. osmophores and nectaries of four species of Acianthera
Dressler, R.L. 1981. The Orchids, natural history and (Orchidaceae: Pleurothallidinae). Plant Systematic
classification. The Smithsonian Institution, Washintong Evolution 286: 141-151.
DC, USA. Mesler, M.R., J.D. Ackerman & K.L. Lu. 1980. The
Duque, O. 1993. Polinización en Pleurothallis. effectiveness of fungus gnats as pollinators. American
Orquideología 19: 55-69. Journal of Botany 67: 564-567.
Endara, L., Grimaldi, D. A., & Roy, B. A. 2010. Lord of Neiland, M.R. & C. Wilcock. 1998. Fruit Set, Nectar
the flies: pollination of Dracula orchids. Lankesteriana Reward, and Rarity in the Orchidaceae. American
10: 1-11. Journal of Botany 85: 1657-1671.
Escobar, E. 2001. Presentación de Yotoco “Reserva Natural” Nilsson, L.A. 1992. Orchid pollination biology. Trends in
Flora: Plantas Vasculares. Universidad Nacional de Ecology and Evolution 7: 255-259.
Colombia, Palmira, Colombia. Okuyama, Y., M. Kato, N. Murakami. 2004. Pollination
Faegri, K. & L. van der Pijl. 1979. The principles of by fungus gnats in four species of the genus Mitella
pollination biology. Oxford: Pergamon Press. (Saxifragaceae). Botanical Journal of the Linnean
Flanagan, N.S., R. Peakall, M.A. Clements & J.T. Otero. Society 144: 449-460.
2006. Conservation of taxonomically difficult species: Otero, J.T., J.D. Ackerman & P. Bayman. 2002. Diversity
the case of the Australian orchid, Microtis angusii. and host specificity of endophytic Rhizoctonia-like
Conservation Genetics 7: 847-859. fungi from tropical orchids. American Journal of
Gaston, K.J. 1991. The magnitude of global insect species Botany 89: 1852-1858.
richness. Conservation Biology, 5: 283-296. Otero, J.T., J.D. Ackerman & P. Bayman. 2004. Differences
Goldblatt, P., P. Bernhardt, P. Vogan & J.C. Manning. 2004. in mycorrhizal preferences between two tropical
Pollination by fungus gnats (Diptera: Mycetophilidae) orchids. Molecular Ecology 13: 2393-2404.
and self-recognition sites in Tolmiea menziesii Otero, J.T. & P. Bayman. 2007. Mycorrhizae in orchid
(Saxifragaceae). Plant Systematics and Evolution 244: conservation. In: E Calderón-Sáens [ed.], The Red
55-67. Book of Orchids of Colombia, V, 6: Orchids, First Part.
Govaerts, R., J. Pfahl, M.A. Campacci, D. Holland-Baptista, Series The Red Book Species of endangered species of
H. Tigges, J. Shaw, P. Cribb, A. Geore, K. Kreuz & J. Colombia, 771-796. Instituto Alexander von Humboldt,
Wood. 2012. World checklist of Orchidaceae. The Ministerio de Ambiente, Vienda y Desarrollo Territorial,
Board of Trustees of the Royal Botanic Gardens, Kew. Bogota, Colombia.
http://www.kew.org/wcsp/monocots/ [accessed 24 June Otero, J.T., N.S. Flanagan, E.A. Herre, J.D. Ackerman,
2012]. P. Bayman. 2007. Widespread mycorrhizal
Kearns, C.A. & D.W. Inouye. 1993. Techniques for specificity correlates to mycorrhizal function in the
Pollination Biologists. University Press of Colorado, neotropical, epiphytic orchid, Ionopsis utricularioides
Colorado, USA. (Orchidaceae). American Journal of Botany 94: 1944-
Kearns, C.A., D.W. Inouye & N.M. Waser. 1998. 1950.
Endangered Mutualism: the conservation of plant- Otero, J.T., P.H. Thrall, M.A. Clements, J.T. Miller &
pollinators interactions. Annual Review of Ecology and J.J. Burdon. 2011. Co-diversification of Orchids
Systematics 29: 83-112. (Pterostylidinae) and their Associated Mycorrhizal
Lu, K.L. 1982. Pollination Biology of Asarum caudatum Fungi. Australian Journal of Botany 59: 480-497.
(Aristolochiaceae) in Northern California. Systematic Pansarin, E.R. 2008. Reproductive biology and pollination
Botany 7:150-157. of Govenia utriculata: A syrphid fly orchid pollinated
Luer, C.A. & R. Escobar. 1996. Nuevas especies de through a pollen-deceptive mechanism. Plant Species
Pleurothallis de Colombia. Orquideología 20: 68-71. Biology 23: 90-96.
Luer, C.A. 2005. Icones pleurothallidinarum XXVII. Peakall, R., D. Ebert, J. Poldy, R.A. Barrow, W. Francke,
Dryadella and Acronia section Macrophyllae- C.C. Bower & F.P. Schiestl. 2010. Pollinator specificity,
Fasciculatae: addenda to Acianthera, Andinia, floral odour chemistry and the phylogeny of Australian

sexually deceptive Chiloglottis orchids: implications ringens (Lindl.) Schltr. (Orchidaceae:Maxillariinae).

for pollinator-driven speciation. New Phytologist 188: Annals of Botany 93: 755-762.
437-450. Singer, R. B., Breier, T. B., Flach, A., & Farias-Singer,
Pérez-Escobar, O.A., E. Parra-Sanchez & P. Ortiz-Vadivieso. R. 2007. The pollination mechanism of Habenaria
2009. Inventario orquideológico de la Reserva Bosque pleiophylla Hoehne & Schlechter (Orchidaceae:
de Yotoco, Valle del Cauca. Acta Agronómica 58: 189- Orchidinae). Functional Ecosystems and Communities,
196. 1: 10-14.
Pupulin, F., A.P. Karremans & B. Gravendeel. 2012. Swarts, N.D. & W. Dixon. 2009. Terrestrial orchid
A reconsideration of the empusellous species of conservation in the age of extinction. Annals of Botany
Specklinia (Orchidaceae: Pleurothallidinae) in Costa 104: 543-556.
Rica. Phytotaxa 63: 1–20. Tremblay, R. & J.D. Ackerman. 2007. Floral color patterns in
Rodríguez-Robles, J.A., E.J. Meléndez & J.D. Ackerman. a tropical orchid: are they associated with reproductive
1992. Effects of display size, flowering phenology, and success? Plant Species Biology 22: 95-105.
nectar availability on effective visitation frequency in Tremblay, R. & J.T. Otero. 2009. Orchid conservation
Comparettia falcata (Orchidaceae). American Journal biology: Predicting species dynamics and community
of Botany 79: 1009-1017. interactions. In: A.M. Prigeon & J.P. Suárez [eds.],
Sasaki, M., M. Ono, T. Asada & T. Yoshida. 1991. Proceedings of the Second Scientific Conference
Oriental orchid (Cymbidium pumilum) attracts drones on Andean Orchids, 97-107. Universidad Técnica
of the Japanese honeybee (Apiscerana japonica) as Particular de Loja, Loja, Ecuador.
pollinators. Experientia 47: 1229-1225. van der Pijl, L. & C.H. Dodson. 1966. Orchid Flowers: their
Singer, R.B. 2001. Pollination biology of Habenaria pollination and evolution. University of Miami Press,
parviflora (Orchidaceae: Habenariinae) in Southeastern Miami, USA.
Brazil. Darwiniana 39: 201-207. Whitten, W.M., A.M. Young & D.L. Stern. 1993. Non-floral
Singer, R.B. 2002. The pollination mechanism in Trigonidium sources of chemicals that attract male euglossine bees.
obtusum Lindl. (Orchidaceae: Maxillariinae): Sexual Journal of Chemical Ecology. 19:3017-3027.
mimicry and trap-flowers. Annals of Botany 89: 157- Williams, N.H. 1982. The biology of orchids and euglossine
163. bees. In: J. Arditti [ed.], Orchidbiology II, 121-169.
Singer, R.B. & M. Sazima. 1999. The pollination mechanism Cornell University Press, Ithaca, New York.
in the ‘Pelexia alliance’ (Orchidaceae:Spiranthinae). Williams N.H. & W.M. Whitten. 1983. Orchid floral
Botanical Journal of the Linnean Society 131: 249-262. fragrances and male euglossine bees. Methods and
Singer, R.B., A. Flach, S. Koehler, A.J. Marsaioli & advances in the last sesquidecade. Biological Bulletin,
M.D.C.E. Amaral. 2004. Sexual mimicry in Mormolyca 164: 355-395.

LANKESTERIANA
LANKESTERIANA 13(3): 419—427. 2014.
Organización espacial y estructura de una población

de Ionopsis utricularioides (Orchidaceae) en un área
suburbana de Pinar del Río, Cuba
Alfredo García-González* & Frander B. Riverón-Giró
El Colegio de la Frontera Sur (ECOSUR), Unidad Tapachula. Carretera Antiguo Aeropuerto, km 2.5,
Apartado Postal 36, Tapachula, Chiapas, México. C.P. 30700
*
Autor para correspondencia: alfredmx22@gmail.com
Resumen. Se determinó la estructura poblacional y hábitos de crecimiento de una población de Ionopsis

utricularioides (Orchidaceae), en un huerto de naranjos (Citrus sinensis; Rutaceae), localizado en la finca “La
Juanita”, Pinar del Río, Cuba. Se tuvieron en cuenta todos los árboles de naranjo del huerto y la población total
de I. utricularioides. Se midieron las siguientes variables: altura y diámetro de los naranjos y ramas donde
crecían las orquídeas, distribución de las orquídeas en los forófitos (tronco, ramas o ramillas), estadio de vida de
las orquídeas (inmaduras o adultas), orientación de las orquídeas en el forófito, si las plantas estaban solitarias
o agregadas y especie de los vecinos en el caso de las agregadas. Se estudiaron un total de 10 árboles de C.
sinensis, ocho de ellos forófitos de la orquídea. Se contabilizaron 217 plantas de I. utricularioides. En el tronco
de los árboles no se encontraron plantas de I. utricularioides y en las ramillas creciá 98.61% de la población.
El número de plantas es relativamente abundante en los dos estadios de vida. Gran parte de las plantas de I.
utricularioides se encontraron creciendo en agregación con otros individuos de su misma especie o con otras
especies de epífitas vasculares. Esta es una población establecida y madura. Crecer en agregación le puede
brindar ventajas competitivas a I. utricularioides.
Abstract. We determined the population structure and some habitat conditions of a Ionopsis utricularioides
(Orchidaceae) population in an orange orchard (Citrus sinensis, Rutaceae), located in the “La Juanita” farm,
Pinar del Río, Cuba. We took into account all the orange trees of the orchard, and located all the individuals of
I. utricularioides. The following variables were analyzed: height and diameter of branches in growing orchids,
orchid distribution on phorophytes (trunk, branches or twigs), life stage of the orchids (immature or adults),
orientation of orchids in the phorophyte, if the plants were solitary or aggregated, and kind of neighbours in the
case of the aggregate. Of the 10 trees of C. sinensis, eight trees had orchids of I. utricularioides, with 217 plants.
Almost all orchids were observed on the twigs (98.61 %) and none were observed on the trunk of the tree. The
number of plants is relatively high in the two stage of life. Most plants of I. utricularioides were found growing
aggregate with individuals of the same species, or with other species of vascular epiphytes. This is a stable and
mature population. Growing up in aggregation can give competitive advantages to I. utricularioides.
Palabras claves: micrositio, forófito, clases de vida, plantas agregadas, plantas solitarias, naranjo
Introducción. Las orquídeas son probablemente las soportes (a nivel de corteza, ramas, troncos y especies
más evolucionadas de todas las plantas vasculares y de forófitos) ejercen una influencia muy fuerte en
son un componente muy importante de la biodiversidad la dinámica de las poblaciones de epífitas (Zotz &
a consecuencia de su gran diversidad de especies Schmidt 2006).
(Mujica et al. 2000). No obstante, las orquídeas En Cuba actualmente se reconocen aproxima-
epífitas y terrestres difieren en un importante número damente 99 géneros y 308 especies de la familia
de aspectos (Zotz & Schmidt 2006). Las orquídeas Orchidaceae (Llamacho & Larramendi 2005), de las
epífitas no tienen una fase bajo tierra y en ocasiones cuales 71 % son epífitas (Díaz 1999, Llamacho &
sus bajas densidades sugieren poca competencia intra Larramendi 2005).
o inter específica (Zotz & Hietz 2001). Además, los Una de las especies de orquídeas epífitas que
420 LANKESTERIANA
habitan en Cuba es Ionopsis utricularioides (Sw.) González & Pérez 2011). En cada forófitos se contaron
Lindl. (Ackerman 1995, Mujica et al. 2000, Llamacho todas las plantas de I. utricularioides y se anotaron las
& Larramendi 2005, Acevedo-Rodríguez & Strong siguientes variables: altura y diámetro de la rama en la
2012) (Figs. 1a–1b). Esta es una especie neotropical, que crecían, micrositio que ocupaban (tronco, ramas
con un amplio ámbito de distribución, que incluye o ramillas), clase de vida de las orquídeas (inmaduras
Florida, México, Antillas Mayores y Menores, América o adultas), orientación cardinal de las plantas sobre
Central, América del Sur e islas Galápagos (Ackerman el forófito y estado en el que crecían (solitarias o
1995, Mujica et al. 2000, Llamacho & Larramendi agregadas). En este estudio, el término forófito sólo
2005, FNA 2008). Es muy común encontrarla creciendo se utiliza para los árboles de naranjo que tenían I.
en zonas antropizadas (Ackerman 1995, Hágsater et utricularioides (García-González & Pérez 2011).
al. 2005, Llamacho & Larramendi 2005), asociada a
Altura y DAP de los naranjos —. La altura (m) de
plantaciones de cítricos, café y cacao (Hágsater et al.
todos los árboles de naranjo se estimó empleando
2005, Llamacho & Larramendi 2005).
una vara recta de madera, de 4 m de largo, graduada
Teniendo en cuenta que I. utricularioides es una
a intervalos de 50 cm (García-González et al. 2011).
especie que frecuentemente crece asociada a cultivos
El DAP (diámetro a la altura del pecho, a 1.30 m de
exóticos; se procedió a evaluar la organización espacial
altura) (cm) se determinó midiendo la circunferencia
de esta orquídea sobre arboles de Citrus sinensis (L.) (C) del tronco de todos los naranjos y luego aplicando
Osbeck (Rutaceae) y se estudiaron otras variables a este valor la fórmula DAP= C / π. De forma similar
relacionadas con su ecología en un agroecosistema se determinó la altura y diámetro de las ramas en las
en Pinar del Río, Cuba, para analizar la preferencia que crecían orquídeas.
que manifiesta por los espacios que ocupa sobre los
forófitos y determinar las respuestas adaptativas y Micrositios —. Se siguió la zonación vertical propuesta
morfológicas que le permiten ser exitosa en estas por García-González et al. (2011), para arbustos de café
condiciones antrópicas. (Coffea arabica L.) y se elaboró un sistema propio para
los árboles de naranjo (Fig. 1c), donde se eliminó el
Materiales y Métodos micrositio horquetas. Mediante observaciones previas
Caracterización del sitio —. El estudio se desarrolló al estudio se observó que en estos naranjos las horquetas
durante los años 2010 y 2011, en un huerto de eran pequeñas y estrechas, por lo que no presentaban
naranjos (C. sinensis), una especie frutal originaria características ecológicas (ej.: acumulación de materia
de las regiones tropicales y subtropicales de Asia orgánica, mayor presencia de musgos y líquenes) que
y el Archipiélago Malayo, introducida en el Nuevo las diferenciaran significativamente de las ramas.
Mundo en 1493 (ACTAF 2011). Este huerto, de • Tronco: de la base del árbol hasta el inicio de las
aproximadamente 0.375 ha (375 m²), se localiza en ramas primarias.
los 22°28’599’’N 083°37’678’’W, en la finca “La • Ramas: ramas con circunferencia >3 cm.
Juanita”, aproximadamente 10 km al noreste de la • Ramillas: ramas delgadas con circunferencia <3 cm.
ciudad de Pinar del Río, Cuba. El promedio anual Clases de vida —. Siguiendo la clasificación de García-
de precipitaciones en esta área es de 1600 mm, y las González et al. (2011), que reconocen tres estadios de
temperaturas promedio oscilan entre 23 y 25 °C (Díaz vida (plántulas, juveniles, adultos), se desarrolló una
& Cádiz 2008). En este huerto de naranjos crecen versión propia para este estudio, donde las plantas de I.
naturalmente diferentes especies de epífitas vasculares, utricularioides se clasificaron solo en dos estadios de
predominando I. utricularioides. vida: inmaduras (I) y adultas (A). Todas las plantas de
Unidad de muestreo —. Se identificaron todos los orquídea que presentaban indicios de floración actual o de
árboles de C. sinensis existentes en el huerto y se años anteriores, fueron incluidas en A, las restantes en I.
registró cuáles eran forófitos. En este estudio, el Orientación en el forófito —. Mediante cuatro tramos
término forófito sólo se utiliza para los árboles de de cuerda de 2 m, que fueron colocados en el suelo en
naranjo en los que crecía I. utricularioides (García- forma de cruz, teniendo como punto central el tronco
García-González & Riverón-Giró — Ecología de Ionopsis utricularioides 421
Figura 1. Ionopsis utricularioides (Sw.) Lindl.; A — plantas en árboles de naranjo; B — flores; C — zonación vertical de los ár-
boles de naranjo: Micrositio 1: tronco; Micrositio 2: ramas; Micrositio 3: ramillas (ilustración: Alfredo García-González).
de los naranjos, y empleando una brújula, se determinó Oriana (Versión 1.01) para la prueba de Uniformidad
la posición en que se encontraba ubicada cada orquídea Circular de Rayleigh, y SPSS 15.0 para hacer gráficos
en el forófito: norte (N), sur (S), este (E), oeste (O), de frecuencias con las categorías de altura (Bajo:
noroeste (NO), noreste (NE), sureste (SE) y suroeste 1.28-2.28 m, Medio: 2.29-3.28 m, Alto: 3.29-4.16 m)
(SO). y con las categorías de diámetro (Muy finas: 0.06-
0.47 cm, Medianamente finas: 0.48-0.79 cm, Finas:
Estado de las orquídeas (solitarias o agregadas)
0.8-2.8 cm) en las que se encontraron las plantas
—. Las plantas de I. utricularioides se dividieron en
de I. utricularioides en cada forófito. Los datos de
dos grupos, según lo planteado por Mujica (2007) y
altura y de diámetro se dividieron equitativamente
González et al. (2007) para Broughtonia cubensis
en tres categorías, teniendo en cuenta los mínimos
(Lindl.) Cogn:
• Plantas agregadas: Aquéllas que están en un y máximos donde se localizaron orquídeas en cada
radio de 10 cm o menos de otro individuo de I. forófito. Se aplicaron como estadísticos descriptivos
utricularioides o de otras especies de epífitas la media y la desviación estándar.
vasculares.
Resultados
• Plantas solitarias: Aquéllas que están en un
radio mayor de 10 cm de otro individuo de I. Organización espacial —. Se evaluaron un total de
utricularioides, de otras especies de epífitas 10 árboles para detectar la presencia de la orquídea.
vasculares, o habitando en solitario en un Estos árboles tienen una altura promedio de 4.11
forófito. ± 0.58 m, y un DAP promedio de 10.92 ± 1.74 cm
(Tabla 1). Se identificaron ocho forófitos en los que se
Análisis estadísticos —. Utilizando el programa contabilizaron 217 plantas de I. utricularioides (Tabla
StatXact-4 (Versión 4.0.1), se hizo una comparación 1). La mayor parte de las orquídeas se encontraron en
entre las frecuencias de aparición por medio de una la categoría “Medio” de altura (2.29-3.28 m) (Fig. 2),
prueba de Montecarlo. Este algoritmo se empleó
y en la categoría “Muy finas” de diámetro (0.06-0.47
en el caso de las variables: número de orquídeas
cm) (Fig. 3).
en cada micrositio, número de orquídeas creciendo
agregadas y creciendo solitarias, y número de Micrositios, clases de vida, orientación y estado
orquídeas que crecían agregadas con otras plantas de de las orquídeas—. En el tronco no se encontró
su misma especies y las agregadas con otras especies creciendo ninguna planta de I. utricularioides.
de epífitas vasculares. Se utilizaron los programas En las ramas se localizó 1.38 % de las orquídeas

422 LANKESTERIANA
Tabla 1. Árboles de naranjo estudiados, altura y diámetro a la altura del pecho (DAP) de cada uno, número de plantas
de Ionopsis utricularioides en cada forófito, micrositio donde se encuentran creciendo las orquídeas en cada forófito
(tronco, ramas o ramillas) y estadio de vida de cada planta de orquídea (I: inmaduras o A: adultas).
Árbol Altura (m) DAP (cm) No. de Tronco Ramas Ramillas Orquídeas por
orquídeas estadios de vida
I A
1 3.7 8.59 15 0 0 15 2 13
2 4.2 10.82 2 0 0 2 0 2
3 4.15 10.03 2 0 0 2 0 2
4 4.4 10.82 9 0 0 9 0 9
5 4.35 12.1 13 0 0 13 2 11
6 4 12.1 102 0 3 99 55 47
7 4.2 12.42 33 0 0 33 10 23
8 4.6 11.46 0 0 0 0 0 0
9 4.8 13.21 41 0 0 41 22 19
10 2.7 7.64 0 0 0 0 0 0
Total ---- ---- 217 0 3 214 91 126
Promedio 4.11 10.92 ---- ---- ---- ---- ---- ----
± 0.58 ± 1.74
contabilizadas y en las ramillas 98.61 % (Tabla 1), lo significativas (Montecarlo, p= 0.231), siendo
cual implica diferencias muy significativas entre ellos relativamente abundante en las dos clases (I: 41.9 %; A:
(Montecarlo, p< 0.001). 58.1 %) (Tabla 1). No hay una marcada preferencia de
El número de plantas de I. utricularioides I. utricularioides por ninguna orientación en particular
entre ambas clases de vida no presenta diferencias (Uniformidad Circular de Rayleigh, p= 0.75), aunque
Figura 2. Categorías de altura en las que se encontraron Figura 3. Categorías de diámetro en las que se encontraron las
las plantas de Ionopsis utricularioides en cada forófito plantas de Ionopsis utricularioides en cada forófito (Muy
(Bajo: 1.28-2.28 m, Medio: 2.29-3.28 m, Alto: 3.29- finas: 0.06-0.47 cm, Medianamente finas: 0.48-0.79 cm,
4.16 m) y número de plantas en cada categoría. Finas: 0.8-2.8 cm) y número de plantas en cada categoría.

Discusión. Se conoce poco acerca de la especificidad

de hospederos en las orquídeas (Walter 1991. Tremblay
et al. 1998. Llamacho & Larramendi 2005. Trapnell
& Hamrick 2006. Mujica et al. 2010), aunque se sabe
que algunas especies de árboles como Citrus spp., son
especialmente buenos hospederos para determinadas
especies de orquídeas (Walter 1991, Llamacho &
Larramendi 2005).
Pese a ser C. sinensis una especie exótica en Cuba
(ACTAF 2011), en este estudio es el único forófito en que
Figura 4. Orientación de Ionopsis utricularioides en los se localizó I. utricularioides, aunque se hicieron varios
forófitos (N: norte, S: sur, E: este, O: oeste, NE: noreste,
recorridos exploratorios en los parches remanentes de
NO: noroeste, SE: sureste, SO: suroeste).
bosque existentes en los alrededores de la población
de orquídeas estudiada. No obstante, en este sitio
C. sinensis es generalista, siendo capaz de albergar
otras especies de epífitas vasculares, específicamente
del género Tillandsia, aunque I. utricularioides es
predominante. Solo se localizó otra población de
I. utricularioides en cuatro árboles de naranjo (C.
sinensis) en una huerta abandonada, aproximadamente
a 3 km de la población analizada. Es muy probable
que de estas orquídeas se haya originado la población
estudiada, debido a que están relativamente cerca,
estos árboles de naranjo (C. sinensis) eran antiguos y
muchas de las I. utricularioides que los ocupaban eran
Figura 5. Estado en el que se encuentran creciendo las plan-
de mayor tamaño y aparentemente de mayor edad que
tas de Ionopsis utricularioides (solitarias o agregadas) y
especies con las que se encuentran agregadas (con otras
las de la población estudiada.
I. utricularioides o con otras epífitas vasculares). Luego de que las semillas de orquídea llegan a un
sustrato, su germinación y posterior establecimiento
las orientaciones con mayor número de plantas fueron depende de muchos factores bióticos y abióticos
E (16.1 %) y SO (16.6 %) (Fig. 4). (Trapnell & Hamrick 2006). La preferencia de I.
Gran parte de las plantas de I. utricularioides utricularioides por C. sinensis puede estar asociada
se encontraron creciendo en agregación (74.2 %), a la arquitectura, porte y características de la corteza
con otras orquídeas de la misma especie o con otras (Ter Steege & Cornelissen 1989; González et al.
especies de epífitas vasculares (Fig. 5), existiendo 2007), su composición química (González et al. 2007,
diferencias significativas entre el número de plantas Mujica et al. 2010) y la estructura de su cobertura de
creciendo agregadas y las que crecían solitarias copa, ramificación, tamaño y disposición de las hojas
(Montecarlo, p< 0.001). También existen diferencias (Benzing 1979). Citrus sinensis presenta una estructura
significativas entre las plantas creciendo agregadas con de copa poco densa y con abundancia de ramas finas.
I. utricularioides (94.4 %) y las agregadas con otras Otro factor que probablemente tenga gran influencia
especies de epífitas vasculares (5.6 %) (Montecarlo, en la selección de sustrato de I. utricularioides es la
p< 0.001). Las orquídeas que crecen agregadas tienen posible presencia del o los hongos micorrícicos con los
como promedio 2.93 ± 1.87 plantas en un radio de 10 que se asocia esta especie de orquídea para germinar y
cm. Sólo se encontraron otras dos especies de epífitas desarrollarse (Walter 1991, Otero et al. 2004, Trapnell
vasculares en agregación con I. utricularioides, estas & Hamrick 2006, Mujica 2007, Otero et al. 2007,
son: Tillandsia flexuosa Sw. (siete plantas) y Tillandsia Mujica et al. 2010, Raventós et al. 2011).
recurvata (L.) L. (dos plantas). Esta última afirmación requiere estudios más
424 LANKESTERIANA
enfocados para determinar la posible presencia Williams, una orquídea con porte y características
de hongos micorrícicos en el caso específico C. ecológicas similares a I. utricularioides, el micrositio
sinensis-I. utricularioides y determinar con cuales se preferido por la especie fue las ramas (García-González
relaciona esta especie de orquídea en este forófito. et al. 2011). En este caso la preferencia puede ser
Otero et al. (2004) y Otero et al. (2007), plantean consecuencia de las prácticas agroculturales que se
que I. utricularioides generalmente se asocia y es le hacen a la plantación de café (Coffea arabica L.),
más eficaz en la explotación de un efectivo clado de donde el extremo de las ramas se poda periódicamente,
hongos filogenéticamente estrecho, pertenecientes perdiéndose gran parte de las ramillas, eliminando
a los Ceratobasidium D.P. Rogers. Estos hongos con ellas las plantas que las ocupaban y limitando la
tienen una amplia distribución, y su asociación con disponibilidad de este microhábitat (García-González
I. utricularioides puede explicar en parte la amplia et al. 2011).
distribución geográfica y la abundancia de esta especie Las preferencias de micrositio y las adaptaciones
de orquídea (distribución geográfica y la abundancia morfológicas que muestra I. utricularioides, como ser
de esta especie de orquídea (Otero et al. 2004, Otero et plantas de porte pequeño a mediano (Ackerman 1995,
al. 2007). Mujica et al. 2000), tener hojas con cutículas muy
De los 10 árboles de naranjo estudiados, dos de gruesas para conservar el agua en los tejidos (Hágsater
igual porte, edad y bajo las mismas condiciones que los et al. 2005) y, en comparación con otras especies de
ocho restantes, se encontraban totalmente desprovistos orquídeas, tener raíces numerosas, delgadas, largas
de orquídeas (Tabla 1). Esto puede estar ocasionado por y morfológicamente adecuadas para curvarse y
circunstancias aleatorias en la dispersión de las semillas formar un entramado alrededor de los soportes finos
de I. utricularioides por el viento, pero es factible (Ackerman 1995, Mujica et al. 2000), concuerdan con
que en el futuro cercano estos naranjos también sean las características típicas de las llamadas orquídeas
colonizados. Es muy probable que el primer forófito de ramilla (Hágsater et al. 2005), lo que coincide con
colonizado, a partir del cual comenzó la expansión, lo planteado por Ackerman (1995). No está del todo
haya sido el árbol número 6, que es el que cuenta con el claro como estas orquídeas obtienen los nutrientes
mayor número de orquídeas de forma general (Tabla 1) que necesitan y algunos autores sugieren que pueden
y el mayor número de orquídeas, tanto inmaduras como ser parcialmente parásitas de sus árboles hospederos
adultas (Tabla 1). Las orquídeas adultas de este forófito (Ruinen 1953). Frecuentemente crecen en ramillas
también son las más grandes y desarrolladas. muertas o poco vigorosas, pero no existe evidencias de
Se pueden encontrar plantas de I. utricularioides que obtengan nutrientes de sus hospederos (Hágsater
a lo largo y ancho de la copa de los naranjos, pero et al. 2005). De la biología de este tipo de orquídeas
manteniéndose generalmente en las ramas finas y aún se desconocen muchos aspectos, planteándose
expuestas de los árboles (Fig. 2 y Fig. 3), con una por ejemplo que florecen a muy temprana edad (unos
marcada ausencia de orquídeas en el tronco, escases meses o un año después de germinar) y que tienen
en las ramas y abundancia en las ramillas (Tabla 1). tiempos generacionales muy cortos (de 1-5 años),
Esta distribución probablemente esté relacionada siendo un fenómeno muy raro entre las plantas epífitas,
con lo planteado por Johansson (1974) y Krömer et que suelen ser muy longevas (Hágsater et al. 2005).
al. (2007), cuando afirman que las epífitas vasculares Dentro del microhábitat ramillas también se
tienden a mostrar patrones de distribución vertical en pueden apreciar pequeñas diferencias de ubicación
sus forófitos que reflejan su rango de tolerancia a la entre las alturas a las que se encontraron las orquídeas
luz, la humedad y otras adaptaciones ecofisiológicas. y entre los diámetros donde crecen (Fig. 2 y Fig. 3).
La preferencia de I. utricularioides por las ramillas La categoría “Muy finas” de diámetro (0.06-0.47 cm)
probablemente se encuentra estrechamente relacionado está acorde con las características de las orquídeas de
con la mayor intensidad luminosa en este micrositio. ramilla, pero manteniendo esta preferencia, crecen
En estudios análogos desarrollados en cafetales más fácilmente en la categoría “Medio” de altura
de sombra en el Soconusco, Chiapas, México, con (2.29-3.28 m), donde cuentan con las condiciones para
Oncidium poikilostalix (Kraenzl.) M.W. Chase & N.H. las que están adaptadas y al mismo tiempo están más
protegidas que en la categoría “Alto” (3.29-4.16 m). frecuencia por barrancos ubicados al sudeste del área,
La relativa abundancia de I. utricularioides tanto principalmente vientos del este y del noreste.
adultas, como inmaduras (Tabla 1), indica una población Al igual que ocurre con I. utricularioides, González
equilibrada, con una saludable tasa de reclutamiento et al. (2007) y Raventós et al. (2011) reportan que
y recambio. Las plantas inmaduras garantizan el en el Parque Nacional Guanahacabibes, Cuba, es
relevo de las posibles bajas que ocurren de forma más frecuente encontrar a B. cubensis creciendo en
natural (Mujica 2007). La predominancia de orquídeas parches o en agregación, fenómeno habitual en muchas
adultas (Tabla 1) refleja una población establecida y especies de orquídeas epífitas (Ackerman 1995;
madura, con abundancia de plantas reproductoras, Tremblay 1997). También similar a I. utricularioides,
que garantizan en gran medida el mantenimiento y B. cubensis se agrega más comúnmente con plantas de
la expansión de la especie hacia nuevos nichos no su misma especie, pero a continuación los vecinos más
ocupados, siendo la etapa adulta la más importante de usuales fueron cuatro especies de orquídeas, aunque
la vida de las orquídeas (Zotz 1998; Winkler & Hietz esta agregación interespecífica es rara (González et al.
2001; García-Soriano 2003; Mondragón 2009). No 2007).
obstante, es conveniente profundizar en los estudios El micrositio principal que ocupa I. utricularioides
reproductivos de esta especie, para lograr obtener en los forófitos (Tabla 1), probablemente esté
datos cuantitativos relativos a su tasa de floración, directamente relacionado con que la especie potencie
polinización, germinación y mortalidad en este sitio, el patrón agregado por encima del patrón solitario
que permitan apreciar exactamente el estado actual (Fig. 5). Aunque como plantea González et al. (2007),
de la población y su posible comportamiento y es posible que entre las I. utricularioides que crecen
permanencia en el futuro. agregadas se establezcan relaciones de competencia
Ionopsis utricularioides no muestra ninguna intraespecífica o de competencia interespecífica con
preferencia de orientación cardinal en el forófito (Fig. las especies de Tillandsia, y que esto sea una de las
4). Probablemente en este caso las plantas germinen fuerzas que condicionan la estructura y dinámica de
y se establezcan indistintamente en cualquiera de las la población, es probable que luego de eliminar el
orientaciones donde sean depositadas las semillas exceso de competidores, se establezca un equilibrio
por el viento y encuentren las condiciones adecuadas, beneficioso entre las plantas agregadas sobrevivientes.
siendo más susceptible esta especie de orquídea a la Generalmente las ramillas es el microhábitat con menor
influencia de factores como la luz y el grosor de la rama. disponibilidad de recursos para la orquídea (Chase
El mayor número de plantas en las orientaciones E y 1987. Brown 1990. Gravendeel et al. 2004. Hágsater
SO (Fig. 4) puede ser completamente aleatorio, por lo et al. 2005, Mondragón et al. 2007), por lo que las
que la diferencias no son significativas en comparación plantas de I. utricularioides que crecen agregadas
con el resto de las orientaciones (Fig. 4). No obstante, con otras de la misma especie o con otras especies de
la ubicación de las orquídeas en una u otra orientación epífitas vasculares, forman entramados de raíces que
probablemente también pueda estar determinada por pueden funcionar como cestas, brindándoles a estas
la dirección y velocidad predominante de los vientos orquídeas mayores ventajas competitivas y mayores
del área (González et al. 2007), las necesidades posibilidades de supervivencia, al ser capaces de
particulares de luz y humedad de esta especie y la retener mejor la humedad y acumular mayor cantidad
orientación de los sitios donde se encuentran las plantas de materia orgánica y partículas de polvo.
en los forófitos, en relación con los demás árboles que Por otro lado, dado que las ramillas es la porción
los rodean (Mujica 2007). Por ejemplo, Tremblay y más delgada de los árboles, con altos niveles de
Velázquez (2009), en el Bosque Nacional El Yunque, perturbación e inestabilidad (Chase 1987, Brown
en Puerto Rico, encontraron que la orquídea Lepanthes 1990, Gravendeel et al. 2004, Hágsater et al. 2005,
eltoroensis Stimson si manifiesta preferencia por Mondragón et al. 2007), las acumulaciones de
crecer en el lado noroeste de los troncos de los árboles raíces también pueden ayudar a las plantas que
que ocupa, probablemente a consecuencia de los crecen agregadas a permanecer ancladas al soporte
constantes vientos que suben del mar Caribe, con más y por tanto, a perdurar. En éste microhábitat, para I.
426 LANKESTERIANA
utricularioides, representa una ventaja tener el mayor Díaz, M. A. 1999. Orquídeas cubanas: Pasado, presente y
número posible de raíces, extenderlas alrededor de futuro. Seminario Mesoamericano de Orquideología y
la propia ramilla y de las ramillas vecinas, y formar Conservación. Universidad de Costa Rica, San José,
Costa Rica.
entramados con las raíces de las epífitas con las que
Díaz, L. M. & A. Cádiz. 2008. Guía taxonómica de los
crece agregada, logrando un anclaje firme frente a
anfibios de Cuba. Figura 3 (Regiones climáticas de
tempestades, fuertes vientos o si se seca y quiebra su Cuba). Volumen 4. Abc Taxa. Belgian Development
ramilla. Es muy frecuente observar I. utricularioides Cooperation.
solitarias o grupos de éstas, que perdieron su ramilla y FNA (Flora of North America). 2008. Ionopsis
se sostienen colgando de sus entramados de raíces que utricularioides (Swartz) Lindley. Orchidaceae. Vol.
se extienden a otras ramillas. Generalmente en estos 26: 646-647. (Consultado: 20 de julio de 2011, http://
casos los grupos de I. utricularioides se sostienen más www.efloras.org/florataxon.aspx?flora_id=1&taxon_
id=116467).
firmemente, mientras las plantas solitarias se aprecian
García-González, A., A. Damon., L. G. Esparza & J.
con un anclaje más endeble y más propensas a caer al Valle-Mora. 2011. Population structure of Oncidium
suelo y morir. poikilostalix (Orchidaceae), in coffee plantations in
Soconusco, Chiapas, México. Lankesteriana 11: 23-32.
Agradecimientos. Agradecemos a la familia García, García-González, A. & R. Pérez. 2011. La comunidad
propietarios de la finca “La Juanita”, por el apoyo brindado orquideológica en la Reserva de la Biosfera Sierra del
en la realización de este estudio. Al Lic. Yoeslandy García Rosario, Cuba. Rev. Biol. Trop. 59: 1805-1812.
Marsilio por su importante colaboración en el trabajo García-Soriano, R. 2003. Demografía, manejo y
de campo. Al Dr. Dennis Denis Ávila, por sus valiosos conservación de Artorima erubescens en Oaxaca,
conocimientos, puestos en función de este estudio. orquídea endémica del sur de México. Tesis en opción
A la organización IDEA WILD por el equipamiento al grado científico de Master en Ciencias. Universidad
proporcionado, fundamental para la realización de este Autónoma de Yucatán, Mérida, México.
trabajo. A los dos revisores anónimos que tuvieron a su González, E., J. Raventós, E. Mújica & A. Bonet. 2007.
cargo la corrección del manuscrito original, por su tiempo Estructura y ecología de la población del endemismo
y dedicación. cubano Broughtonia cubensis (Orchidaceae), en Cabo
San Antonio, Península de Guanahacabibes, provincia
de Pinar del Río, Cuba. Lankesteriana 7: 469-478.
Literatura Citada Gravendeel, B., A. Smithson, F. J. W. Slik & A. Schuiteman.
Acevedo-Rodríguez, P. & M.T . Strong. 2012. Catalogue 2004. Epiphytism and pollinator specialization: drivers
of seed plants of the West Indies. Smithsonian for orchid diversity?. Phil. Trans. R. Soc. Lond. B.
Contributions to Botany. Number 98. Smithsonian Hágsater, E., M. Soto, G. Salazar, R. Jiménez, M. López &
Institution Scholarly Press, Washington D.C. R. Dressler. 2005. Las orquídeas de México. Productos
Ackerman, J. D. 1995. An orchid flora of Puerto Rico and Farmacéuticos, S.A. de C.V. Instituto Chinoin. México
the Virgin Islands. The New York Botanical Garden, D.F., México.
Memoirs 73. Nueva York, E.U. Johansson, D. 1974. Ecology of vascular epiphytes in West
ACTAF (Asociación Cubana de Técnicos Agrícolas y African Rain Forest. Acta Phytogeogr. Suecica 59:1-
Forestales). 2011. Instructivo técnico para el cultivo 129.
de los cítricos. Biblioteca ACTAF. Instituto de Krömer, T., M. Kessler & S. R. Gradstein. 2007. Vertical
Investigaciones en Fruticultura Tropical (IIFT), Cuba. stratification of vascular epiphytes in submontane and
Ministerio de la Agricultura (MINAGRI), Cuba. montane forest of the Bolivian Andes: the importance
Benzing, D. H. 1979. Alternative interpretations for the of the understory. Plant Ecol. 189: 261-278.
evidence that certain orchids and bromeliads act as Llamacho, J. A. & J. A. Larramendi. 2005. Las orquídeas
shoot parasites. Selbyana 5: 135-144. de Cuba. Greta, Sevilla, España.
Brown, A. D. 1990. El epifitismo en las selvas montanas Mondragón D. 2009. Population viability analysis for
del Parque Nacional “El Rey”, Argentina: composición Guarianthe aurantiaca, an ornamental epiphytic
florística y patrón de distribución. Rev. Biol. Trop. 38: orchid harvested in Southeast México. 24: 35-41.
155-166. Mondragón, D., C. Maldonado & R. Aguilar-Santelises.
Chase, M. W. 1987. Obligate twig epiphytism in the 2007. Life history and demography of a twig epiphyte:
Oncidiinae and other Neotropical orchids. Selbyana A case study of Erycina crista-galli (Orchidaceae).
10: 24-30. Selbyana 28: 137-144.
Mujica, E. 2007. Ecología de las orquídeas epífitas and Ecology of vascular epiphytes in lowland rain
Broughtonia cubensis (Lindley) Cogniaux, forest of Guyana. Biotropica 21: 331-339.
Dendrophylax lindenii (Lindley) Bentham et Rolfe y Trapnell, D. W. & J. L. Hamrick. 2006. Variety of
Encyclia bocourtii Mújica et Pupulin en el Cabo San Phorophyte species colonized by the neotropical
Antonio, Península de Guanahacabibes, Cuba. Análisis epiphyte, Laelia rubescens (Orchidaceae). Selbyana
espacio-temporal e implicaciones del impacto de 27: 60-64.
un fenómeno atmosférico severo. Tesis en opción al Tremblay, R. L. 1997. Distribution and dispersion
grado científico de Doctor en Ciencias. Universidad de patterns of individuals of nine species of Lepanthes
Alicante, España. (Orchidaceae). Biotropica 29: 38-45.
Mujica, E., J. Raventós & E. González. 2010. Análisis de Tremblay, R. L. & J. Velazquez. 2009. Circular distribution
la selección de sustrato por parte de Dendrophylax of an epiphytic herb on trees in subtropical rain forest.
lindenii (Orchidaceae) en Cabo San Antonio, Tropical Ecology 50: 211-217.
Península de Guanahacabibes, Pinar del Río, Cuba. Tremblay, R. L., J. K. Zimmerman, L. Lebrón, P. Bayman,
Lankesteriana 9: 533-540. I. Sastre, F. Axelrod & J. Alers-García. 1998. Host
Mujica, E., R. Pérez, J. L. Bocourt, P. J. López & T. M. specificity and low reproductive success in the rare
Ramos. 2000. Géneros de orquídeas cubanas. Felix endemic Puerto Rico orchid Lepanthes caritensis.
Varela, La Habana, Cuba. Biological Conservation 85: 297-304.
Otero, J. T., J. D. Ackerman & P. Bayman. 2004. Walter, D. S. 1991. Orchidaceae. En: Janzen, D.H.
Differences in mycorrhizal preferences between two (edit.). Historia natural de Costa Rica. Editorial de la
tropical orchids. Molecular Ecology 13: 2393-2404. Universidad de Costa Rica.
Otero, J. T., N. S. Flanagan, A. E. Herre, J. D. Ackerman & Winkler, E. & P. Hietz. 2001. Population of three epiphytic
P. Bayman. 2007. Widespread mycorrhizal specificity orchids (Lycaste aromatica, Jacquiniella leucomelana,
correlates to mycorrhizal function in the neotropical, and J. teretifolia) in a Mexican humid montane forest.
epiphytic orchid Ionopsis utricularioides (Orchidaceae). Selbyana 22: 27-33.
American Journal of Botany 94: 1944-1950. Zotz, G. 1998. Demography of the epiphytic orchid,
Raventós, J., E. Mujica, T. Wiegand & A. Bonet. 2011. Dimerandra emarginata. J. Trop. Ecol. 14: 725-741.
Analyzing the spatial structure of Broughtonia Zotz, G. & G. Schmidt. 2006. Population decline in the
cubensis (Orchidaceae) populations in the dry forests epiphytic orchid Aspasia principissa. Biol. Conserv.
of Guanahacabibes, Cuba. Biotropica 43: 173-182. 129: 82-90.
Ruinen, J. 1953. Epiphytosis. A second view on epiphytism. Zotz, G. & P. Hietz. 2001. The ecophysiology of vascular
Annales Bogorienses 1: 101-157. epiphytes: current knowledge, open questions. J.
Ter Steege, H. & J. H. C. Cornelissen. 1989. Distribution Exper. Bot. 52: 2067-2078.

LANKESTERIANA
LANKESTERIANA 13(3): 429–430. 2014.
REVIEWERS OF THE MANUSCRIPTS

SUBMITTED TO LANKESTERIANA, VOL. 13
The Editor-in-Chief, Managing Editor, Editorial Committee, Editorial Board and Editorial staff of
Lankesteriana acknowledge the reviewers listed below for their willing cooperation. It is greatly appreciated
that they have generously invested their time and competence in providing valuable comments and advice, for
the benefits of the authors, the editorial staff, and the readers of Lankesteriana.
James D. Ackerman, Department of Biology and Center Günter Gerlach, Botanischer Garten München–
for Applied Tropical Ecology and Conservation, Nymphenburg, Münich, Germany.
University of Puerto Rico, San Juan, PR, U.S.A.
Barbara Gravendeel, Naturalis Biodiversity Center –
Jesús Aguirre Gutierrez, Naturalis Biodiversity NHN Leiden University, The Netherlands.
Center – NHN Leiden University, The Netherlands.
Eric Hágsater, Herbario AMO, México D.F., México.
Rafael Arévalo Burbano, University Of Wisconsin,
Madison, U.S.A. Wesley E. Higgins, The American Orchid Society,
Coral Gables, U.S.A.
Cássio van den Berg, Univ. Estadual de Feira de
Santana, Feira de Santana, Brazil. Luko Hilje, Centro Agronómico Tropical de Investi-
gación y Enseñanza (CATIE), Costa Rica.
Diego Bogarín, Lankester Botanical Garden,
University of Costa Rica. Rudolf Jenny, Jany Renz Herbarium, University of
Basel, Switzerland.
Ken Cameron, University of Wisconsin, Madison, WI,
U.S.A. Rolando Jiménez, Herbario AMO, México D.F.,
México.
Germán Carnevali, Centro de Investigaciones
Científicas de Yucatán, México. Carlyle A. Luer, Missouri Botanical Garden, U.S.A.
Guy Chiron, Herbiers, Claude Bernard University Ernesto Mujica, Centro de Investigaciones y Servicios
Lyon 1, France. Ambientales Ecovida, Pinar del Rio, Cuba.
Benjamin Collantes Meza, Inka Terra Association Carlos Ossenbach, Orquideario 24 de mayo, Sabanillas
(ITA), Peru. de Montes de Oca, Costa Rica.
Phillip J. Cribb, Royal Botanic Gardens, Kew, U.K. Joel Tupac Otero Ospina, Universidad Nacional de
Stig Dalström, Lankester Botanical Garden, Colombia.
University of Costa Rica, and National Alec M. Pridgeon, Sainsbury Orchid Fellow, Royal
Biodiversity Centre, Serbithang, Bhutan. Botanic Gardens, Kew, U.K.
Nicolas Davin, Naturalis Biodiversity Center – NHN Rafael Rincón, Herbario UCH, Universidad Autónoma
Leiden University, The Netherlands. de Chiriquí, Panama.
Calaway Dodson, Missouri Botanical Garden, U.S.A. David A. Roberts, Durrell Institute of Conservation
Robert L. Dressler, Lankester Botanical Garden, and Ecology, University of Kent, U.K.
University of Costa Rica.
Gustavo A. Romero–González, Harvard University
Lorena Endara, Florida Museum of Natural History, Herbaria, Harvard University, Cambridge,
University of Florida, U.S.A.. Massachusetts, U.S.A.
Melania Fernández, Lankester Botanical Garden, Gerardo A. Salazar Chávez, Instituto de Biología,
University of Costa Rica. Universidad Nacional Autónoma de México.
430 LANKESTERIANA
Luis Sánchez Saldaña, Herbario AMO, México D.F., Raymond Tremblay, University of Puerto Rico – Río
México. Piedras, PR, U.S.A.
Lisa Thoerle, The Orchid Digest, Laguna Niguel, CA, Jorge Warner, Lankester Botanical Garden, University
U.S.A. of Costa Rica.
Rodolfo Solano Gómez, Universidad Nacional Autó- W. Mark Whitten, Florida Museum of Natural History,
noma de México. University of Florida, U.S.A..

Revista LANKESTERIANA

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Revista LANKESTERIANA

Uploaded by

Copyright:

Available Formats

ISSN 1409-3871

VOL. 13, No. 3 JANUARY 2014

Instalación de la primera Junta Asesora del Jardín Charles Lankester

New species and records of Orchidaceae from Costa Rica. III

El grupo Epidanthus, subgrupo Selaginella de Epidendrum

What is in a orchid name: a tribute to the early naturalists in Costa Rica

Lankesteriana, a new genus in Pleurothallidinae (Orchidaceae)

The first ten years of Selby Gardens

Consideraciones sobre la historia de la prioridad taxonómica de Oncidium

A new species of Vanilla (Orchidaceae) from the Colombian Pacific region

Charles H. Lankester (1879–1969): his life and legacy

Generic and subtribal relationships in Neotropical Cymbidieae (Orchidaceae)

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

A new large-flowered Odontoglossum (Orchidaceae: Oncidiinae) from the

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

Copyright © 2014 Lankester Botanical Garden, University of Costa Rica

Layout: Jardín Botánico Lankester.

Printed in Costa Rica / Impreso en Costa Rica

R Lankesteriana / International Journal on Orchidology

1. Botánica - Publicaciones periódicas, 2. Publicaciones

Instalación de la primera Junta Asesora

Rafael Lucas Rodríguez Caballero †

Escuela de Biología, Universidad de Costa Rica

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

RAPID TRANSFORMATION OF ORCHID FLORAS

Key words: Orchidaceae, conservation, resiliency, floristic change, forest recovery

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

1042-1045. Doi10.1038/nature06039 E.M. III, Everham, D.J. Lodge, C.M. Taylor, D.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

FROM CUBA TO MOST OF THE NEOTROPIC:

João A. N. Batista1,3, Karina Proite1, Bruno M. Carvalho1, Aline A. Vale1

Key words: Biogeography, cytogenetics, molecular phylogenetics, Orchidinae, taxonomy

Taxon Voucher Origin ITS matK

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

H. bicornis H. caldensis H. exaltata H. rodeiensis

Anterior petal 6.8–8.8 8–13 1.2–4.4 4.5–6(7)

Ovary length (mm) 13–28 10–14 11–15 12–16

Pedicel length (mm) 2.3–6 5–8 1.5–4.4 18–28

Spur length (mm) 25–46 32–41 28–35 28–36

Spur clavate clavate linear linear

Spur apex subacute to acute rounded acute acute

Hemipollinaria separated united separated united

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

to 6. In the strict consensus of the parsimony analysis

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

Key to Habenaria bicornis and morphologically similar species

Mexico and Central America 2 2 1 8

Northeastern Brazil and northern South

Central and southeastern Brazil 4 1 7

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

Appendix. Additional specimens examined of morphological similar species.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

ILLUSTRATIONS AND STUDIES IN NEOTROPICAL ORCHIDACEAE.

Diego Bogarín1,2,3, Zuleika Serracín2 & Zabdy Samudio2

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

The combination of whitish flowers with dispersed

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.

Column greenish-yellowish, greenish-yellowish, 6.0 mm greenish-yellowish, 9 mm greenish, immaculate 5.4 mm greenish-yellowish, 12 mm

LANKESTERIANA 13(3), January 2014. © Universidad de Costa Rica, 2014.