Diversity Garcinia Species in The Western Ghats. Phytochemical Perspective

Diversity of Garcinia species in the Western Ghats:
Phytochemical Perspective
Editor
K. B. Rameshkumar
Jawaharlal Nehru Tropical Botanic Garden and Research Institute

Thiruvananthapuram
Title: Diversity of Garcinia species in the Western Ghats: Phytochemical Perspective
Editor: K. B. Rameshkumar
Published by: Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode,
Thiruvananthapuram 695 562, Kerala, India
ISBN No.: 978-81-924674-5-0
Printed at: Akshara Offset, Thiruvananthapuram- 695 035
Copyright © 2016: Editor and Publisher
All rights reserved. This book may not be reproduced in whole or in part without the prior
written permission of the copyright owner.
ii
Foreword
I am delighted to write a Foreword to the Book ‘Diversity of Garcinia species in the Western
Ghats: Phytochemical Perspective’ edited by my student Dr. K. B. Rameshkumar who took
Garcinia imberti as a subject for his doctoral studies. It gives me all the more pleasure and
gratification to see that he continued with his studies on Garcinia species of the Western
Ghats along with his students and colleagues. Unlike many other doctoral students, he kept
alive his passion for the studies on Garcinia and the present book is the outcome of his
dedicated efforts during the last one and a half decades. Pursuit of science is a passion and
unravelling the subtleties of nature is an ecstasy which fulfils the inner urge for quest and
discovery.
The genus Garcinia is important by virtue of their reputation in traditional medicines,
established pharmacological activities, diversity in chemical structures and potential
nutritional properties. Despite recent progress in phytochemical and pharmacological studies
on Garcinia species world over, significant gaps still exist concerning the exploration of the
vast data on phytochemical diversity of Garcinia species. The present book provides a
comprehensive and updated report on different aspects including distribution, conservation,
morphology, chemotaxonomy, molecular taxonomy and pharmacology of Garcinia plants,
with emphasis on Western Ghats species. Its specific focus on the Phytochemistry of
Garcinia species is a great contribution to the lesser known subject Phytochemistry,
especially in India. The authors are experts in their relevant field of research, as revealed by
the contents and the in-depth presentation of individual chapters. The compiled data may
provide useful clues to promote further investigations for the development of new lead
molecules and value added products from Garcinia species. Furthermore, the book will give
basic information on possible conservation strategies for the Western Ghats Garcinia plants. I
personally am privileged to present this elegant work on ‘Phytochemistry of Garcinia
species’ before the scientific community.
Prof. Dr. V. George Ph.D., FRSC

Director
Amity Institute of Phytochemistry and Phytomedicine
Thiruvananthapuram
iii
iv
Preface
The plant kingdom represents an extraordinary reservoir of molecules, that can be beneficial
to mankind in several ways and currently there is a worldwide interest in the use of natural
products, particularly plant derived products. The Western Ghats, one among 36 global
biodiversity hotspots, harbors one of the finest tropical forests in the world. A recent
enumeration has identified nearly 7500 flowering plants in the Western Ghats, of which more
than 1250 are endemic to the region. Literature review revealed that nearly 80% of the
endemic flowering plants of the region are hitherto uninvestigated for their chemical
constituents, bioactivities or potential utilities. Garcinia species are one among such least
explored group of plants, represented by 9 species and 2 varieties in the Western Ghats, of
which 7 species and 2 varieties are endemic to the region. The genus Garcinia is important as
a source of edible fruits, edible fats like kokum butter, oleoresin and coloring agents, the
much valued anti-obesity phytochemical hydroxycitric acid (HCA) and other bioactive
compounds like biflavonoids and xanthones. Due to the diversity of natural products and the
presence of high value compounds, several industrial sectors like pharmaceutical,
nutraceutical, paint and food additives are centred around this potential group of trees. In
south India, G. gummi-gutta and G. indica are cultivated for commercial extraction of a
variety of products such as bioactive acids, nutraceuticals, fats and condiments.
Literature review reveals that out of the nearly 250 Garcinia species, 120 species have
so far been investigated for their chemical constituents. Garcinia species are found to be rich
sources of structurally diverse secondary metabolites such as xanthones, benzophenones and
biflavonoids, in addition to flavonoids, biphenyls, phloroglucinols, depsidones and
triterpenoids as minor constituents. Though the Western Ghats has a rich diversity of
Garcinia species, only a few species are exploited sustainably for their potential utilities. The
rich floristic wealth can be harvested profitably by taking advantage of the developments in
phytochemical analytical techniques. Phytochemistry, being an interdisciplinary subject
linked to different disciplines, the present book also includes recent research activities in the
fields such as botany, pharmacology and plant biotechnology of the genus. It is expected that
the effort will open new vistas of knowledge and prove to be an excellent exposition of
current research efforts in India in the field of Phytochemistry.
K. B. Rameshkumar
v
vi
Acknowledgements
First of all I would like to extend my profound thanks and sincere gratitude to my research
guide, Dr. V. George, who introduced me to the fascinating world of plant chemistry. I am
also indebted to the taxonomists of JNTBGRI for introducing me to the unexplored and
fascinating world of tropical forest flora.
This book is indeed the result of the scholarly inputs from different experts and I would like
to extend profound gratitude to all of the authors for their sincere efforts.
I also wish to acknowledge the assistance by the research students Mr. A. P. Anu Aravind
and Mr. P. S. Shameer for their enduring effort during the preparation of the book.
This book is produced through the financial support of Kerala State Council for Science
Technology and Environment (KSCSTE), SRS project entitled ‘Biflavonoids from Garcinia
species- Chemical, Molecular and Pharmacological Evaluation’ (No.
008/SRSPS/2011/CSTE). The support of STP Division, KSCSTE and the advice and
suggestions of the experts of SRS-GMW in successful completion of the project is also
thankfully acknowledged here.
A special thanks to my family for their understanding and support during the time of
producing this book.
K. B. Rameshkumar
vii
viii
Contents Page
No.
1. 2. Foreword 3. 4. iii
5. 6. Preface 7. 8. v
9. Acknowledgements vii
Chapters
1 Diversity of Garcinia species in the Western Ghats 1

P. S. Shameer, K. B. Rameshkumar and N. Mohanan
2 Structural diversity of secondary metabolites in Garcinia species 19
A. P. Anu Aravind, Lekshmi N. Menon and K. B. Rameshkumar
3 Phytochemical investigation of the Western Ghats endemic species Garcinia imberti 76
Bourd.
K. B. Rameshkumar, Renu Pandey, Lekshmi N Menon, Brijesh Kumar and V. George
4 Phytochemical investigation of the Western Ghats endemic species Garcinia 87
travancorica Bedd.
A. P. Anu Aravind, Renu Pandey, Brijesh Kumar and K. B. Rameshkumar
5 Leaf volatile chemical profiles of Garcinia species in the Western Ghats 101
K. B. Rameshkumar, A. P. Anu Aravind and Lekshmi N. Menon
6 Rapid estimation of bioactive constituents of Garcinia species in the Western Ghats 113
using UHPLC-MS/MS method
Renu Pandey, Brijesh Kumar and K. B. Rameshkumar
7 Morphological, chemical and molecular taxonomy of a new Garcinia species- Garcinia 123
pushpangadaniana Sabu et al.
P. S. Shameer, K. B. Rameshkumar, A. R. Sivu, T. Sabu, N. S. Pradeep and N. Mohanan
8 Diversity of Malabar Tamarind (Garcinia gummi-gutta (L.) N. Robson) in the Western 132
Ghats- Morphological and phytochemical evaluation
P. S. Shameer, K. B. Rameshkumar, T. Sabu and N. Mohanan
9 Phytochemicals and bioactivities of Garcinia indica (Thouars) Choisy- A review 142
R. Ananthakrishnan and K.B. Rameshkumar
10 Phytochemicals and bioactivities of Garcinia gummi- gutta (L.) N. Robson- A review 151
V. Anju and K.B. Rameshkumar
11 Gamboge- The bark exudate from Garcinia species 162
Siji Aral and K.B. Rameshkumar
12 Nutrient properties of important Garcinia fruits of India 170
Utpala Parthasarathy and O. P. Nandakishore
13 Antioxidant and antibacterial activities of Garcinia species in the Western Ghats 179
A. P. AnuAravind, T. G. Nandu, S. Shiburaj and K. B. Rameshkumar
14 Antioxidant and cytotoxic activities of Fukugiside- The major biflavonoid from Garcinia 187
travancorica Bedd.
A. P. Anu Aravind and K. B. Rameshkumar
15 Molecular characterisation of Garcinia species in the Western Ghats 196
A. R. Sivu, N. S. Pradeep and K. B. Rameshkumar
List of authors 202
ix
JNTBGRI Diversity of Garcinia species in the Western Ghats: Phytochemical Perspective
Chapter 1
Diversity of Garcinia species in the Western Ghats
P. S. Shameer1, K. B. Rameshkumar2 and N. Mohanan1,*
1
Garden Management, Education, Information and Training Division
2
Phytochemistry and Phytopharmacology Division
Palode, Thiruvananthapuram-695562, Kerala, India
*
Corresponding author
Abstract
The Western Ghats, being one of the hotspots of biodiversity, support an enormous plant
wealth. The genus Garcinia is an important component of the flora of the Western Ghats and
is well known for their edible fruits and nutraceutical properties. The present chapter
elaborates the diversity and distribution of Garcinia species in the Western Ghats.
Conservation status of Garcinia species of the Western Ghats has also been revised. Field
surveys, herbarium examinations and literature references revealed that there are 9 species
and 2 varieties of the genus indigenous to the Western Ghats of which 7 species and 2
varieties are endemic to the region. The diversity of floral morphology, leaf morphology and
fruit morphology were elaborated along with a dichotomous key to the Western Ghats
species.
Key words: Garcinia, Clusiaceae, Western Ghats, Diversity, Conservation
Introduction
The dioecious genus Garcinia is the largest genus within the family Clusiaceae (formerly
Guttiferae) and comprises nearly 250 species world over. Garcinia species are generally
small or medium sized evergreen trees, (occasionally shrubs: G. buchneri Engl.), and are
distributed in pantropical regions, with high species richness in South-East Asia (Figure 1).
The centre of diversity of Garcinia species is the Malaysian region, with some species
reaching India and the Micronesian islands and also extending to tropical Africa and the
Neotropics (Rogers and Sweeney 2007, Stevens, 2007, Jones, 1980, Sharma et al., 2013,
Nimanthika and Kaththriarchi 2010).
The genus name Garcinia honours the Dutch army doctor and naturalist Laurentius
Garcin (1683-1752), who described the fruiting specimen of mangosteen collected from
Moluccas, the Maluku islands, Indonesia (Garcin, 1733). This species was later named
Garcinia mangostana by Linnaeus in 1753, which became the type species for the genus. The
family Guttiferae was created by Jussieu (1789) based on the presence of the exudates
secreted from cut stems and leaves. Thereafter, several monumental works such as that of
Hooker (1875), Engler (1925), Robson (1961), Whitmore (1973) and Bamps (1978) reviewed
the taxonomic status of Garcinia in different parts of the world. The first review of Indian
Garcinia was in the ‘Flora of British India’, where Anderson describes 30 species in British
India and including the pentamerous group also in section Xanthochymus (Anderson, 1874).
1
Diversity of Garcinia species in the Western Ghats: Phytochemical Perspective JNTBGRI
Maheshwari in 1964, describes 31 species as naturally distributed in India (Maheshwari,

1964). In Flora of India, Singh (1993) included 34 indigenous Garcinia species.
India is one among the 12 megadiversity nations of the world. The wide range of
climatic and topographical features have resulted in a high level of ecosystem diversity
encompassing forests, wetlands, grasslands, deserts, coastal and marine ecosystems, each
with unique assemblage of species. The Western Ghats, a mountain range that runs
nearly1,600 km, extends from the west coast of peninsular India from the river Tapti in north
to Kanyakumari in south. It is perhaps the most important centers of biodiversity and floristic
wealth in India. The region is a UNESCO World Heritage Site and also one among the 36
global biodiversity hot spots in the world. Among the 36 global biodiversity hotspots,
Western Ghats occupies 5th position in the economic potential of its biological resources.
Over 7,500 species of flowering plants, comprising about 27% of the Indian flora, were
reported from the region, of which nearly 1250 are endemic to the region (Anonymous,
2014). Moreover, the Western Ghats is the centre of origin and diversity of a number of
economically important plants and there exists a variety of wild relatives of important food
and spice crops. The rich biodiversity of tropical forest is attributed to a constant amount of
energy from the sun, abundant rain fall and year round warmth, which makes life more
favourable than any other place on earth.
In India, the genus Garcinia is represented by 43 species and 5 varieties, of which 37
species and 4 varieties occur in wild, whereas the rest were introduced into cultivation
(Anderson, 1874, Maheshwari, 1964, Singh, 1993, Srivastava, 1994, Mohanan et al., 1997,
Sabu et al., 2013, Sarma et al., 2016). Among the 37 indigenous Garcinia taxa, 16 species
and 4 varieties are endemic to the country. In India, Garcinia species are distributed mainly
in three phyto-geographical zones; North East India, the Western Ghats and Andaman and
Nicobar Islands. North East India hosts 17 species, of which 2 species and 1 variety are
endemic to the region. The Western Ghats hosts 9 species and 2 varieties, of which 7 species
and 2 varieties are endemic and the Andaman and Nicobar Islands hosts 15 taxa, of which 6
species and 1 variety are endemic.
Figure 1. Distribution map of Garcinia species in the world (A), in India (B) and in the Western
Ghats (C)
2
1. Distribution of Garcinia species in the Western Ghats

In the Western Ghats, most of the Garcinia species are distributed in semi evergreen to
evergreen habitat, except G. wightii which is also found in riparian habitats. Altitude wise
they are found from sea shore (G. gummi-gutta var. gummi-gutta) to high land up to 1500 m
(G. travancorica). Recent checklist (Nayar et al., 2014) reported the natural occurrence of 10
species and 2 varieties of Garcinia in the Western Ghats region. However, field survey and
detailed study of various flora revealed the presence of 9 species and 2 varieties as
indigenous to the Western Ghats, of which 7 species and 2 varieties are endemic to the region
(Table 1). G. morella, G. talbotii and G. gummi-gutta var. gummi-gutta are the most widely
distributed species in the Western Ghats. Our study revealed that Agasthyamala Biosphere
Reserve in the Western Ghats is the centre of maximum diversity of the genus, with 6 species
of which three species viz., G. travancorica, G. imberti and G. rubro-echinata are endemic to
the region (Table 1).
Among the nine species indigenous in the Western Ghats, G. gummi-gutta is an
economically important and widely cultivated fruit crop in Southern Western Ghats, while G.
indica is cultivated widely in Central Western Ghats region for their fruits. Besides, 6
introduced species (G. cowa Roxb. ex. DC., G. hombroniana Pierre, G. xanthochymus Hook.
f. ex T. Anderson, G. cymosa (K. Schum.) I. M. Turner and P. F. Stevens, G. intermedia
(Pittier) Hammel, G. mangostana L.) are also reported as cultivated in the Western Ghats
region either as fruit plants or as ornamental plants. Garcinia mangostana L., source of the
edible fruit mangosteen, is native to South East Asia and now cultivated throughout the
Western Ghats for their delicious fruits. G. hombroniana, known as sea shore mangosteen, an
allied species is getting popular in the Western Ghats region as source of edible fruits. The
introduced tree G. xanthochymus is also getting popular as a fruit crop and avenue tree.
Garcinia echinocarpa Thw. (1854) was considered as a species distributed in South
India and Sri Lanka, until Kostermans (1977) separated the South Indian taxon as a distinct
species viz. G. rubro-echinata. Though later Singh (1993) reduced G. echinocarpa var.
monticola as a synonym of G. rubro-echinata, detailed literature survey and examination of
type specimens in the present study revealed that G. rubro-echinata is distinct from G.
echinocarpa var. monticola.
Garcinia talbotii Raizada ex Santapau was considered as a species distributed in
Western Ghats of India and was first reported from Gairsoppah Ghats, North Kanara,
Karanataka (Raizada, 1960). This species is closely allied to Garcinia spicata Wight and Arn.
which is native to Sri Lanka (1875). In most of the Indian Floras, G. talbotii has been
misidentified as G. spicata, which is not naturally occurring in India. Thorough examination
of literature, type specimens and live specimens from the Western Ghats, live specimen from
AJCB Indian Botanic Garden Kolkata (G. spicata, Herb. Wallich 4838, Wight 138) and
herbarium specimens housed at various Herbarium like MH, ASSAM, PBL, CAL, FRC,
CALI, KFRI and KEW, it was found that G. talbotii is distinct from G. spicata by the milky
exudation turning brownish after exposure, elliptic, ovate-oblong leaf, more number of lateral
veins, fascicles or pseudo spikate male inflorescence, number of stamens and stigmatic lobes
and globose fruit.
3
Table 1. Garcinia species in the Western Ghats: IUCN status and distribution
Sl. Garcinia species IUCN Distribution (altitude, Locality
No. status meter)
1 G. gummi-gutta (L.) -- India, Sri Lanka Throughout the evergreen-semi evergreen
N. Robson var. (50- 900 m) forests of the Western Ghats
gummi-gutta N. P.
Singh
G. gummi-gutta var. -- Endemic to the Western Kerala: Kadllar, Munnar, Rajamala, Chinnar
conicarpa (Wight) Ghats (Idukki); Vellarimala (Kozhikode)
N. P. Singh (1350- 1950 m)
G. gummi-gutta var. -- Endemic to the Western Kerala: Wallakkad, Silent Valley (Palakkad)
papilla (Wight) N. P. Ghats TamilNadu: Nilagiri Biosphere Reserve
Singh (800-1850 m)
2 G. imberti Bourd. EN Endemic to South Kerala: Agasthyamala Biosphere Reserve
Western Ghats (Thiruvananthapuram), Shankily, Shendaruni
(900-1200 m) (Kollam).
3 G. indica (Thouars) VU Endemic to India. Kerala: Badi Baduka, Thaliparamba;
Choisy the Western Ghats, Maharashtra: Thungar Hill, North Kanara;
North East India Karnataka: Tinai Ghat.
(50- 550 m) Assam: Karbi Anglong Dist.
4 G. morella (Gaertn.) -- Indo-Malay, Sri Lanka Kerala: Chenathnair, Kuruva Island,
Desr. (500- 1100 m) Kambamala (Wayanad); Thamarassery,
Vellarimala (Kozhikode); Silent Valley
(Palakkad); Kodakkalthodu, Payampara
(Thrissur); Pampa (Pathanamthitta);
Pandimotta, Chemmunjii, Attayar
(Thiruvananthapuram) Karnataka: Horanad
Forests;
Tamil Nadu: Anamalai Hills, Iyyerpadi,
Kannikketyy.
Assam: Pasighat, Rani Dawa bang
5 G. -- Endemic to the Western Kerala: Kadalar, Pampadumchola, Munnar
pushpangadaniana Ghats (850-1400 m) (Idukki); Wallakad of Silent Valley
T. Sabu, N. (Palakkad);
Mohanan, Krishnaraj Tamil Nadu: Anamalai Hills
and Shareef
6 G. rubro-echinata VU Endemic to South Kerala: Ponmudi, Chemmunji Hills
Kosterm. Western Ghats (Thiruvananthapuram). Tamil Nadu: Kalakkad
(800-1200 m) Mundanthurai Tiger Reserve (Thirunelveli)
7 G. talbotii Raizada -- Endemic to the Western Kerala: Uduma, Cheemani (Kasaragode);
ex Santapau Ghats Vellarimala (Kozhikode); Vazhachal
(100 -500 m) (Thrissur); Pampa, Pandarakayam
(Pathanamthitta); Pandimotta, Rosemala
(Thiruvananthapuram)
8 G. travancorica VU Endemic to South Kerala: Athirumala, Chemmunjii
Bedd. Western Ghats (Thiruvananthapuram). Tamil Nadu: Kalakkad
(950-1500 m) Mundanthuarai Tiger Reservae (Thirunelveli)
9 G. wightii T. VU Endemic to South Kerala: Vazhachal, Athirappally (Thrissur);
Anderson Western Ghats Paniyeli-poru (Eranakulam)
(250-700 m)
VU- Vulnerable, EN- Endangered
4
According to Anderson (1874), Maheshwari (1964) and Singh (1993) Garcinia

xanthochymus is distributed in the Western Ghats. However, detailed literature survey,
herbarium references and field collections revealed that G. xanthochymus is naturally found
only in the North East India and Andaman Nicobar Islands. G. xanthochymus is cultivated
elsewhere in the Western Ghats for its delicious fruits. Most of the specimens identified in
Indian Herbaria as G. xanthochymus, on close examination revealed to be distinct, which
resembles to the new species G. pushpangadaniana, reported from Kadalar forest Division of
Munnar, Southern Western Ghats of India (Sabu et al., 2013).
Garcinia gummi-gutta (L.) Robs. is an economically important fruit crop and a vital
component of the forest flora of the Western Ghats. Three varieties of the species viz; G.
gummi-gutta (L.) Robs. var. gummi-gutta, G. gummi-gutta var. papilla (Wight) N. P. Singh
and G. gummi-gutta var. conicarpa (Wight) N. P. Singh are reported from India. Among the
three varieties, var. gummi-gutta is the most common and economically important one,
widely cultivated throughout the Western Ghats region, especially in Kerala, ranging from
sea shore to high land and also found in the wild. The variety conicarpa and var. papilla are
rare and distributed restrictedly in highlands of evergreen forest. The large fruit size, pulpy
aril and more number of seeds (4-8) per fruit were the favorable features of var. gummi-gutta
for its wide distribution and preference for cultivation over the other two varieties. The
variety conicarpa was found morphologically distinct by the absence of leaf ligules and by
the arrangement of stamens in convex torus head, in addition to the conical nature of fruits.
We suggest reinstating the species status of G. gummi-gutta var. conicarpa to G. conicarpa
based on the unique morphological characters.
2. Conservation status
Literature review revealed that Garcinia species in the Western Ghats have not been assessed
critically for their distribution and conservation and a comprehensive revision on the
conservation status of the Garcinia species appears to be vital.
G. travancorica, G. imberti and G. rubro-echinata are distributed strictly endemic to
the forest regions of Agasthyamala Biosphere Reserve, at an altitude ranging from 800-1400
m. According to the guidelines of IUCN Red List and World Conservation Monitoring Centre
(Moat, 2007), G. imberti Bourd. is an endangered tree species, while G. travancorica and G.
rubro-echinata belongs to ‘vulnerable’ category. Our field surveys revealed that population
size of G. imberti is rather larger than that of G. travancorica and G. rubro-echinata. The two
varieties of G. gummi-gutta; var. conicarpa and var. papilla are also very rare in the
evergreen forest of Southern Western Ghats, suggesting vulnerable status for these two
varieties.
3. Taxonomy
The genus Garcinia is considered as a taxonomically difficult one due to the complexity in
floral characteristics. While majority of Garcinia species are dioecious, a few species or races
are reported as hermaphrodite (Dunthorn, 2004). Garcinia species generally display an
unusual evolutionary plasticity and there are many unresolved phylogenic issues surrounding
the genus. Among the different phylogenic analytical strategies, morphology in all its aspects,
from micromorphology to embryology, palynology, seed, fruit, floral, stem and leaf
5
morphology, still remains to be the most indispensible tool. Several identification keys have
been reported for Garcinia species across the globe based on morphological features of
flower, fruit and leaf (Jones, 1980, Nimanthika and Kaththriarachchi, 2010).
3.1. Diversity in floral morphology

Male and female flowers are seen on different trees (dioecious) or rarely male or female and
hermaphrodites flowers on the same tree (polygamodioecious) in Garcinia species. The basic
inflorescence type of Garcinia is a simple cyme or few flowered (2 to 16) clusters in
fascicles. Exceptions are in the case of G. travancorica with trichotomous cyme and G.
wightii with solitary or rarely 2-3 flowers. Flowers of Garcinia are generally sessile except G.
talbotii and G. pushpangadaniana with pedicellate (Figure 2). Flowers are solitary or in
fascicles, terminal or axillary and variously coloured. Sepals and petals 4-5, stamens usually
numerous, very variable in arrangement and structure, sometime with pistillode; ovary 1-12
loculed with a single apical ovule per locule, ovule 1 in each locule; stigma conspicuous and
variously lobed, usually peltate. Characteristic differences in the floral architecture were
observed even among closely related taxa of Garcinia (Pierre, 1883, Jones, 1980, Gustafsson
et al., 2002, Sweeney, 2008).
Male flowers: Inflorescence of male flowers are observed both in terminal and axillary
positions; axillary inflorescence being common. Species like G. morella, G.
pushpangadaniana, G. wightii and G. gummi-gutta have flowers in axills, whereas in the case
of G. imberti, G. indica, G. rubro-echinata and G. talbotii, flowers are found both in axillary
and terminal position. G. travancorica flowers are found only terminal or sub-terminal.
The sepals are usually orbicular and green or yellowish in colour. Species like G.
pushpangadaniana and G. talbotii have ciliate margins. The petals, however, have brighter
colour, from yellow (G. imberti, G. gummi-gutta, G. indica) to white (G. talbotii, G. wightii),
cream (G. morella), pink or red (G. pushpangadaniana), pale greenish (G. travancorica) and
green (G. rubro-echinata). Petal of the male and female flowers of the same species are
usually similar, but varies considerably among different species from ovate to oblong, or
oblanceolate to obovate. The stamens are always united in a bundle at the centre of the
flower. In the case of G. gunmmi-gutta, stamens were arranged usually on tetragonous
receptacle and also as androphore. In Garcinia, pistillodes have a fungiform-shape, consisting
of a cap and the shaft (or stipe), which is homologous to the stigma and ovary respectively.
The pistillodes are small in diameter, varied from 1 mm for G. gummi-gutta to 5 mm for G.
rubro-echinata. The stipe can be slender or ovoid and the margin of the cap may be crenate
or lobed. However, pistillode is lacking in G. talbotii and G. pushpangadaniana.
6
Figure 2. Male flowers of Garcinia species in the Western Ghats (A. G. rubro-echinata, B. G.
imberti, C. G. wightii, D. G. travancorica, E. G. morella, F. G. talbotii, G. G. pushpangadaniana, H.
G. indica and I. G. gummi-gutta)
Female flowers: Inflorescence of female flowers are usually terminal in position. G. morella,
G. pushpangadaniana, G. talbotii and G. wightii have axillary flowers while G. gummigutta
exhibit both axillary and terminal flowers (Figure 3). The female flowers are fewer compared
to male flowers and in the case of G. rubro-echinata, G. imberti and G. wightii, the female
flowers are strictly solitary. The female flowers have shorter, stouter pedicels and peduncles
comparatively smaller than the male flowers. In general, the ovary in Garcinia is superior and
very few species have constant locule numbers. Most of the Garcinia species have 4 or 5
locules (G. morella, G. wightii, G. rubro-echinata and G. talbotii) but rarely 1or 2 loculed (G.
imberti, G. travancorica) and more than 5 loculed (G. indica, G. gummi-gutta, G.
pushpangadaniana). Generally, ovary is globose to ovoid. Variation is also found in the
shape of ovary, however, it has less taxonomic value and is not really an important character
for species delimitation in Garcinia.
The stigma is usually sessile and wide variation exists. In most species the stigma is
large and conspicuous, and in some species like G. travancorica and G. imberti the stigma is
larger than the ovary. Lobes are slightly divided (G. pushpangadaniana, G. talbotii, G.
rubro-echinata and G. wightii) to completely divided in to rays (G. gummi-gutta, G. indica
and G. morella), whereas in some species stigma exists as broad convex disc (G.
travancorica and G. imberti).
7
Figure 3. Female flowers of Garcinia species in the Western Ghats (A. G. rubro-echinata, B. G.
3.2. Diversity in branching and bark exudates

Garcinia species were characterized by their monopodial branching form, where secondary
shoots or branches arise behind the growing point but remain subsidiary to the main stem,
which continues to grow indefinitely (Tootil, 1984). Hence Garcinia species usually
exhibited horizontal spreading branching pattern. However, G. gummi-gutta var. gummi-gutta
and G. morella showed pendulous drooping branchlets whereas G. indica showed crown
shaped canopy ending with horizontal branchlets. G. pushpangadaniana has pyramidal crown
with pendulous drooping branchlets.
Bark is usually grey to brown, inner bark is yellow or occasionally white. The stem
and twigs produce yellow, white or cream exudates, known as ‘Gamboge’ (Figure 4).
Gamboge is solidified resin and is sticky in nature and is also found in immature fruit rind
and leaves in addition to stem bark. Gamboge is used as a pigment in paint and varnishes.
The colour of the exudates varies from yellow to white and is a characteristic identification
feature for Garcinia species. Species like G. travancorica, G. morella, G. wightii and G.
gummi-gutta have yellow exudation. G. pushpangadaniana, G. imberti, G. talbotii, G. indica
and G. rubro-echinata have white exudation. Gamboge of G. morella is widely used in the
preparation of golden coloured water colours and spirit varnishes for metals and also for
dyeing silk fabrics. A golden yellow coloured ink was prepared from the gamboge of G.
morella for writing on black paper (Anonymous, 1950).
8
Figure 4. Stem bark exudates in Garcinia species in the Western Ghats (A. G. rubro-echinata, B. G.
3.3. Diversity in leaf morphology

Leaves of Garcinia species are opposite, usually thick and characterized by the presence of a
foveola (an excavation with an extension resembling a ligule) at the base of the petiole. Based
on the arrangement of leaf lamina, the Western Ghats species can be classified into two
groups, those possess lamina with conspicuous secondary veins and the group with
inconspicuous secondary veins. Also, the arrangement of secondary veins falls into two
patterns; loose and dense. G. travancorica and G. rubro-echinata exhibit loosely arranged
secondary veins, while all other species showed densely arranged veins. Lamina size and
nature of petiole were also distinguishing features. G. pushpangadaniana and G. talbotii have
large leaves (>15 x 8 cm) with stout petiole. Coriaceous leaf texture was prominent in most
of the Garcinia species except G. imberti, G. wightii and G. indica which possess
subcoriaceous leaves. G. talbotii and G. gummi-gutta were the two species that showed
maximum diversity in leaf shape (Figure 5).
9
Figure 5. Leaf morphology of Garcinia species in the Western Ghats (A. G. rubro-echinata, B. G.
3.4. Diversity in fruit morphology

Relatively few investigations have been carried out on fruit and seed morphology of
Garcinia. Fruits are fleshy to woody berry; seated on the usually persistent calyx. Seed 1-12,
often flattened and enclosed in pulp. Regarding fruit size, G. wightii has the smallest (10-15
gm), while the largest is that of G. pushpangadaniana, weighing upto 750 gm. Most of the
fruits are globose in shape except sub-globose to ellipsoid in G. rubro-echinata, oblong to
sub-globose in G. imberti and G. travancorica. Texture of fruit surface is another
distinguishing feature, where G. imberti, G. travancorica, G. morella, G. wightii and G.
indica possess smooth fruit surface, grooved in G. gummi-gutta, warty nature in G.
pushpangadaniana while the fruit surface of G. rubro-echinata is covered with broad sharp
tubercles (Figure 6). Species like G. imberti, G. wightii, G. travancorica, G. morella and G.
indica have pulpy aril while the aril of G. pushpangadaniana is crispy and that of
10
Figure 6. Fruit morphology of Garcinia species in the Western Ghats (A. G. rubro-echinata, B. G.
G. rubro-echinata is fibrous. The seed shape was oblong in most of the Garcinia species,
except plano-convex for G. pushpangadania, ovoid-reniform for G. morella and G. gummi-
gutta. The fruit colour is a characteristic distinguishing feature which varies from yellowish
green in G. travancorica, G. imberti and G. talbotii, brownish yellow in G.
pushpangadaniana, yellow in G. gummi-gutta, red in G. wightii and G. morella and purple in
G. indica.
4. Key to the Garcinia species of the Western Ghats

Vegetative morphological characters among the Garcinia species of the Western Ghats were
evaluated systematically to construct an identification key, which will be a valuable tool for
identification of the Western Ghats species in the field.
1a Fruit surface smooth……………………………………….2
2a. Fruit less than 3 cm in diam. ……………………………...3
3a Fruit with 2 loculed ovary, rarely one……………………..4
4a Leaf linear-oblong with distinct closely arranged parallel
veins…..................................................................................G. travancorica
4b Leaf oblanceolate indistinct veins……………………….....G. imberti
3b Fruit with more than 2 loculed ovary……………………...5
5a Leaves linear-lanceolate, fruit size of a small cherry, with pinkish
11
tinge…………………………………………………..…….G. wightii
5b Leaves elliptic, fruit globose or subglobose red……………G. morella
2b Fruit more than 3 cm in diam……………………………….6
6a Stem cut showing white exudation, fruit with stalk, yellowish green in
colour……………………………………………………….G. talbotii
6b Stem cut showing yellow exudation, fruit without stalk, red or dark purple in
colour…………………………………………………….…G. indica
1b Fruit surface rough…………………………….…………….7
7a Fruit grooved………………………………………………...8
8a Leaf ligule absent, fruit with 3-5 grooves, fruit conical……G. gummi-gutta var. conicarpa
8b Leaf ligule present, fruit with more than 6 grooves, fruit ovoid-oblong or
globose……………………………………………………….9
9a Fruit with 6-8 grooves, fruit ovoid-oblong with elongated
beak…………………………………………….…………….G.gummi-gutta var. papilla
9b Fruit with 6-10 grooves, fruit, globose………………………G. gummi-gutta var. gummi-gutta
7b Fruit warty or echinate……………………………………….10
10a Leaves larger than 20 cm, thick coriaceous, indistinct veins, fruit warty,
ca. 750 gm……………………………………………………G. pushpangadaniana
10b Leaves less than 20 cm, coriaceous, distinct closely parallel veins, fruit with echines,
ca. 100 gm…………………………...……………………..G. rubro-echinata
5. Western Ghats Garcinia species

5.1. Garcinia gummi-gutta (L.) N. Robson
Evergreen tree up to 20 m high; exudation pale yellow, sticky.
Leaves: Elliptic, obelliptic-ovate, 6-13 x 2.5-6 cm.
Male flowers: Tetramerous, 3-8 flowers on axillary fascicles, 1-1.7 x 1-1.2 cm, pedicel 7-12
mm long; sepals orbicular, margin membraneous with fimbril like projections; petals oblong,
pale yellow or orange yellow, membraneous on margin; stamens in a globose head;
rudimentary pistil absent or if present stigma discoid with 4 lobed cleft.
Female flowers: Tetramerous, solitary or 1-3 fascicle on terminal or axillary, 1.5-2 x 1.5 cm;
staminodes 10-20; ovary 4-12 locular, ca. 1 mm long, ovule one in each locule, subglobose or
ovoid, grooved, stigmatic rays spreading, free nearly to the base, margin crenate, tuberculate.
Fruits: Globose, 6-8 cm in diam., 6-10 grooved, yellow or orange yellow on ripening,
pericarp very thick, fleshy.
Seeds: 6-8, ovoid, 2-3.3 x 0.7-0.9 mm, compressed, surrounded by white or red pulpy aril.
Field identification characters
i. Leaves elliptic, 6-13 cm long.
ii. Stigmatic lobes 6-10.
iii. Fruit deeply grooved, grooves 6-10.
Garcinia gummi-gutta var. papilla (Wight) N. P. Singh

Evergreen tree up to 15 m high; exudation yellow.
Leaves: Elliptic, 6-9 x 1.5-3cm.
Male flowers: Tetramerous, 3-5 flowers in axillary fascicles, ,1-1.5 x 1-1.2 cm; pedicels
stout, 5-7 mm long; sepals ovate to oblong, margin membraneous ; petals oblong, brick red,
margin membraneous; stamens in a globose androphore; rudimentary pistil rarely present.
12
Female flowers: Tetramerous, 1-3 flowers on solitary or fascicles, terminal or axillary, 1-1.2
x 7-10 mm; staminodes in a ring; ovary 6-8 locular, 1-ovule in each locule, subglobose,
grooved, stigmatic rays 4-8.
Fruits: Subglobose, yellowish green, ca. 6 cm in diam., 4-8 grooved with a terminal mamilla,
pericarp very thick, fleshy.
Seeds: 3-5, sub-triangular, 2-3 x 0.8-10 mm, enclosed in a thick mass of fibrous aril.
i. Young shoot and margin of leaf shows reddish tinge.
ii. Fruit ovoid-oblong with 4-8 grooves and with terminal mamilla
Garcinia gummi-gutta var. conicarpa (Wight) N. P. Singh

Evergreen tree up to 15 m high; exudation yellow.
Leaves: Obovate-ovate, rarely oblong or broader beyond the middle, 6-10 x 4-8 cm.
Male flowers: Tetramerous, solitary or 2-5 flowered fascicles, axillary or terminal, 1-1.5 x 1-
1.2 cm, pedicels stout, ca. 5 mm long; sepals ovate, margin membraneous with fimbril like
projection; petals yellow, oblong-orbicular, slightly membraneous margin; stamens in a
convex torus head; rudimentary pistil absent or present.
Female flowers: Tetramerous, solitary or 2-3 flowered fascicles, terminal or sub terminal, 1-
1.5 x 1-3 cm, sessile; staminodes in a ring; ovary 3-5 locular, ovule one in each locule, ovoid,
grooved, stigmatic rays 3-5.
Fruits: Usually conical, rarely ovoid, yellowish green, ca. 5 cm in diam., 3-5 grooves with a
terminal mamilla, grooves, pericarp very thick, fleshy.
Seeds: 2-4, ovate-oblong, 2-3 x 0.8-10 mm, enclosed in a thin fibrous aril.
Due to the distinct morphological and chemical characteristics, it is suggested that species
status may be reinstated for the variety conicarpa (Chapter 8).
i. Absence of leaf ligule on petiole.
ii. Shape of leaf broader beyond the middle.
iii. Conical shape of fruit with 3-5 grooves.
5.2. Garcinia imberti Bourd.

Evergreen medium sized tree up to 20 m high; exudation white; branches horizontal
spreading.
Leaves oblanceolate, 6-12 x 2-6 cm.
Male flowers: Tetramerous, 3-6 or 9 flowerered fascicles, or rarely cyme or paired, terminal
5-6 x 4-5 mm, sessile; sepals sub orbicular, membraneous; petals orbicular, pale yellow,
membraneous; stamens in a central globose mass, pistil rudimentary.
Female flowers: Tetramerous, solitary, or rarely in pairs, terminal, 6-8 x 6 mm; ovary 2-
loculed, globose, ovule one in each locule, stigma sessile, convex, capitate; staminodes many,
united in a ring around the ovary.
Fruits: Sub-globose, greenish, 2.2-2.5 cm in diam., smooth
Seeds: 1-2, enclosed in a fibrous aril.
i. Bark brown mottled with white.
13
ii. Leaves less than 12 cm long, oblanceolate with shortly caudate acuminate at apex.
iii. Berry sub-globose, usually 1-2 seeded fruit, crowned by capitated stigma.
5.3. Garcinia indica (Thouars) Choisy

Evergreen to semi-evergreen tree up to 15 m high; exudation milky; branches with conical
crown or pendulous drooping.
Leaves: Lanceolate or obovate-oblong, 6-12 x 1.5-5 cm,
Male flowers: Tetramerous, 4-8 flowered fascicles, axillary or terminal, 5-9 x 5-8 mm,
pedicel stout, ca. 4 mm long; sepals ovate-rotundate, membraneous; petals orbicular, creamy
white, membraneous; stamens inserted on hemispheric, sub-quadrate torus; rudimentary pistil
absent or if present as long as stamens.
Female flowers: Tetramerous, solitary, terminal, sub-sessile; ovary, subglobose, stigmas
convex, 4-8 rayed, coronate, sessile.
Fruits: Spherical, orange-pink, deep purple when ripe, up to 4 cm in diam., pulp red, fleshy.
Seeds: 5-8, compressed.
i. Branches with conical crown or pendulous drooping.
ii. Berries smooth, not grooved, deep purple when ripe.
5.4. Garcinia morella (Gaertn.) Desr.

Evergreen medium sized tree up to 18 m high; exudation deep yellow, sticky.
Leaves: Elliptic, ovate or obovate, 10-15 x 4-8 cm.
Male flowers: Tetramerous, ca. 3 flowered fascicles, axills of fallen leaves, 1-1.2 x 5-10 mm,
sessile or short pedicel, 4-6 mm long; sepals orbicular or elliptic, membraneous; petals
rotundate or orbicular, white to pink, membraneous; stamens in a central subglobose mass;
rudimentary pistil absent.
Female flowers: Tetramerous, solitary, axillary, ca. 1 x ca. 0.5 cm, sessile; staminodes,
connate at base into a ring around ovary; ovary 4-locular, sub-globose; stigma coronate,
tubercled.
Fruits: Sub-globose or globose, yellow with reddish tinge, 2.5-3 x 2-3 cm, smooth
Seeds: Ovoid-reniform, 4, laterally compressed and dark brown.
i. Petiole folding longitudinally above.
ii. Leaves with 8-12 pairs of lateral veins, midrib prominent below and margin revolute
and wavy.
iii. Tubercled stigma.
5.5. Garcinia pushpangadaniana T. Sabu, N. Mohanan, Krishnaraj and Shareef

Evergreen to semi-evergreen medium sized tree up to 20 m high; bark exudation milky.
Leaves: Elliptic-oblong, 14-20 x 6-8 cm.
Male flowers: Pentamerous, ca. 2-10 flowered fascicles, axillary, 1-1.5 x.1cm, pedicel 7-10
mm long; sepals orbicular-sub-orbicular, margin ciliate; petals orbicular, pinkish pale
greenish white, membraneous margin; stamen 5-phalangiate; rudimentary pistil present.
14
Female flowers: Pentamerous, ca. 2-8 flowered fascicles, axillary, 1-1.5 x 1-1.3 cm;
staminodes arranged in 5-phalanges; ovary 6-8 loculed, 6 mm in diam., globose, stigma 6-8
lobed, oblong, stellate.
Fruits: Globose, pale yellowish brown, 13 x 11 cm, fleshy, without pulpy aril, irregularly
ridged surface.
Seeds: 1-4, plano-convex, whitish yellow, up to ca. 2 cm long.
i. Tree with pyramidal crown.
ii. Leaves 14-20 × 6-8 cm long, elliptic-oblong, thick coriaceous, lateral nerves 28-
34 pairs.
iii. Large fruits (600-750g), globose and irregularly ridged on the surface.
5.6. Garcinia rubro-echinata Kosterm.

Evergreen tree up to 20 m tall; exudate brownish-white.
Leaves: Sub-obovate to broadly elliptic, 8-15 x 3-8 cm.
Male flowers Tetramerous, fascicled, axillary or terminal, pale green, 1.6-2 x 1.5 cm, sessile;
sepal orbicular-obtuse, margin membraneous; petals sub-orbicular to oblong, pale green,
membraneous; stamens in a tetragonous torus; pistil rudimentary.
Female flowers: Tetramerous, solitary, terminal, pale green, 1.8-2.5 x 1.5-1.8 cm, sessile;
staminodes ca.22, connate in to a ring at base, disc present at intercalary position; ovary 3-4
locular, covered with numerous fleshy scales; stigmas peltate, irregularly lobed.
Fruits: Sub-globose or ellipsoid, dark red, 4-6 x 2.5-4 cm, covered with spines or broad
tubercles.
Seeds: 1-3, oblong, up to 4cm long with scanty aril.
i. Bark greenish white with yellow red or white mottles.
ii. Lamina usually obovate with numerous parallel lateral veins.
iii. Fruit covered with spines.
5.7. Garcinia talbotii Raizada ex Santapau

Evergreen tree up to 20 m tall; exudate white, turning brownish after exposure.
Leaves: Elliptic-ovate, oblong or ovate-oblong, 7.5-18 x 3-10 cm.
Male flowers: Pentamerous, fascicled, axillary or terminal, creamy-white, 1.8-2.3 cm long,
pedicel, ca. 1 cm long; sepal orbicular, margin membraneous, rarely ciliate; petals orbicular-
obovate, rarely sub-orbicular, creamy-white or greenish-yellow, margin membraneous;
stamens in to 5 phalanges; rudimentary pistil absent.
Female flowers: Pentamerous, fascicled, axillary, creamy-white, 1.8-2.7 cm long, pedicel, ca.
1 cm long; staminodes in 5 delicate phalanges; ovary 3-locular, very rarely 4, globose, stigma
peltate, 3 lobed.
Fruits: Globose, greeninsh-yellow on ripening, 4-6 x 3.8-5 cm, fleshy, rind surface shows an
yellow resins.
Seeds: 1-3, oblong, ca. 3cm long with yellow pulpy aril.
i. Exudation milky, turning brownish after exposure.
15
ii. Leaves usually ovate.

iii. Fruit greenish yellow, ripe fruit pulp sweet-scented, stigmatic lobe 3.
5.8. Garcinia travancorica Bedd.
Evergreen tree up to 15 m high; exudate yellow.
Leaves: Linear-oblong, 5.5-10 x 1-2 cm.
Male flowers: Tetramerous, trichotomous short cymes, terminal or sub terminal, 1.2-1.5 x
0.8-1 cm, pedicel short, ca. 2-3 mm long; sepals orbicular, margin membraneous; petals
orbicular, creamy white, membraneous; stamens numerous in 4-tetragone masse; rudimentary
pistil columnar, with a circular peltate stigma.
Female flowers: Tetramerous, solitary or paired, terminal or sub terminal, 1.3-1.5 x 8-1.2 cm;
staminodes in 5-phalanges; ovary 1-2 locular, subglobose or pyriform; stigma 3-lobed and
spreading.
Fruits: Ovoid-oblong, 2-3 x 1-2.5 cm, stigma persistent to fruit.
Seeds: Usually 1, rarely 2, ovoid, up to 2-2.5 x 0.7-1 cm.
i. Leaves narrow oblong, less than 3 cm broad with secondary nerves closely parallel
and horizontal.
ii. Male flowers trichotomous cyme.
iii. Female flowers with broad yellow stigma.
5.9. Garcinia wightii T. Anderson

Evergreen tree up to 15 m high; exudation deep yellow to orange yellow.
Leaves: Linear-lanceoalte, 6-14 x 1.5-3 cm.
Male flowers: Tetramerous, solitary or 2-3 together, sometimes numerous, axillary, 1-1.2 x
0.8-1 cm, sessile; sepals orbicular, margin membraneous; petals obovate, creamy white,
membraneous; stamens in tetragons head.
Female flowers: Tetramerous, solitary, axillary, 1-1.5 x 5-7 mm, sessile; staminodes 4-
phalanges; ovary 4-locular, globose; stigma 4-lobed.
Fruits: Sub-globose, rose with pinkish tinged, 1.2-1.5 x 0.9-1 cm, smooth, with persistent
stigma and sepals.
Seeds: 4, up to ca. 9.5 x 4.5 mm long.
1. Leaves less than 3 cm wide, linear-lanceolate tapering at both ends, secondary veins
very oblique.
2. Fruit colour rose with pinkish tinge.
Conclusions
Garcinia species are important components of the flora of the Western Ghats and also an
economically important group. Field surveys revealed that 9 species and 2 varieties are
indigenous to the Western Ghats of which 7 species and 2 varieties are endemic to the region.
Distribution, distinguished morphological features and conservation aspects of Garcinia
species of the Western Ghats were discussed in detail. Agasthyamala forests in the Western
Ghats region, with natural distribution of 6 Garcinia species, can be considered as the centre
of diversity of Garcinia species in the Western Ghats.
16
References
1. Anderson T. 1874. Guttiferae. In: Hooker JD. (ed.) Flora of British India. 1. L. Reeve and
Co., London. 259-278.
2. Anonymous. 1950. Wealth of India Raw Materials, 4. CSIR, New Delhi. 99-108.
3. Anonymous. 2014. Plant Discoveries, New genera, species and new records. Botanical
Survey of India, Ministry of Environment and Forests.
4. Bamps P, Robson N and Verdcourt B. 1978. Flora of Tropical East Africa: Guttiferae.
Crown Agents for Overseas Government and Administration, London.
5. Dunthorn M. 2004. Cryptic dioecy in Mammea (Clusiaceae). Plant Syst. Evol., 249, 191-196.
6. Engler A. 1925. Guttiferae. In: Engler A and Prantl K (eds.), Die natürlichen
Pflanzenfamilien. 21, Engelmann W, Leipzig, 154-237.
7. Garcin L. 1733. The settling of a new genus of plants, called after the Malayans, Mangostans.
Translated by Mr. Zollman. Philosophical Transactions (1683-1775) 38, 232-242.
8. Gustafsson MHG, Bittrich V and Stevens PF. 2002. Phylogeny of Clusiaceae based on rbcL
sequences. Int. J. Plant Sci., 163, 1045- 1054.
9. Hooker JD. 1875. Observation on some Indian species of Garcinia. Journal of the Linnean
Society Botany, 14, 484-486.
10. Jones S. 1980. Morphology and major taxonomy of Garcinia (Guttiferae). Ph.D. dissertation.
London, University of Leicester and British Museum, 474.
11. Jussieu AL. 1789. Genera plantarum. Viduam Herissant, Paris.
12. Kostermans AJGH. 1977. Miscellaneous Botanical notes. Ceylon Journal of Science
(Biological Sciences, 12, 128.
13. Linnaeus C. 1753. Species Plantarum 1. Salvius L, Stockholm.
14. Maheshwari JK. 1964. Taxonomic studies on Indian Guttiferae III. The genus Garcinia L.
Bulletin of the Botanical Survey of India, (2-4), 107-135.
15. Moat J. 2007. Conservation assessment tools extension for ArcView 3.x, version 1.2. GIS
Unit, Royal Botanic Gardens, Kew. Available at: http://www.rbgkew.org.uk/gis/cats
16. Mohanan N, Shaju T, Rajkumar G and Pandurangan AG. 1997. Rediscovery of Garcinia
imberti Bourd. (Clusiaceae), a little known endemic species of Western Ghats. Indian J.
Forestry, 20 (4), 383-385.
17. Nayar TS, Beegam AR and Sibi M. 2014. Flowering plants of the Western Ghats, India.
JNTBGRI, Thiruvananthapuram.
18. Nimanthika WJ, Kaththriarachchi HS. 2010. Systematics of genus Garcinia L. (Clusiaceae)
in Sri Lanka. New insights from vegetative morphology. Journal of National Science
Foundation, 38, 29-44.
19. Pierre L. 1882-1885. Flore forestiere de la Cochinchine, Paris. (1-2), pl. 54-98.
20. Raizada.1960. In: Santapau H. Flora of Khandala. Records of the Botanical Survey of India.
14 (1), 14.
21. Robson NKB. 1961. Guttiferae. In: Exell AW and Wild H (eds.), Flora Zambesiaca.1,
Mozambique, Federation of Rhodesia and Nyasaland, Bechuanaland Protectorate Crown
Agents for Overseas Government, London, 378-404.
22. Rogers SZ, Sweeney PW. 2007. Two distinctive new species of Malagasy Garcinia
(Clusiaceae). Systematic Botany, 32,772-779.
17
23. Sabu T, Mohanan N, Krishnaraj MV, Shareef SM, Shameer PS and Roy PE 2013. Garcinia
pushpangadaniana, (Clusiaceae) a new species from southern Western Ghats, India.
Phytotaxa, 116 (2), 51-56.
24. Sarma J, Shameer PS, Mohanan NN. 2016. A new species of Garcinia (Clusiaceae) from
Assam, North East India. Phytotaxa, 252 (1), 73-76.
25. Sharma BPH, Handique PJ, Sunitibala Devi H. 2013. A Historical and Taxonomic Overview
of Garcinia L. and its reproductive ecology. Folia Malaysiana, 14 (1), 63-76.
26. Singh NP. 1993. Clusiaceae (Guttiferae nom. alt.) In: Sharma, BD and Balakrishnan NP
(eds.), Flora of India 3. Botanical Survey of India, Kolkatta, 86-151.
27. Srivastava SK. 1994 Garcinia dhanikhariensis (Clusiaceae), a new species from Andaman
Islands, India. Nordic Journal of Botany, 14, 51-53.
28. Stevens PF. 2007. Clusiaceae. The families and genera of vascular plants. 9, Kubitzki K (ed.),
Berlin, Springer, 48-66.
29. Sweeney PW. 2008. Phylogeny floral diversity in the genus Garcinia (Clusiaceae) and
relatives. Int. J. Pl. Sci., 169 (9), 1288-1303.
30. Tootil E. 1984. The Penguin Dictionary of Botany. Penguin Books, London
31. Whitmore TC. 1973. Guttiferae. In: Whitmore TC (ed.), Tree Flora of Malaya, a Manual for
Foresters. 2, Longman, London, 196-225.
18
Chapter 2
Structural diversity of secondary metabolites in Garcinia species
A. P. Anu Aravind, Lekshmi N. Menon and K. B. Rameshkumar*

*
Abstract
Plants of the genus Garcinia produce structurally diverse secondary metabolites such as
biflavonoids, xanthones, benzophenones, flavonoids, biphenyls, acyl phloroglucinols,
depsidones and terpenoids. The rich diversity in chemical structures made the genus Garcinia
attractive for the phytochemists. In addition, several industrial sectors such as cosmetic, food,
pharmaceutics, neutraceutics and paints are centered around the genus. The genus is
represented by more than 250 species, among which nearly 120 species were subjected to
phytochemical investigation. A review of the structural diversity of secondary metabolites of
Garcinia species revealed that xanthones are the important class of secondary metabolites,
distributed in 74 Garcinia species, followed by benzophenones in 50 species and
biflavonoids in 45 species. Biphenyls, acyl phloroglucinols, depsidones and flavonoids are
some other interesting group of phenolic compounds in Garcinia species. The present chapter
enlists the major phenolic compounds reported from Garcinia species.
Keywords: Garcinia, Secondary metabolites, Xanthones, Biflavonoids, Benzophenones
Introduction
Plants continue to be an important source of diverse chemical structures with broad utilities in
several fields like medicines, cosmetics, food, neutraceutics and pesticides. Despite the
availability of alternative synthetic substituents, there has been an increasing awareness
worldwide towards the use of phytochemicals and other plant derived products. The ever
increasing demand for phytochemicals can be attributed to their diverse and complex
chemical structures that are difficult to replicate in the laboratory, greater number of chiral
centres and increased steric complexity compared to synthetic compounds (Croteau et al.,
2000, Hostettman and Marston, 2002).
The genus Garcinia is well known for the value added products such as essential oils,
fats, resins and colouring materials. Gamboge, the yellow colouring pigment, is a well known
product from Garcinia species. Fruits of some Garcinia species are rich source of red
pigments in the plant kingdom. Garcinia fruits are the source for a natural diet ingredient (-)
hydroxycitric acid (HCA), which is an anti-obesity compound (Hemshekhar, et al., 2011,
Parthasarathy, et al.,2013).
Recently, Garcinia species have received considerable attention worldwide from
scientific as well as industrial sectors and several novel structures, bioactivities and potential
utilities have been reported. Several industrial sectors like pharmaceutical, nutraceutical,
19
paint and food additives were centred around this potential group of trees (Hemshekhar, et
al., 2011, Magadula and Mbwambo 2014). In south India, G. gummi-gutta and G. indica
were cultivated for commercial extraction of a variety of products such as bioactive acids,
nutraceuticals, fats and condiments. In USA alone, mangosteen based beverages had a
turnover of more than $200 million in 2008.
The genus Garcinia is represented by 250 species in the pantropical region, with high
species richness in South East Asia. In India, 43 species and 5 varieties of the genus are
reported, of which 37 species and 4 varieties occur in wild naturally, while the rest were
introduced into cultivation. Nine Garcinia species were reported to occure naturally in the
Western ghtas, of which 7 are endemic to the region (Sabu et al., 2013, Sarma et al. 2016).
Of the nearly 250 species reported from world over, nearly 120 species were subjected to
phytochemical investigation. Though several monographs and reviews on Garcinia species
have appeared, a compilation of the phytochemistry of the Garcinia species has seldom been
attempted (Obolskiy et al., 2009). Venkataraman (1973) has reviewed the chemistry of
pigments from Garcinia species. A recent review on phytochemistry of Garcinia species in
Africa revealed that out of the 80 Garcinia species reported in Africa, only 21 species have
been investigated phytochemicaly (Magadula and Mbwambo 2014). Literature review
revealed that out of the 9 Garcinia species reported from the Western Ghats, only 4 species
have been studied in detail for their phytochemicals (Pandey et al., 2015, Anu Aravind et al.,
2015).
Garcinia species are reported as rich depository of structurally diverse secondary
metabolites such as xanthones, benzophenones and biflavonoids, in addition to flavonoids,
biphenyls, acyl phloroglucinols, depsidones and triterpenoids as minor constituents. Volatile
mono and sesqui terpenoids, and phenyl proapnoids were also reported from Garcinia
species. Present chapter review the diversity of phytochemicals, especially the phenolic
compounds, reported from Garcinia species worldover.
1. Xanthones
Xanthones, with two aromatic rings linked via carbonyl and ether linkages, are a group of
secondary metabolites originated biosynthetically by condensation of acetate and shikimate
derived moieties. Xanthones can be considered as regioselectively cyclized benzophenone
derivatives.The mixed biogenetic origin of xanthone necessitates that the carbons be
numbered according to biosynthetic convention (Figure 1). Carbons 1-4 were assigned to the
acetate derived ring A, while the carbons 5-8 to the shikimate derived ring B (Gottlieb, 1968,
Bennett and Lee, 1989).
O
8 1
7 2
B A
6 3
O
5 4
Figure 1. Numbering in typical xanthone structure
20
Xanthones are limited in distribution to a few plant families such as Clusiaceae,

Gentianaceae, Moraceae and Polygalaceae and several reviews on xanthones have been
published (Afsal and Al Hassan, 1980, Sultanbawa, 1980; Bennet and Lee, 1989, Peres et al.,
2000, Chantarasriwong et al., 2010, Anantachoke et al., 2012). Garcinia species are
important sources of xanthones and literature review revealed that 74 Garcinia species,
comprising more than half of all the Garcinia species studied so far, were reported to contain
xanthones (Table 1). Among different Garcinia species, G. mangostana has been studied
extensively, and reported to conatin the highest number of xanthones followed by G. cowa.
The xanthones isolated can be classified into five major groups: simple oxygenated
xanthones, prenylated xanthones, xanthone glycosides, xanthonolignoids, and miscellaneous
xanthones (Mandal et al.,1992). Simple oxygenated xanthones are subdivided according to
the degree of oxygenation into mono-, di-, tri-, tetra-, penta- and hexa-oxygenated xanthones.
Isopentenyl and geranyl substituted xanthones are the common types in the genus Garcinia.
The isopentenyl group may be modified by terminal cyclisation with ortho hydroxyl group to
give a chromene system as in the case of jacareubin (Bennet and Lee, 1989). In some cases,
the geranyl group may undergo cyclisation leading to structurally intriguing class of
secondary metabolites known as caged xanthones, where C ring has been converted into an
unusual 4-oxa-tricyclo[4.3.1.03,7]dec-8-en-2-one ring (caged) scaffold (Yang, et al., 2012).
Caged xanthones like gambogic acid and morellin were mainly reported from the genus
Garcinia (Figure 2). Some of the bixanthones reported from Garcinia species are
bigarcinenone (G. xanthochymus), garcilivins (G. livingstonei), garciobioxanthone (G.
oblongifolia) and griffipavixanthone (G. griffithi). Bennet and Lee (1989) have pointed that
1,3,5,6 tetraoxygenated xanthones were reported only from African Garcinia species and not
from any of the Asian Garcinia species.
O OH
O OH
MeO
O O O
HO O OH
OH
Mangostin Rheediaxanthone A
O
H O OH
O OH
O O O
H HO O OH
OH O OH
Gambogic acid Garciniaxanthone E
Figure 2. Prenylated xanthone (-mangostin), xanthone with terminal cyclisation and ortho-hydroxyl
group (rheediaxanthone), geranyl substituted xanthone (garciniaxanthone E) and caged xanthone
(gambogic acid)
21
Though complex in structure, Yang, et al. (2012) reported the rapid characterization of caged
xanthones in the resin of G. hanburyi using multiple mass spectrometric scanning modes. The
hyphenated approach combining centrifugal partition chromatography (CPC), high-
performance liquid chromatography (HPLC) with diode-array detection (DAD) and mass
spectrometry (MS) was applied to the fractionation and purification of xanthones from G.
mangostana fruits, where CPC efficiently separated the metabolites while the structural
information was obtained from mass spectral data (Michel et al., 2012). A simple UV-Vis
spectrophotometry method has been reported for the estimation of xanthones in G.
mangostana, using -mangostin, that has absorption maxima at 243.4 and 316.4 nm, as the
reference compound (Aisha et al., 2013).
Xanthones are attributed with remarkable bioactivities such as antibacterial,
antifungal, antiviral, antioxidant, anti-inflammatory and cytotoxic to cancer cells (Chin et al.,
2008; Peres et al.,2000). The xanthone -mangostin, attributed with antioxidant and
anticarcinogenic properties, is one of the active ingredients of nutritional supplements derived
from mangosteen (G. mangostana) fruits (Gutierrez-Orozco and Failla, 2013). Most of the
caged xanthones are reported with potential antitumor activity, with gambogic acid being the
best representative and most studied member of this group of compounds (Han and Xu, 2009,
Chantarasriwong et al., 2010, Xu et al., 2015). Desoxymorellin, morellic acid, gambogic
acid, forbesione, hanburin, and dihydroisomorellin were reported to exhibit anti-HIV-
1 activity (Reutrakul et al., 2007). 7-O-methylgarcinone E, cowanin, cowanol,
cowaxanthone, and β-mangostin were found to possess in vitro antimalarial activity against
Plasmodium falciparum (Likhitwitayawuid et al.,1998). α- and β-Mangostins, and garcinone
B exhibited strong inhibitory effect against Mycobacterium tuberculosis. Structure activity
relationship (SAR) studies showed that tri- and tetra-oxygenated xanthones with di-C5 units
or with a C5 and a modified C5 groups are essential for higher activities (Suksamrarn et al.,
2003).
Table 1. Xanthones reported from Garcinia species

Sl. Garcinia Plant part Xanthones Reference
No. species
1 G. afzelii Stem bark Afzeliixanthones A and B Waffo et al.,
2006
2 G. Stem bark Cudraxanthone G, 1,3,5-trihydroxy-4- Lavaud et al,
amplexicaulis prenylxanthone, nigrolineaxanthone F, and 1,3,7- 2015
trihydroxy-2-prenylxanthone
3 G. assigu Stem bark Assiguxanthone A and B, dulxanthone A-D, and Ito et al., 1997
latisxanthone A-D
4 G. atroviridis Stem bark Garcinexanthone G Tan et al.,2016
5 G. benthamiana Leaf 1,3,6,7-Tetrahydroxy xanthone Amelia et al.,
2015
Stem bark Benthamianone See et al., 2016
6 G. bracteata Leaf Garcibracteatone, xerophenone C, 5-O- Thoison et al,
methylxanthone V1, nemorosonol, and 10-O- 2005
methyl macluraxanthone
Bark Neoisobractatins A and B, and bracteaxanthone I Thoison et al,
and II 2005
22
Stem bark 1,4,5,6-Tetrahydroxy xanthone, bracteaxanthones Niu et al, 2012

III-VI, 1,4,6-trihydroxy-5-methoxy-7-
prenylxanthone, 1,4,5,6-tetrahydroxy-7,8-di(3-
methylbut-2-enyl)xanthone, 1,4,5,6-tetrahydroxy-7-
prenylxanthone, 1,4,5-trihydroxyxanthone, 1,4-
dihydroxy-5,6-dimethoxyxanthone,
garciniaxanthone H, symphoxanthone, 1-O-
methylsymphoxanthone, morusignin I,
garcinexanthone B, 6-deoxyjacareubin, 1,3,5,6-
tetrahydroxyxanthone, 1,3,6,7-
tetrahydroxyxanthone, 1,5-dihydroxy-3-
methoxyxanthone, 1,5-dihydroxy-3,8-
dimethoxyxanthone, 1,7-dihydroxyxanthone, 1,2,5-
trihydroxyxanthone, 2,6-dihy droxy-1,5-
dimethoxyxanthone, 2,5-dihy droxy-1-
methoxyxanthone, 1,2, 5-trihydroxy-6-
methoxyxanthone, 12-hydroxy- D-garcigerrin A,
3-hydroxy-1, 5-dimethoxyxanthone,
garciniaxanthone E, 6-deoxyisojacareubin, and
garciduol A
Twig Neobractatin Na et al, 2010
7 G. brasiliensis Epicarp 1,3,6,7-Tetrahydroxyxanthone Gontijo et al,
2012
8 G. buchananii Heartwood Buchanaxanthone, 1,5,6-trihydroxyxanthone and Jackson et al.,
1,5-dihydroxyxanthone 1968a
9 G. cantleyana Twig 1,3,6-Trihydroxy-5 -methoxy-7-(30-methyl-20-oxo- Jantan and
but-30-enyl)xanthone, 1,3,5-trihydroxyxanthone, Saputri, 2012
1,3,8-trihydroxyxanthone, 2,4,7-trihydroxy
xanthone, and 1,3,5,7-tetrahydroxyx anthone
Leaf and Cantleyanone A, 7-hydroxyforbesione, 4-(1,1- Shadid et al,
trunk bark dimethylprop-2-enyl)-1,3,5,8-tetrahydroxy 2007
xanthone, and cantleyanones B-D
10 G. chapelieri Bark Chapexanthone A and B Rambeloson et
al, 2014
11 G. Pericarp Dulxanthone A, 1,3,5-trihydroxy-6-methoxy-7-(3- Nguyen et al,
cochinchinensis methylbut-2-enyl)xanthone, 1,3,5-trihydroxy- 2011
13,13-dimethyl-2H-pyran[7,6-b]xanthen-9-one, and
1,3-dihydroxy-5,6-dimethoxy-7-(3-methyl- but-2-
enyl)xanthone
12 G. costata Branch Costatin Nuangnaowarat
et al.,2010
13 G. cowa Leaf Cambogic acid and mangostin Pandey et al.,
2015
Stem bark Garciniacowol, garciniacowone, parvifoliol F, α- Siridechakorn
mangostin, β-mangostin , cowaxanthone, et al, 2012
norcowanin, cowanin, cowanol, cowagarcinone B,
cowagarcinone D, cowagarcinone E, fuscaxanthone
A, fuscaxanthone C, 6-O-methylmangostanin,
cowaxanthone D, and 1,7-dihydroxyxanthone
2-(3-Methyl-2-butenyl)-1,5,6-trihydroxy-3- Wahyuni et al,
methoxy-4- (1,1-dimethyl-2-propenyl)-9H- 2004
xanthen-9-one, and rubraxanthone
23
7-O-Methyl garcinone E Likhitwitayawu

id et al.,1997
Cowanin, cowanol, norcowanin, cowaxanthone, and Thongtheerapar
1,3,6-trihydroxy-7-methyl-2,5-bis(preny1) xanthone p et al., 1994
1,3.6-Trihydroxy-7-methoxy-8-(3,7-dimethyl)-2,6- Lee et al.,1977

octadieny xanthone
Fruit Cowaxanthones A-E, l,6-dihydroxy-3,7-dimethoxy- Panthong et al.,
2-(3-methyl-2- butenyl)xanthone, fuscaxanthone C, 2006
7-O-methylgarcinone E, -mangostin, mangostanin,
6-O-methyl mangostanin, α-mangostin, and
cowaxanthone
Garcicowanones A and B, 9-hydroxy Auranwiwat et
calabaxanthone, β-mangostin, fuscaxanthone A, al., 2014
cowaxanthone D, cowanin, α-mangostin,
cowagarcinone E, and rubraxanthone
Garciniacowones A-E, cowaxanthone,1 3-O- Sriyatep et al.,
methylmangostenone D, garcinianone A, and 2015
garcinianone B
Twig Cowaxanthone F and 1,6-dihydroxyxanthone Panthong et al.,
2009
-Mangostin, cowanol, cowanin, norcowanin and Cheenpracha et
3,6-di-O-methyl--mangostin al., 2011
Flower Garciniacowones D and E, mangostanin, 6-O- Sriyatep et al.,
methylmangostanin, fuscaxanthone A, 2015
fuscaxanthone C, 7-O-methylgarcinone
E, cowaxanthone D, α-mangostin, β-mangostin,
3,6-di-O-methyl-γ-mangostin, and rubraxanthone
Root Kaennacowanols A-C Kaennakam et
al., 2015
Leaf Cowaxanthones G and H, 1,3,5-trihydroxy-6′,6′- Xia et al., 2015
dimethyl-2H-pyrano(2′,3′:6,7)xanthone, 1,5,6-
trihydroxy-2-prenyl-6′,6′-dimethyl-2H-
pyrano(2′,3′:3,4)xanthone, isojacareubin,
guttiferone F, jacareubin, xanthone V1,
isoprenylxanthone, garcinexanthone C, xanthone
V1a, 1,3,5-trihydroxyxanthone, ugaxanthone, 1,5,6-
trihydroxy-3-methoxyxanthone, 1,3,7-trihydroxy
xanthone, and 1,4,5-trihydroxyxanthone
Latex Cowagarcinone A-E, cowaxanthone, cowanin, Mahabusaraka
cowanol, 1,3,6-trihydroxy-7-methoxy-2,5-bis(3- m et al., 2005
methyl-2- butenyl)xanthone, mangostinone, and
fucaxanthone A
14 G. Stem bark Cylindroxanthones A-C Sukandar et al.,
cylindrocarpa 2016
15 G. cuneifolia Stem bark Cuneifolin Ee et al., 2003
16 G. densivenia Stem bark Pyranojacareubin Waterman and
Crichton, 1980
17 G. dulcis Leaf Dulxanthone E Kosela et al.,
1999
Fruit Dulcisxanthone A, l,6-dihydroxy-3,7-dimethoxy-2- Deachathai et
24
(3-methyl-2-butenyl)xanthone, cowaxanthone, al., 2005

cowanin, l,7-dihydroxy-3-methoxy-2-(3- methyl-2-
butenyl)xanthone, 1,5,8-trihydroxy-3-methoxy-2-
(3-methyl-2- butenyl) xanthone, BR-xanthone A,
mangostin, 6,8,12-trihydroxy-7-(3-methyl-2-
butenyl)- 2-methyl-2-(4-methyl-3-
pentenyl)pyrano(20,30:7, 8)xan thone, garcinone D,
mangostenol, tovophyllin A, and cratoxylone
18 G. echinocarpa Bark and 1,5-Dihydroxyxanthone and 1,3,6,7-tetrahydroxy Bandaranayake
wood xanthone et al., 1975
Leaf Cambogic acid and mangostin acid Pandey et al.,
2015
19 G. edulis Root bark 1,4,6-Trihydroxy-3-methoxy-2-(3-methyl-2- Magadula, 2010
butenyl)-5-(1,1- dimethyl-prop-2-enyl) xanthone
and forbexanthone
20 G. esculenta Twig 1,3,5,7-Tetrahydroxy-8-isoprenylxanthone Zhang et al.,
2015
21 G. eugenifolia Twig 5,9-Dihydroxy-8-methoxy-2,2-dimethyl -7-(3- Mian et al.,
methylbut-2-enyl)pyrano[3,2-b]xanthen-6(2H)-one 2010
Heart wood Euxanthone, gentisin, 1,4,7-trihydroxy-3- Jackson et al.,
methoxyxanthone, 1,5,6-trihydroxyxanthone, and 1969
1,6,7-trihydroxyxanthone
22 G. forbesii Branch and Forbexanthone, pyranojacareubin, and 1,3,7- Harrison et
twig trihydroxy-2-(3-methylbut-2-enyl)-xanthone al.,1993
23 G. fusca Root Fuscaxanthone I, 𝛽𝛽-mangostin, fuscaxanthone A, Nontakham et
cowanin, cowaxanthone, α-mangostin, cowanol, al., 2014
isojacareubin, fuscaxanthone G, and 1,3,5,6-
tetrahydroxyxanthone
Stem bark Fuscaxanthone A-H, cowaxanthone, β-mangostin, Ito et al., 2003a
cowanin, rubraxanthone, α-mangostin, cowanol,
norcowanin, 7-O-methylgarcinone, and garbogiol
24 G. gaudichaudii Bark Gaudispirolactone Wu et al., 2001
Gaudichaudiic acids F , G , H and I Xu et al., 2000
Leaf Gaudichaudiones A- H, gaudichaudiic acids A-E, Cao et al., 1998
morellic acid, and forbesione
25 G. griffithii Stem bark 1,5-Dihydroxy-3,6-dimethoxy-2,7- Elfita et al.,
diprenylxanthone and 1,6- dihydroxyxanthone 2009
1,7-dihydroxyxanthone, 1,3,6,7- Nguyen et al.,
tetrahydroxyxanthone and 1,3,5,6-tetrahydroxy 2005
xanthone
Griffipavixanthone Xu et al., 1998
Leaf 1,3,5,6-Tetrahydroxy-7-(3-methylbut-2- Alkadi et al.,
enyl)xanthone and rubraxanthone 2013
26 G. gummi-gutta Leaf Cambogic acid and mangostin Pandey et al.,
(G. cambogia) 2015
Root Garbogiol Iinuma et al.,
1998
Semwal et al.,
2015
Bark Rheediaxanthone Semwal et al.,
2015
25
Fruit Oxy-guttiferone K , oxy-guttiferone K2 Masullo et al,

and oxy-guttiferone 2010 and
Oxy-guttiferones M, K, K2 and I Semwal et al.,
2015
27 G. hanburyi Resin Garcinolic acid, 10α-ethoxy-9,10-dihydromorellic Deng et al.,
acid, and 10α-ethoxy-9,10-dihydrogambogenic 2012
acid
Gambogic aldehyde Wang et al.,
2008
Forbesione, isomorellic acid, morellic acid, R-30- Zhou et al.,
hydroxygambogic acid, S-30-hydroxygambogic 2008a
acid, isogambogenic acid, gambogenic acid, R-
isogambogic acid, S-isogambogic acid, R-gambogic
acid, S-gambogic acid, desoxymorellin,
isogambogenin and isomorellinol
Forbesione, forbesionic acid, isoforbesionic acid, Yang et al.,
desoxygaudichaudione A, gaudichaudionol, 2012
isogaudichaudionol, epoxylgaudichaudione A,
gaudichaudione A, isogaudichaudione A,
gaudichaudionic acid, isogaudichaudionic acid,
desoxymorellin, morellinol, isomorellinol, morellin
isomorellin, morellic acid, isomorellic acid,
desoxygambogenin, gambogeninol,
isogambogeninol, gambogenin, isogambogenin,
gambogenic acid, isogambogenic acid,
dihydrodesoxygambogenin S-gambogic acid,R-
gambogic acid, S-30-hydroxygambogic acid, R-30-
hydroxygambogic acid, R tetrahydrogambogic acid,
and hanburin R
Latex Gambogin, morellin dimethyl acetal, isomoreollin Asano et al.,
B, moreollic acid, gambogenic acid, gambogenin, 1996
isogambogenin, desoxygambogenin, gambogenin
dimethyl acetal, gambogellic acid, hanburin,
gambogic acid, isomorellin, morellic acid, and
desoxymorellin
Isogambogenic acid, desoxymorellinin, 10- Feng et al.,
methoxygambogenic acid, 10-methoxygambogic 2007
Acid, and 10-ethoxy gambogic acid
28 G. Leaf Cambogic acid and mangostin Pandey et al.,
hombroniana 2015
Twig Garcihombronones A-D Klaiklay et al.,
2013
Bark 1,3,6-Trihydroxy-7-methoxy-2,8-(3-methyl- 2- Jamila et al.,
butenyl) xanthone 2014
1,3,6,7-Tetrahydroxy xanthone Jamila et al.,
2014a
29 G. indica Leaf Cambogic acid and mangostin Pandey et al.,
2015
30 G. linii Root 1,5-Dihydroxy-6-methoxy xanthone and 1,7- Chen et al.,
dihydroxy-3-methoxy xanthone 2006
31 G. lancilimba Stem bark 1,5,6-Trihydroxy-6',6'-dimethyl-2H- Yang et
pyrano(2',3':3,4)-2-(3-methylbut-2-enyl) xanthone al.,2007
26
and 1,6,7-trihydroxy-6',6'-dimethyl-2H-
pyrano(2',3':3,2)-4-(3-methylbut-2-enyl) xanthone
32 G. lateriflora Stem bark Isomoreollic acid, isogaudichaudiic acid, Ren et al., 2010
isogaudichaudiic acid E, 11,12-dihydro -12-
hydroxy morellic acid, and isogaudichaudiic acid B
33 G. livingstonei Root bark 1,4,5-Trihydroxy-3-(3-methylbut-2-enyl)-9H- Sordat-Diserens
xanthen-9-one, 1,4,5-Trimetkoxy-3-(3-methylbut-2- et al., 1992a
enyl)-9H-xanthen-9-one, 3,4-dihydro-6,1l-
dihydroxy-2,2-dimethyl-pyrano[3,2-c]-xan-then-
7(2H)-one, 6,11-dihydroxy-2,2-dimethyl-pyrano
[3,2-c] xanthen-7(2H)-one, and 6,l l-dihydroxy-3-
methyl-3-(4-methylpent-3-enyL)- 3H,7H-
pyrano[2,3-c] xanthen-7-one
Garcilivin A-C Sordat-Diserens
et al., 1992
34 G. lucida Stem bark 1,2‐Dihydroxy xanthone and 1‐hydroxy‐2‐methoxy Momo et al.,
xanthone 2011
35 G. malaccensis Stem bark α and β-Mangostins Taher et al.,
2012
36 G. mangostana Leaf Cambogic acid and mangostin Pandey et al.,
2015
Gartanin Sen et al.,1980
1,5,8-Trihydroxy-3-methoxy-2[3- methyl-2- Parveen and
butenyl] xanthone, and 1,6-dlhydroxy-3- methoxy- Khan,1988
2[3-methyl-2-butenyl]xanthone
Pericarp Mangostinone, α, β and γ-mangostins, gartanin, Asai et al.,1995
garcinone E, 1,5-dihydroxy-2-(3-methylbut- 2-
enyl)-3-methoxy xanthone, and 1,7-dihydroxy-2-(3-
methylbut-2-enyl)-3-methoxyxanthone
1,3,7-Trihydroxy-2-(3-methyl-2-butenyl)-8-(3- Xu et al., 2014
hydroxy-3-methylbutyl)-xanthone,
1,3,8-trihydroxy-2-(3-methyl-2-butenyl)-4-(3-
hydroxy-3-methylbutanoyl)-xanthone, garcinones C
and D, gartanin, xanthone I, and γ-mangostin
3-Hydroxy-6-methoxy-5’-isopropyl-4’,5’- Zhao et al.,
dihydrofuro [2’,3’ : 7, 8]-6”,6”-dimethyl-4”,5”- 2012
dihydropyrano[2”,3” : 1,2]xanthone, and 1,6-
dihydroxy-7-methoxy-8-(3-methylbut-3-enyl)-6’,6’-
dimethyl-4’,5’-dihyd ropyrano[2’3’’ : 3,2] xanthone
Garcimangosxanthone A-C, α-mangostin, γ- Zhang et al.,
mangostin, garcinone C and D, trapezifolixanthone, 2010a
8-deoxygartanin, gartanin, 2-(γ,γ-dimethylallyl)-
1,7-dihydroxy-3-methoxyxanthone
1,5-dihydroxy-3-methoxy-2-prenylxanthone
garcinone B, 9-hydroxycalabaxanthone,
dulxanthone D and 1,3,7-trihydroxy-2-(3-
methylbut-2-enyl)-xanthone and tevophyllin A
8-Hydroxycudraxanthone G, mangostingone [7- Jung et al.,
methoxy- 2-(3-methyl-2-butenyl)-8-(3-methyl-2- 2006
oxo-3-butenyl)-1,3,6-trihydroxyxanthone,
cudraxanthone G, 8-deoxygartanin, garcimangosone
B, garcinone D, garcinone E, gartanin, 1-
27
isomangostin, R-mangostin, γ-mangostin,

mangostinone, smeathxanthone A, and tovophyllin
A
Garcimangosxanthone F-G Zhou et al.,
2015
Garcimangosxanthone D-E Zhou et al.,
2011
1,3,6-Trihydroxy-2-(3-methylbut-2-enyl)-8-(3- Xu et al., 2016
formyloxy-3-methylbutyl)xanthone
3-Isomangostin, 8-desoxygartanin, gartanin, Ji et al., 2007
α-mangostin, 9-hydroxycalabaxanthone, and β-
mangostin
3-Isomangostin, 8-desoxygartanin, gartanin, Ji et al., 2007
α-mangostin, 9-hydroxycalabaxanthone, and β-
mangostin
Mangostin, Gartanin, ϒ-Mangostin, β-mangostin, 3- Mahabusakara
isomangostin, 3-isomangostin hydrate and 1- m et al., 1987
isomangostin hydrate
Fruit 1,2-Dihydro-1,8,10-trihydroxy-2-(2- Chin et al.,
hydroxypropan-2-yl)-9-(3-methylbut-2- 2008
enyl)furo[3,2-a]xanthen-11-one, 6-deoxy-7-
demethylmangostanin, 1,3,7-trihydroxy- 2,8-di-(3-
methylbut-2-enyl)xanthone, mangostanin, and α-
mangostin
3-Isomangostin, mangostanol, 8-deoxygartanin Zarena and
gartanin, α-mangostin, garcinone E, 9-hydroxy Sankar, 2009
calabaxanthone, and γ-mangostin
α-Mangostin, γ-mangotsin,gartanin,1- Quan et al.,
isomangostanin, garcinone E, and tilirosidea 2010
Fruit hull Garcinones A, B and C Sen et al., 1982
Mangostenol, mangostenone A, mangostenone B, Suksamrarn et
trapezifolixanthone, tovophyllin B, α and β- al., 2002
mangostins, garcinone B, mangostinone, and
mangostanol
α and γ-Mangostin Chen et al.,
2008
BR-Xanthone A and B Balasubramanian
and
Rajagopalan,
1988
Mangostanol, α-mangostin, γ-mangostin, gartanin, Chairungsrilerd
8-deoxygartnin, 5,9-dihydroxy-2,2-dimethyl-8- et al., 1996
methoxy-7-(3- methylbut-2-enyl)-2H,6H-
pyrano[3,2-b]xanthen-6-one, garcininone E, and 2-
(γ,γ-dimethylallyl)-l,7-dihydroxy-3-
methoxyxanthone
β-Mangostin, 9 hydroxy calabaxanthone, Ryu et al., 2011
mangostanol, mangostenone F, allanxanthone E, α-
mangostin, mangostingone, garcinone D, γ-
mangostin, mangosenone G, cudraxanthone, 1,5,8-
trihydroxy-3-methoxy-2-(3-methylbut-2-
enyl)xanthone, 8- deoxygartanin, gartanin,
smeathxanthone A, and 1,3,6-trihydroxy-7-
28
methoxy-2-(3-methylbut-2-enyl)-8-(2-oxoethyl)-
9H-xanthen-9-one
2,7-Di- 3-methylbut-2-enyl -1,3,8-trihydroxy-4- Gopalakrishnan
methyl xanthone and 2,8-di- 3-methylbut-2-enyl -7- et al., 2000
carboxy-1,3-dihydroxyxanthone
1,3,6,7-Tetrahydroxy-2,8-(3- methyl-2-butenyl) Yu et al., 2007
xanthone and1,3,6-trihydroxy-7-methoxyl-2,8-(3-
methyl-2- butenyl) xanthone
Garcimangosone A, garcimangosone B, and Huang et al.,
garcimangosone C 2001
1,5-dihydroxy-2-(3-methyIbut-2-enyl)-3- Sen et al.,1981
methoxyxanthone and 1,7-dihydroxy-2-(3-
methylbut-2-enyl)-3-methoxyxanthone
Mangostin, BR-xanthone A, gartanin, β-mangostin Gopalakrishnan
γ-mangostin, and garcinone D et al., 1997
Gartanin, 8-deoxygartanin, normangostin, Govindachari et
-mangostin, and β-mangostin al., 1971
Mangostin Yates and
Stout, 1958
Seed case β-Mangostin, 9-hydroxy calabaxanthone, Ryu et al., 2010
mangostanone, α-mangostin, garcinone D, γ-
mangostin, cudraxanthone, 8-deoxygartanin,
gartanin, smeathxanthone A, and mangostenone F,
G
Heartwood Mangoxanthone, dulxanthone D, 1,3,7-trihydroxy- Nguyen et al.,
2-methoxyxanthone, and 1,3,5-trihydroxy-13,13- 2005
dimethyl-2H-pyran[7,6-b]xanthen-9-one
α-Mangostin, β-mangostin, γ- mangostin, Nilar and
garciniafuran, 1-hydroxy-8-(2-hydroxy-3- Harrison, 2002
methylbut-3-enyl)- 3,6,7-trimethoxy-2-(3-
methylbut-2-enyl)-xanthone, 1,6-dihydroxy-2-(2-
hydroxy-3-methylbut-3-enyl)- 3,7-dimethoxy-8-(3-
methylbut-2-enyl)-xanthone, 1,6-dihydroxy-8-(2-
methylbut-2-enyl)-xanthone, 1-hydroxy-3,6,7-
trimethoxy-2-(2-hydroxy-3- methylbut-3-enyl)-8-
(3-methylbut-2-enyl)-xanthone, 1,3-dihydroxy-2-(2-
methylbut-2-enyl)-xanthone, mangostanin, (16E)-
1,6-dihydroxy-8-(3-hydroxy-3-methylbut-1- enyl)-
3,7-dimethoxy-2-(3-methylbut-2-enyl)-xanthone ,
6-O-methylmangostanin, (16E)-1-hydroxy-3,6,7-
trimethoxy-2-(3-methylbut- 2-enyl)-8-(3-hydroxy-
3-methylbut-1-enyl)-xanthone, 1,6-dihydroxy-3,7-
dimethoxy-2-(3-methylbut-2- enyl)-xanthone, 1-
hydroxy-3,6,7-trimethoxy-2-(3-methylbut-2- enyl)-
8-(2-oxo-3- methylbut-3-enyl)-xanthone, and 1-
hydroxy-3,6,7-trimethoxy-2-(3-methylbut-2- enyl)-
xanthone
Aril Mangostin, Calbaxanthone, Mahabusakara
Demethylcalbaxanthone, 2-(γ,γ-dimethylallyl)-l,7- m et al., 1987
dihydroxy-3- methoxyxanthone and 2,8-bis-(γ,γ-
dimethylallyl)-l,3,7-trihydroxyxanthone
29
Aril and 1,7-Dihydroxy-3-methoxy- 2-(3-methylbut-2- Wittenauer et

pericarp enyl)xanthone, γ-mangostin, 8-deoxygartanin al., 2012
1,3,7-trihydroxy-2,8-di- (3-methylbut-2-
enyl)xanthone, 1,3,7-trihydroxy-2,8-di- (3-
methylbut-2- enyl)xanthon gartanin, α-mangostin,
and garcinon E
Stem and 2,6-Dihydroxy-8-methoxy-5-(3- methylbut-2-enyl)- Ee et al., 2006
root xanthone
Stem Mangosharin , (2,6-dihydroxy-8-methoxy-5-(3- Ee et al., 2006
methylbut-2-enyl)-xanthone), α -mangostin, β-
mangostin, garcinone D, 1,6-dihydroxy-3,7-
dimethoxy-2-(3-methylbut-2-enyl)-xanthone,
mangostanol and 5,9-dihydroxy-8-
methoxy-2,2-dimethyl-7-(3-methylbut-2-enyl)-
2H,6H-pyrano-[3,2-b]-xanthene-6-one
Stem bark Mangaxanthone B, mangostanin, and mangostenol See et al., 2014
11-Hydroxy-3-O-methyl-1-isomangostin,11- Han et al., 2009
hydroxy-1-isomangostin, 11α-mangostanin, 3-
isomangostin, α-mangostin, β-mangostin, garcinone
D , 9 hydroxy calabaxanthone, 8-deoxygartanin,
gartanin, and cratoxyxanthone
Root bark β-Mangostin, α-mangostin, garcinone-D, Ee et al.,2006
mangostanol, and gartanin
Mangostin and β-mangostin Govindhachari
et al., 1971
Latex Mangostin and β-mangostin Govindachari et
al., 1971
37 G. merguensis Bark Merguenone, 1,5-dihydroxy-60-methyl-60-(4- Nguyen et al.,
methyl-3-pentenyl)- pyrano(20,30:3,2)-xanthone, 2003
subelliptenone H, 8-deoxygartanin, rheediaxanthone
A, morusignin G, 6-deoxyjacareubin, 1,3,5-trihy-
droxy-4,8-di(3-methylbut-2-enyl)-xanthone,
rheediachromenoxanthone, and 6-
deoxyisojacareubin
Twig Merguensinone and 1,5,6- trihydroxy-2-prenyl- Trisuwan et al.,
60,60-dimethyl-2H-pyrano(20,30:3,4)xanthone 2013
Wood 5-Farnesyltoxyloxanthone B, α-mangostin, Kijjoa et al.,
rubraxanthone, and isocowanol 2008
38 G. morella Seed Morellin Rao 1937, Rao
and Natarajan
1950 and
Kartha et al.,
1963
Pericarp Morellin Karanjgaokar et
al., 1967
Leaf Cambogic acid and mangostin Pandey et al.,
2015
39 G. nervosa Stem bark Nervosaxanthone Ampofo and
Waterman,
1986
40 G. nobilis Stem bark Caroxanthone, 4-prenyl-2-(3,7-dimethyl-2,6- Fouotsa et
octadienyl)-1,3,5,8-tetrahydroxyxanthone, al.,2012
smeathxanthone A, gartanin, euxanthone, 8-
hydroxycudraxanthone G, and morusignin I
30
41 G. nigrolineata Leaf Nigrolineaxanthones J-S Rukachaisirikul

et al., 2003
Stem bark Nigrolineaxanthones A–I, 1,3,5-trihydroxy-4-(3- Rukachaisirikul
hydroxy-3-methylbutyl)xanthone, 1,3,7-trihydroxy- et al., 2003c
2-(3-hydroxy- 3-methylbutyl)xanthone, 6-
deoxyjacreubin, morusignin C, 1,5-dihydroxy-6’,6’-
dimethylpyrano[2’,3’:3,2] xanthone, and
tovoxanthone
42 G. nitida Stem bark 1,6-Dihydroxy-5-methoxy-6,6- Ee et al., 2012
dimethylpyrano[2',3':2,3]-xanthone, inophyllin B,
osajaxanthone, 3-isomangostin, and rubraxanthone
43 G. nujiangensis Twig Nujiangexanthones C-F, jacareubin, guttiferone F, Tang et al.,
cudratricusxanthone E, and garcihombronone B 2015
Leaf Nujiangexanthones A and B Xia et al., 2012
44 G. oligantha Stem Oliganthins A-D and gaudichaudione H Gao et al., 2012
Leaf Oliganthin H, I, K and L, oliganthic Tang et al.,
acids A-C, oliganthaxanthone A, oliganthaxanthone 2016
B, gaudichaudione H, and cantleyanone
Stem bark Macluraxanthone Waterman and
Crichton 1980b
45 G. opaca Leaf Macluraxanthone, 1,3,5-trihydroxy-6’,6’- Goh et al.,1992
dimethylpyrano-(2,3’:6,7)-4-( l,l-dimethylprop-2-
enyl)xanthone, 1,3,5-trihydroxy-6′,6′-
dimethylpyrano(2′,3′:6,7)-2-(3-methylbut-2- enyl)-
4-(1,1- dimethylprop-2-enyl)xanthone, and 4″,5″-
dihydro-1,5-dihydro-1,5-dihydroxy-6′,6′-
dimethylpyrano(2′,3′:6,7)-2-(3- methylbut-2-enyl)-
4″,4″,5″-trimethylfurano(2″,3″:3,4) xanthone
46 G. paucinervis Leaf Paucinervins H-J Li et al., 2016a
47 G. parvifolia Twig Parvifolixanthones A-C Rukachaisirikul
et al., 2006
Bark Parvixanthones A−I Xu et al., 2001
Parvixanthone A and rubraxanthone Kardono et al.,
2006
48 G. pedunculata Bark Pedunxanthones A–C, 1,5-dihydroxy-3- methoxy- Vo et al., 2012
6’,6’-dimethyl-2H-pyrano(2’,3’:6,7)-4-(3-
methylbut-2-enyl)xanthone, 1,5-dihydroxy-3-meth-
oxy-4-(3-methylbut-2-enyl)xanthone, dulxanthone
A, and garbogiol
Heartwood 1,3,5,7-tetrahydroxyxanthone and 1,3,6,7- Rao et al.,1974
tetrahydroxyxanthone
Pericarp Pedunxanthones D-F Vo et al., 2015
49 G. penangiana Leaf 4-(1,1-Dimethylprop-2-enyl)-1,3,5,8- Jabit et al.,
tetrahydroxyxanthone penangianaxanthone, 2007
cudratricusxanthone H, macluraxanthone C, and
gerontoxanthone C
50 G. polyantha Stem bark Bangangxanthone A and B, 1,5-dihydroxyxanthone, Lannang et al.,
and 2-hydroxy-1,7-dimethoxyxanthone 2005
Isorheediaxanthone B Ampofo and
Waterman,
1986
Polyanxanthone Komguem et
al., 2006
31
Root bark Garciniaxanthone I, smeathxanthone Lannang et al.,

A, smeathxanthone B, and chefouxanthone 2008
Wood trunk Polyanxanthone A, B, C, 1,3,5-trihydroxyxanthone, Louh et al.,
1,5-dihydroxyxanthone, 1,3,6,7-tetrahydroxy 2008
xanthone, 1,6-dihydroxy-5-methoxy xanthone, and
1,3,5,6-tetrahydroxy xanthone
51 G. porrecta --- Porxanthone A and dulxanthone E-G Kardono et al.,
2006
52 G. propinqua Twig Doitunggarcinone C, dulxanthone B, 5-O- Tantapakul et

methylxanthone V1, 10-O-methylmacluraxanthone, al., 2012
macluraxanthone, gartanin, and morusignin J
Root Doitunggarcinone D Meesakul et al.,
2016

pushpangadani 2015
ana
54 G. pyrifera Stem bark Rubraxanthone, isocowanin, and isocowanol Ampofo and
Waterman,
1986
55 G. quadrifaria Stem bark 1, 3, S-Trihydroxy-4, 8di(3, 3- Waterman and
dimethylallyl)xanthone Hussain, 1982
56 G. rigida Leaf Yahyaxanthone Elya et al.,2008
Musaxanthone and asmaxanthone Elya et al.,
2006a
57 G. Bark 6-O-Demethyloliverixanthone, schomburgxanthone, Vo et al., 2012a
schomburgkian cowanin, cowanol, fuscaxanthones A and B, 3-
a isomangostin hydrate, and 1,7-dihydroxyxanthone
Root Schomburgxanthone A Sukandar et al.,
2016a
Branch Euxanthone and gentisein Meechai et al.,
2016
58 G. scortechinii Twig Scortechinones A-C Rukachaisirikul
et al., 2000a
Fruit Scortechinones Q-T, scortechinones U-X, Sukpondma et
scortechinones A-F, H, I, M, L, and P al., 2005
Latex Scortechinones D-K Rukachaisirikul
et al., 2003b
59 G. Stem bark Smeathxanthone A and B Komguem et
smeathmannii al., 2005
Cheffouxanthone, 1,5 dihydroxyxanthone, 1,3,5- Kuete et al.,
trihydroxyxanthone, bangang xanthone A, 2007
smeathxanthone B, and smeathxanthone A
1,3,5,8-Tetrahydroxy-2-(3-methybut-2-enyl)-4-(3,7- Fouotsa et al.,
dimethylocta-2,6-dienyl)xanthone, 2015
cheffouxanthone, smeathxanthone A,
smeathxanthone B, and ananixanthone
Root bark Cheffouxanthone , smeathxanthones A, and Lannang et al.,
smeathxanthones B 2006
60 G. speciosa Bark α-Mangostin, cowanin and cowanol Okudaira et al.,
2000
61 G. spicata Leaf Cambogic acid and mangostin Pandey et al.,
32
2015
62 G. staudtii Stem bark Rheediaxanthone-A Waterman and
Hussain, 1982
Twig Staudtiixanthones A-D, α-mangostin, 9 garcinone Ngoupayo et
B, 9 demethylcalabaxanthone, gartanin, and al., 2009
xanthone V1
63 G. subelliptica Heartwood Garciniaxanthones A and B Fukuyama et
al., 1991
Wood Garciniaxanthone C, 1,2,5-trihydroxyxanthone, 2,6- Minami et al.,
dihydroxy-1,5-dimethoxyxanthone, and 1,2- 1994
dihydroxy-5,6-dimethoxyxanthone
2,5-Dihydroxy-1-methoxylxanthone, l-O- Minami et al.,
methylsymphoxanthone, garciniaxanthone E 1996
symphoxanthone, and subelliptenone A
1,6-O-Dimethylsymphoxanthone Minami et al.,
1998
Root bark 1,4,5,6-Tetrahydroxy-2-(1,1-dimethyl-2- propenyl)- Iinuma et al.,
7,8,-di-(3-methyl-2-butenyl)xanthone, and 1,2,5,6- 1994
tetrahydroxy-4-(1,l-dimethyl-2-propenyl)-7- (3-
methyl-2-butenyl)xanthone, subelliptenones A and
B
Subelliptenones C and subelliptenones D Iinuma et
al.,1995
Subelliptenones H and subelliptenones I Iinuma et al.,
1995a
Subelliptenones E and subelliptenones F Iinuma et al.,
1995b
64 G. terpnophylla Timber and 1,5-Dihydroxyxanthone and mangostin Bandaranayake
bark et al., 1975
65 G. tetralata Stem bark Garcinexanthone B, morellic acid acetate, Guo et al., 2011
toxyloxanthone A, 6,11-dihydroxy-2,2-
dimethylpyrano[3,2-c]xanthen-7(2H)-one, and 1,4-
dihydroxy-5,6-dimethoxy xanthone
66 G. tetrandra Stem bark 1,3-Dihydroxy,2′,2′-dimethyl pyrano (5′,6′,5,6) Hartati et al.,
xanthone 2008
67 G. urophylla Leaf 7-Hydroxydesoxymorellin, isocaledonixanthone D, Khalid et al.,
gaudichudione H, 1,7-dihydroxy-3-methoxy-2-(3- 2007
methyl- 2-butenyl)xanthone, 1,5-dihydroxy-3-
methoxy-2-(3-methyl-2butenyl)xanthone, and 1,3,7-
trihydroxy-2-(3-methyl-2-butenyl)xanthone
68 G. vieillardii Stem bark Vieillardiixanthones B and C, pancixanthones A, B, Hay et al., 2008
1,6-dihydroxyxanthone, pyranojacareubin and 5,6-
O-dimethyl-2-deprenylrheediaxanthone
1,6-Dihydroxyxanthone, pancixanthone A, Hay et al., 2004
isocudraniaxanthone B, isocudraniaxanthone A, 2-
deprenyl rheediaxanthone B and 1,4,5-
trihydroxyxanthone
69 G. vilersiana Bark Globuxanthone, subelliptenone H, subelliptenone B, Nguyen et al.,
12b-hydroxy-des-D-garcigerrin A, 1-O- 2000
methylglobuxanthone, and symphoxanthone
70 G. virgata Stem bark Virgataxanthone A and B Merza et al.,
2004
71 G. yunnanensis Pericarp Garciyunnanins A and B Xu et al., 2008
33
72 G. wightii Leaf Cambogic acid and mangostin Pandey et al.,

2015
xanthochymus 2015
wood 1,4,5,6-Tetrahydroxy-7,8-di(3-methylbut-2- Chanmahasathi
enyl)xanthone, 1,2,6-trihydroxy-5-methoxy-7-(3- en et al., 2003
methylbut-2-enyl)xanthone, and 12- hydroxy- D-
garcigerrin
Bark 1,6-Dihydroxy-4,5-dimethoxyxanthone and 1,5,6- Zhong et al.,
trihydroxy-7,8-di(3-methyl-2-butenyl)-60,60- 2007
dimethylpyrano(20,30:3,4) xanthone
1,5,6- Trihydroxy-7-(3-methyl-2-butenyl)-8-(3- Chen et al.,
hydroxy-3-methylbutyl)furano(2′,3′:3,4) xanthone, 2010
1,5,6-trihydroxy-7-(3-methyl-2-butenyl)- 8-(3-
hydroxy-3-methylbutyl)–6′, 6′-dimethylpyrano
(2′,3′:3,4) xanthone, 1,5,6-trihydroxy-7-(3- methyl-
2-butenyl)-8-(3-hydroxy-3-methylbutyl)–5′-(1-
hydroxy-1-methylethyl)-4′, 5′-dihydrofurano
(2′,3′:3,4) xanthone, 1, 2, 5, 4′-tetrahydroxy-4-(1,1-
dimethylallyl)-5′-(2-hydroxypropan-2-yl)-4′, 5′-
dihydrofurano-(2′, 3′ : 6, 7)xanthone, 1, 3, 5, 6-
tetrahydroxy-7-geranylxanthone, and 1, 4-
dihydroxy-6′, 6′- dimethylpyrano (2′, 3′: 5, 6)
xanthone
1,7-dihydroxyxanthone and 1,5-dihydroxyxanthone Baslas and
Kumar 1979
Twig bark 1,4,6-Trihydroxy-5-methoxy-7-prenylxanthone, Han et al., 2007
1,4,5,6-tetrahydroxy-7-prenylxanthone, 1,2,5,6-
tetrahydroxy-7-geranylxanthone, 1,4,5,6-
tetrahydroxy-7,8-diprenylxanthone , 1,3,5,6-
tetrahydroxy-4,7,8-triprenylxanthone ,
garciniaxanthone E, and 6-prenylapigenin
74 G. Twig Bannaxanthone H, 1,3,5,6-tetrahydroxy-2-(3- Zhou et al.,
xipshuanbannae methylbut-2-enyl)xanthone, bannaxanthone F, 2008
nsis garcinone C, 1,3,6,7-tetrahydroxy-8-(3-methylbut-
2-enyl)xanthone, bannaxanthone G, bannaxanthone
B, γ-mangostin, garcinone E, bananxanthone E,
allanxanthone C, bannaxanthone D, 1,3,5,6-
tetrahydroxy-7-(3-methylbut-2-enyl)xanthone,
xanthone V1a, and nigrolinexanthone V
Bannaxanthones A-H, allanxanthone C, Han et al., 2008
isojacareubin, garcinone C, and γ-mangostin
2. Benzophenones
Benzophenones are a series of compounds with phenol-carbonyl-phenol skeleton, synthesised
through the mixed shikimic acid and acetate pathway, in which the acetate derived benzene
ring is modified by intervention of prenyl groups. Biogenetically isoprenylated
benzophenones are derived from maclurin which was regarded as a precursor for many
xanthones in higher plants. Garciduols A-E, reported from G. dulcis possesses the novel
benzophenone xanthone dimer skeletal structure, supporting the biosynthetic route that
benzophenones are precursors of xanthones (Iinuma et al.,1996). Naturally occurring
34
benzophenones that consists of more than 300 members are reported with great structural
diversity with oxidized and polyisoprenylated structures (Cuesta-Rubio et al., 2005, Acuna et
al., 2009). The genus Garcinia and Clusia are the major source of natural benzophenones.
Literature review revealed that out of 120 Garcinia species subjected to phytochemical
investigation, 50 Garcinia species contain benzophenones (Table 2). Floral resins and latex
of some of the Clusiaceae members are mainly constituted of benzophenones and can contain
up to 70% of benzophenones (Cuesta-Rubio et al., 2001).
Generally the benzophenones can be classified into simple polyisoprenylated
benzophenones and complex bicyclo-[3.3.1]-nonane derivatives (Figure 3, Figure 4). Most
of the benzophenones reported from the genus Garcinia are polyisoprenylated bezophenones,
derived from maclurin. Karanjgoakar et al. in 1973 isolated xanthochymol, the first bicyclo-
[3.3.1]-nonane benzophenone from the fruits of G. xanthochymus (Karanjgoakar et al., 1973).
Camboginol (garcinol) and cambogin (isogarcinol; xanthochymol) were two important
benzophenones isolated from the latex of G. gummi-gutta in large quantities (37.0% and
5.5% respectively) (Rao et al., 1980). Porto et al (2000) attempted a chemotaxonomical
approach based on the distribution of benzophenones in the floral resins of Clusia members,
where simple benzophenone derivatives and the bicyclo-[3.3.1]-nonane benzophenone
structures demarcated the species.
OH
7
HO 3' HO OH O O
6 1
4' A 4 9
B
3 5
2
O OH OH
Figure 3. Typical benzophenone (maclurin) and bicyclo-[3.3.1]-nonane 2,4,9-trione structure
Recent developments in phytochemical analytical methods, especially the hyphenated LC-

MS techniques, made tremendous contributions to the detection of secondary metabolites that
are present in minute quantities in plants. The limit of detection for xanthochymol in G.
indica fruit rinds was reported as 20 g/mL by HPLC and the method was inadequate to
detect or estimate xanthochymol present in minute quantity in other parts of the plant.
Consequently, LC-ESI/MS/MS method has been developed for the detection and
quantification of xanthochymol at ppb level in Garcinia species. In addition, the isomeric
compound isoxanthochymol can be differentiated from xanthochymol by the fragment ions
obtained through MS/MS (Chattopadhyay and Kumar, 2006). Powder X-ray diffraction
(PXRD) technique has been reported as a non-destructive analytical tool for the detection of
the anti-HIV benzophenones, 7-epi-clusianone and guttiferone in G. brasiliensis extracts by
Martins, et al., (2011). The compounds were detected in plant powder by comparing the
powder diffraction profile of raw plant powder with the reported single crystal profiles of
marker compounds (Martins, et al., 2011).
Benzophenones have shown different biological properties especially activity against
HIV-1 (Cuesta-Rubio et al., 2005). Garcinol is an important polyisoprenylated benzophenone
distributed in several Garcinia species and is one of the active ingredients of nutraceutical
35
products from G. indica and G. cambogia. The structural similarity with curcumin, with -
diketone moiety that shows keto enol tautomerism, make garcinol interesting for
pharmacological screening studies (Padhye et al., 2009). The significant antioxidant activity
of Kokum syrup, a delicious drink popular in northern Kerala and Konkan region, made from
G. indica fruits, is attributed mainly to the presence of garcinol and anthocyanins (Mishra, et
al., 2006). Guttiferones, another class of benzophenones isolated from Garcinia species such
as G. pyrifera and G. aristata are of great interest in pharmaceutical research particularly due
to the anti-HIV, trypanocidal and cytotoxic activities (Acuna et al., 2009).
OH
OH
HO O O OH
O O
HO O O
O OH O OH
O OH
Semsinone B Garcinol Guttiferone A
Figure 4. The simple benzophenone (semsinone B) and the bicyclo-[3.3.1]-nonane

benzophenones (garcinol and guttiferone A)
Table 2. Benzophenones reported from Garcinia species

Sl. Garcinia species Plant Benzophenones Reference
No. part
1 G. achachairu Seed Guttiferone A Dal Molin et al.,
2012
2 G. amplexicaulis Stem Garcinal Lavaud et al.,
bark 2015
3 G. aristata Fruit Aristophenones A-B Cuesta-Rubio et
al., 2001
Fruit Guttiferone A, xanthochymol, and Acuna et al.,

Guttiferone E 2012,
4 G. assigu Stem Isogarcinol, garcinol ,18-0-methyl isogarcinol Ito et al., 2003
bark 18-0-methyl garcinol, and clusianone
5 G. benthami Stem Benthaphenone Nguyen et al.,
bark 2011a
Salimbenzophenone Elya et al., 2006
6 G. brasiliensis Fruit 7-epi-Clusianone and guttiferone A Martins et al.,
2011
Pericarp 7-epi-Clusianone, garciniaphenone, and Pereira et al.,
guttiferone-A 2010
Leaf 7-epi-Clusianone Santa-Cecília et
al., 2011
Epicarp 7-epi-Clusianone and garciniaphenone Derogis et al.,
2008
7-epi-Clusianone Castro et al.,
2015
7 G. cantleyana Twig 2,6,3’,5’-Tetrahydroxybenzophenone, Jantan et al.,
36
3,4,5,3’,5’-pentahydroxybenzophenone, and 2012

3,5,3’,5’-tetrahydroxy-4-methoxybenzophenone
8 G. cochinchinensis Pericarp Guttiferones Q-S and guttiferone I Nguyen et al.,
2011
9 G. cowa Leaf Chamuangone Sakunpak and
Panichayupakara
nt, 2012
Garcinol Pandey et al.,
2015
10 G. echinocarpa Leaf Garcinol Pandey et al.,
2015
11 G. epunctata Stem Epunctanone, 7-epiisogarcinol Fotso et al., 2014
bark
12 G. eugenifolia Root ( 3,4-Dihydroxyphenyl),(3-hydroxy-5- Joong et al.,
methoxyphenyl) methanone, and (3- hydroxy- 2012
phenyl)3,4,5-trihydroxy phenyl) methanone
Stem Eugeniaphenone Hartati et al.,
bark 2008a
13 G. griffithii Stem Guttiferone I Nguyen et al.,
bark 2005
Isoxanthochymol and guttiferone I Elfita et al., 2009
14 G. gummi-gutta Fruit Garcinol, guttiferones K, I, J, M and N Masullo et al.,
(G. cambogia) 2008
Garcinol, guttiferones- K, I, J, M and N Masullo et al.,
2010
Guttiferone I, guttiferone N, guttiferone J, Semwal et al.,
guttiferone K, and guttiferone M 2015
Latex Cambogin (isogarcinol) and camboginol Rao et al.,1980
(garcinol)
Leaf Garcinol Pandey et al.,
2015
Bark Guttiferone E and isogarcinol Semwal et al.,
2015
15 G. hombroniana Leaf Garcinol Pandey et al.,
2015
Stem Bronianone Rao et al., 1973
wood Ollis et al., 1969
Fruits Guttiferone A, xanthochymol, and Acuna et al.,
guttiferone E 2012
Bark 2,3',4,5'-Tetrahydroxy-6-methoxybenzophenone, Jamila et al.,
2,3',4,4'-tetrahydroxy-6-methoxybenzophenone, 2014b
and 2,3',4,6-tetrahydroxybenzophenone
16 G. huillensis Stem Garcinol Phongi et al.,
bark 1987
17 G. indica Leaf Garcinol Pandey et al.,
2015
All Xanthochymol and isoxanthochymol Chattopadhyay
parts et al., 2006
Kumar et al.,
2009.
Fruit Isogarcinol, garcinol, and 14-deoxyisogarcinol Kaur et al., 2012
18 G. intermedia Fruit Guttiferone A, xanthochymol, and Acuna et al.,
37
guttiferone E 2012
19 G. kola Fruit Guttiferone A, xanthochymol, kolanone, and Acuna et al.,
guttiferone E 2012
Waterman et al.,
1983
Kolanone Hussain et al.,
1982
20 G. livingstonei Fruit Guttiferone A, xanthochymol, and Acuna et al.,
guttiferone E 2012
Guttiferone A Gustafson et al.,
1992
21 G. macrophylla Twigs Guttiferone A and guttiferone G Williams et al.,
2003
22 G. maingayii Stem Isoxanthochymol and camboginol Hartati et al.,
bark 2007
23 G. mangostana Leaf Garcinol Pandey et al.,
2015
Heart 3’,6-Dihydroxy-2,4,4’- trimethoxy Nguyen et al.,
wood benzophenone 2005
guttiferone E 2012
Fruit 2,4,6,7- Tetrahydroxyxanthone, 3,4,5,3’- Jiang et al., 2010
hull tetrahydroxybenzophenone, and 2,4,6,3’,5’-
pentahydroxybenzophenone
Garcimangosone D Huang et al.,
2001
Stem Mangaphenone See et al., 2014
bark
24 G. mannii Stem Xanthochymol Crichton et al.,
bark 1979
25 G. morella Leaf Garcinol Pandey et al.,
2015
26 G. multiflora Bark, 4,6,4'-Trihydroxy-2,3'-dimethoxy-3- Chiang et al.,
stem prenylbenzophenone 2003
Fruit 13,14-Didehydoxyisogarcinol, garcimultiflorone Chen et al.,

A, garcimultiflorone B, 13-hydroxy 2009.
garcimultiflorone B, and garcimultiflorone C
27 G. myrtifolia Bark Myrtiaphenone-A, B and vismiaphenone C Spino et al.,
1995
28 G. ovalifolia Leaf Guttiferone E Gustafson et al.,
1992
Stem Xanthochymol and isoxanthochymol Waterman and
bark Crichton, 1980b
Fruit Xanthochymol Waterman et al.,
1980b
Root Epigarcinol and isogarcinol Pieme et al.,
2015
29 G. paucinervis Leaf Paucinones A-D Gao et al., 2010
Seed Paucinones E–I Li et al., 2016
30 G. pedunculata Fruit Pedunculol, garcinol, and cambogin Sahu et al.,1989
Heart 2,4,6,3’,5’-Pentahydroxybenzophenone Rao et al., 1974
38
wood
31 G. picrorrhiza Bark Garcinopicobenzophenone and guttiferone F Soemiati et al.,
2006
32 G. polyantha Stem Xanthochymol and isoxanthochymol Ampofo and
bark Waterman, 1986
33 G. propinqua Twig Doitunggarcinones A and B Tantapakul et al.,
2012
34 G. pseudoguttifera Heart Myrtiaphenone-A, myrtiaphenone-B, Ali et al., 2000
wood myrtiaphenone-C, and pseudoguttiaphenone-A
35 G. purpurea Pericarp Xanthochymol, cambogin (isogarcinol), and Matsumoto et
camboginol (garcinol) al., 2003
Iinuma et al.,
1996
Steller, 1995
36 G. Leaf Garcinol Pandey et al.,
pushpangadaniana 2015
37 G. pyrifera Fruit Guttiferone E and Xanthochymol Roux et al., 2000
38 G. schomburgkiana Fruit Schomburgkianones A-H Le et al., 2016

39 G. semseii Stem Semsinones A-C Magadula et al.,
bark 2008
40 G. smeathmannii Stem Guttiferone I and isoxanthochymol Kuete et al.,
bark 2007
Root Guttiferone I and isoxanthochymol Lannang et al.,
bark 2006
41 G. solomonensis Stem Guttiferones O and P Carrol et al.,
bark 2009
42 G. speciosa Trunk Garciosaphenone Rukachaisirikul
bark, et al., 2003a
stem
43 G. spicata Leaf Garcinol Pandey et al.,
2015
guttiferone E 2012
44 G. staudtii Stem Xanthochymol Waterman and
bark Hussain, 1982
45 G. subelliptica Fruits Garcinialiptone A, garcinialiptone B, (−)- Zhang et al.,
cycloxanthochymol, garcinialiptone C, 2010
garcinialiptone D, xanthochymol,
isoxanthochymol, and cycloxanthochymol
Wood 4′,6-dihydroxy-2,3′4-trimethoxybenzophenone Minami et al.,
1994
46 G. vieillardii Stem Clusiachromene and 3-geranyl-2,4,6- Hay et al., 2008
bark trihydroxybenzophenone
47 G. virgata Stem Guttiferone E, xanthochymol, and guttiferones I Merza et al.,
bark and J 2006
48 G. wightii Leaf Garcinol Pandey et al.,
2015
49 G. xanthochymus Leaf Garcinol Pandey et al.,
2015
Fruit Guttiferone H and gambogenone Bagget et al.,
2005
39
Guttiferone A, xanthochymol, and Acuna et al.,

guttiferone E 2012
Xanthochymol and garcinol Jackson et al.,
2015
Xanthochymol, Isoxanthochymol, and maclurin Baslas and
Kumar 1979
50 G. Twig Guttiferone E and xanthochymol Han et al., 2008
xipshuanbannaensi
s
3. Biflavonoids
Biflavonoids are a distinct class of naturally occurring flavonoid dimers linked by a C-C or
C-O-C bond. The biogenesis of biflavonoids involves the radical pairing of two embryonic
flavonoid units. The ring B and C of flavonoid units were formed through shikimic acid
pathway, while ring A is formed through acetate pathway (Figure 5). Depending on the
monomeric unit like flavones, flavanones, isoflavones, flavanols, chalcones, aurones and
dihydrochalcones, different combinations of flavonoid dimers such as flavanone-flavone,
flavones-flavone, flavone-flavonol are possible. Naturally occurring biflavonoids contains
hydroxy or methoxy groups substituted at different positions leading to diverse array of
biflavonoids (Mercader and Pomilio, 2012). Amentoflavones with the 3-8 linkage is
considered as the primitive or basic form of biflavonoids in vascular plants.
The rapid growth in literature on biflavanoids led to various systems of naming and
though systematic IUPAC and Locksley names exists, most of the biflavonoids are known by
their vernacular names (Locksley, 1973). In Locksley system, for example, amentoflavone is
named as I-4’, II-4’, I-5, II-5, I-7, II-7-hexahydroxy I-3’, II-8 biflavone, while in IUPAC
system, amentoflavone is named as 8-5-(5,7-dihydroxy-4-oxo-4H-chromen-2-il)-2-
hydroxyphenyl-5,7-dihydroxy- 2-(4-hydroxy-phenyl)-chromen-4-on. Basic difference
between the two systems is reference of structural skeleton, where Locksley use flavanoid
structure, while IUPAC use chromen structure (Rahman et al.,2007).
3'
4'
2'
B
5'
1'
8
9 O
7 6'
2 3'''
A C 4'''
2'''
6
3 B
10 5'''
5 4 8''
9'' O 2''
7'' 1''' 6'''
A C
6'' 3''
10''
5'' 4''
Figure 5. Numbering in typical biflavonoid structure

The distribution of biflavonoids is limited to some plant groups, especially in the primitive
orders such as Bryales, Psilotales and Selaginellales, and sporadically in the angiosperms.
According to Gieger and Quinn (1988), angiosperms lost the capacity to biosynthesis
biflavonoids in the course of evolution, but was regained by a selected family. The genus
Garcinia is a rich source of biflavonoids and out of the 120 Garcinia species studied for their
secondary metabolites, biflavonoids were reported from 45 species (Table 3).
40
Majority of the naturally occurring biflavonoids contain C-C linked monomers and
I(3)-II (8) linkage is the most prevalent inter-linkage in Garcinia biflavonoids (Yamaguchi et
al., 2008). Biflavonoids reported from the Garcinia species with 3-8’’ interflavonoid linkage
can generally be divided into two subgroups; biflavonones made up of two flavanone units
(GB type of biflavonoids) and those made up of one flavanone and one flavone subunits
(morelloflavone and volkensiflavone) (Figure 6). Of the two types, biflavonones is the major
type in Garcinia species whereas the co-occurrence of the two types of biflavonoids is rare
(Waterman and Hussain, 1983). Morelloflavone, isolated from G. morella in 1967 is the first
biflavonoid reported with a flavone and a flavonone unit (Karanjgaokar et al., 1967).
Amentoflavone (5′,8′′-biapigenin) is the common example for I(5′)-II(8) biflavonoid
distributed in Garcinia species. It is interesting to note that the biflavonoid linkage has
potential significance in systematic (Waterman and Husain, 1983).
Biflavonoids generally exist as rotamers and can be monitored by variable
temperature NMR studies, where at room temperature the biflavonoids exhibit duplicate
NMR signals, while at elevated temperature a single set of signals was obtained (Jamila, et
al., 2014).Mass spectrometry is perhaps the most informative tool for structure elucidation of
biflavonoids (Zhang et al., 2011). The most useful fragmentations in terms of structural
identification are those involving the C-ring cleavage of biflavonoids. Fragmentation peaks
for phloroglucinol (m/z 126), p-methoxy benzyl (m/z 138), p-hydroxy benzyl (m/z 124) and
retro Diels Alder cleavage products are usually observed for biflavonoids.
A variety of biological activities like anti inflammatory, anti HIV, antifungal, anti
tumor, hypocholesterolemic, and anti-plasmodial were attributed to biflavonoids (Gil et al.,
1997, Lin et al., 1997 Yamaguchi et al., 2008, Pang et al., 2009). Of the different activities,
antioxidant activity is of highly significant, where biflavonoids inhibits transition metal ions
in free radical generating reactions by complexing and quenching the metal ions (Yamaguchi,
et al., 2008).
OH OH
HO O HO O
OH
OH OH
OH O OH O
HO O HO O
OH
OH O OH O
GB-1 Morelloflavone
OH OH
HO O HO O OH
OH
OH
OH O OH O O
HO
GluO O
OH O
OH O
Fukugiside Amentoflavone
Figure 6. Structures of I(3)-II(8) linked biflavonones (GB1), flavanone-flavone (morelloflavone),

flavanone-flavone glycoside (fukugiside) and I(5’)-II(8) linked biflavone (amentoflavone)
41
Table 3. Biflavonoids reported from Garcinia species

Sl. Garcinia species Plant part Biflavonoids Reference
No.
1 G. atroviridis Stem bark Garcineflavonol Tan et al.,
2014
2 G. bakeriana Leaf 4'''-O-Methyl-I3,II8-biapigenin, amentoflavone, Al-Shagdari et
4'''-O-methylamentoflavone , 4'-O- al., 2013
methylcupressuflavone, GB-2a, volkensiflavone,
6"-(2-hydroxy-3-methyl-3-butenyl)-
amentoflavone, I3,II8-biapigenin, and GB-1a
3 G. brasiliensis Epicarp Morelloflavone, morelloflavone-4′″-O-β-D- Gontijo et al.,
glycoside, and morelloflavone-7″-O-β-D- 2012
glycoside
Fukugetin Castro et al.,
2015
Branch, Procyanidin, fukugetin, amentoflavone, and Arwa et al,
leaf podocarpusflavone 2015
4 G. Heart wood Amentoflavone , 4″′-O-methyl amentoflavone, Abderamane et
brevipedicellata Robustaflavone, 4′-O-methyl robustaflavone, al., 2016
and tetrahinokiflavone
5 G. buchananii Stem bark GB-1, GB1a, GB-2 and GB-2a Jackson et al.,
1968 and 1971
(2R,3S,2″R,3″R)-Manniflavanone, Stark et al.,
(2R,3S,2″R,3″R)- isomanniflavanone, 2015
(2″R,3″R)-preussianone, (2R,3S,2″R,3″R)-GB-2
7″-O-β-D-glucopyranoside, and
(2R,3S,2″R,3″R)-manniflavanone-7″-O-β-D-
glucopyranoside
(2R,3S,2″R,3″R)-Manniflavanone, Stark et al.,
(2R,3S,2″R,3″R)-GB-2 and (2R,3S,2″S)- 2012
buchananiflavanone
6 G. conrauana Stem bark GB-1, GB1a, GB-2, Hussain and
Heart wood morelloflavone, O-methyl fukugetin, and O- Waterman,
methyl fukugetin glycoside 1982
7 G. cornea Stem bark Morelloflavone and fukugiside Elfita et al.,
2009
8 G. cowa Branch GB-2, morelloflavone, volkensiflavone, and Shen and
fukugiside Yang, 2007;
Panthong et
al., 2009
Fruit Amentoflavone and morelloflavone Shen and
Yang, 2006
Leaf Fukugicide, amentoflavone, GB-1, and GB-2 Pandey et
al.,2015
9 G. cymosa Stem bark Morelloflavone and morelloflavone-7”-O-β-D- Elfita et al.,
glucoside 2009
10 G. densivenia Stem bark Morelloflavone and O-methyl fukugetin Waterman and
Crichton,
1980a
11 G. dulcis Leaf Amentoflavone, fukugetin, volkensiflavone, and Ansari et al.,
flavanone-(1-3:11-8)-chromone, 1-4’ 1976
(flavanone- chromone)
42
Dulcisbiflavonoid A Saelee et al.,

2015
Morelloflavone Pinkaew et al.,
2009
Branch Podocarpusflavone A Harrison et al.,
1994
Fruit Dulcisbiflavonoid A Saelee et al.,
2015
12 G. echinocarpa Timber, Volkensiflavone, morelloflavone, and fukugetin Bandaranayake
bark et al.,1975
Leaf Fukugicide, GB-1 and amentoflavone Pandey et al.,
2015
13 G. eugeniifolia Heart wood GB-1, GB-1a, GB-2 and GB-2a Jackson et al.,
1968 and 1969
14 G. fusca Root Vokensiflavone, fukugetin, fukugiside Nontakham et
al., 2014
15 G. gardneriana Leaf Fukugetin and GB-2a Castardo et al.,
2008
16 G. gummi-gutta Leaf Fukugicide, GB-1, and amentoflavone Pandey et al.,
(G. cambogia) 2015
Heart Morelloflavone, dihydromorelloflavone and Venkataraman,
wood, bark isomorellic acid 1973
17 G. hombroniana Bark Volkensiflavone, volkensiflavone-7-O- Jamila et al.,
rhamnopyranoside, 4″-O-methyl- 2014
volkensiflavone, volkensiflavone-7-O-
glucopyranoside, morelloflavone, 3″-O-methyl-
morelloflavone, and morelloflavone-7-O-
glucopyranoside
Leaf Fukugicide, GB-1, GB- 2, GB-1a, and Pandey et al.,
amentoflavone 2015
18 G. indica Heartwood Fukugetin and volkensiflavone Cotterill et al.,
1977
Leaf Fukugicide, GB-1, GB- 2, and amentoflavone Pandey et al.,
2015
19 G. intermedia Leaf Podocarpusflavone A and amentoflavone Abe et al.,
2004
20 G. kola Stem bark I-3’, II-3, 3’, II-4’, I-5, II-5, I-7, II-7- Kabangu et al.,
Octahydroxy-1- 4’-methoxy-1-3, II-8- 1987
biflavanone, GB-1, and GB-2
Root GB1, GB-2, kolaflavanone, manniflavanone, Iwu et al.,1990
and garciniflavanone
GB 1 Han et al.,
2005
Seed Amentoflavone, kolaflavone, GB-1, and GB-2 Iwu et al.,1982
GB-1 and GB-2 Terashima et
al., 1997
Kolaflavanone, GB-1, GB-1a, and GB-2 Kapadia et al.,
1994
GB-1 and GB-2 Madubunyi,
1995
43
Garcinianin Terashima et
al., 1995
Kolaflavanone, GB-1, GB-1a, and GB-2 Tshibangu et
al., 2016.
Stem Garcinianin, biflavanone GB-2a, (+) GB-1, (-) Terashima et
GB-1a, biapigenin,3-8’’, and amentoflavone al.,1999,
1999a
21 G. lateriflora Stem bark Morelloflavone Ren et al.,
2010
22 G. linii Bark Fukugetin, GB-1, GB- 2, GB-1a, and GB 2a Konoshima et
al., 1970
23 G. livingstonii Heartwood, Morelloflavone, BGH-III, amentoflavone Pelter et al.,
bark, podocarpusflavone A 1971
leaf
Fruit Amentoflavone, 3,8′′-biapigenin, Yang et al.,
volkensiflavone, morelloflavone and fukugiside 2010
Root bark Ent-naringeninyl-(I-3α, II-8)-4‘-O- Mbwambo et
methylnaringenin al., 2006
Leaf Amentoflavone and 4"-methoxy amentoflavone Kaikabo et al.,
2009
24 G. madruno Leaf Morelloflavone, volkensiflavone and Osorio et al.,
amentoflavone 2009
7''-O-(6''''-Acetyl) glucoside of morelloflavone, Osorio et al.,
fukugiside, and spicataside 2013
25 G. mangostana Leaf Fukugicide, GB-1, GB- 2, GB-1a, and Pandey et al.,
amentoflavone 2015
26 G. mannii Stem bark Manniflavanone, morelloflavone, and O-methyl Hussain et al.,
fukugetin 1982
GB-1, GB-2, and manniflavanone Crichton et al.,

1979
Leaf GB-1, GB-2, and manniflavanone Hussain et al.,

1982
Seed GB-1, GB-2, and manniflavanone Hussain et

al.,1982
27 G. merguensis Twig GB-1a, GB-2a, (+)-morelloflavone, (+)- Trisuwan et

volkensiflavone, and amentoflavone al., 2013
28 G. morella Bark Dihydromorelloflavone, morelloflavone-7’’-- Adawadkar et
glucoside, fukugetin, and fukugiside al.,1976
Leaf Fukugicide, GB-1, GB- 2 ,GB-1a, and Pandey et al.,
amentoflavone 2015
29 G. multiflora Heartwood (-)-GB-1a, (+)- GB-2a, (+) volkensiflavone, (+) Chen et al.,
morelloflavone, spicataside, fukugiside, 1975
xanthochymuside, 3, 8’’-binaringenin-7’’-O--
glucoside, GB-1a, GB-2a, volkensiflavone, and
morelloflavone
Fukugetin, fukugiside, GB-1a, GB-2a and GB- Lin et al.,1997
1a 7’’-O-β-D-glucoside, and I-5, II-5, I-7, II-7,
I-3’, I-4’, II-4’- heptahydroxy- [I-3,II-8]-
flavanonyl- flavones
44
Bark Fukugetin, GB-1, GB- 2 ,GB-1a, GB-2a, and Konoshima et

volkensiflavone al., 1970
30 G. nervosa Leaf I-5, II-5, I-7, II-7, I-3’, I-4’, II-4’- Babu et al.,
Heptahydroxy- [I-3, II-8]- flavanonyl flavones 1988
and I-3, II-3, I-5, II-5, I-7, II-7, I-4', II-4'- Parveen et al.,
octahydroxy [I-2', II-2'] biflavone 2004
31 G. pedunculata Heart wood GB-1a and volkensiflavone Rao et al.,
1974
32 G. prainiana Stem bark Morelloflavone, O-methyl fukugetin, On et al., 2016
volkensiflavone, amentoflavone, and 4′′′-
methoxyamentoflavone
33 G. preussii Leaf Preussianone Messi et al.,
2012
34 G. Leaf Fukugicide, GB-1, GB- 2 ,GB-1a, and Pandey et al.,
pushpangadaniana amentoflavone 2015
35 G. quadrifaria Stembark Fukugetin and O-methyl fukugetin Waterman and
Seed Hussain, 1982
36 G. Fruit GB-1a, GB-2a, morelloflavone, and Le et al., 2016
schomburgkiana volkensiflavone
37 G. scortechinii Fruit (+) Volkensiflavone and (+) morelloflavone Sukpodma et
al., 2005
38 G. spicata Leaf GB-1, GB-1a, GB-2a, and fukugetin Gunatilaka et
al., 1984
Fukugicide, GB-1, GB- 2 ,GB-1a, and Pandey et al.,
amentoflavone 2015
Bark Fukugetin and 3-O-methyl fukugetin Konoshima
and Ikeshiro,
1969
Fukugiside Konoshima
and Ikeshiro,
1970
Volkensiflavone, spicataside, biflavonoid Konoshima et
glycoside, GB-la, and GB-2a al., 1970a
39 G. subelliptica Pericarp Podocarpusflavone A Iinuma et al.,
1996
NSf 2R,3S-5,7,4',5'',7'',3''',4'''-Heptahydroxy Masuda et al.,
flavanone[3-8''] flavone, and 5,7,4',5'',7'',3''',4'''- 2005
heptahydroxy[3-8''] biflavanone
40 G. talboti Root Talbotaflavone and morelloflavone Joshi et al.,
1970
41 G. terpnophylla Timber, GB-1a, GB1 and GB-2, 3’’-3’’’-4’-4’’’-5-5’’-7- Bandaranayake
bark 7’’-Octahydroxy-(3-8’’) biflavanone, 3’’-4’- et al.,1975
4’’’-5-5’’-7-7’’-heptahydroxy-(3-8’’)
biflavanone, and 4’-4’’’-5-5’’-7-7’’-
hexahydroxy -(3-8’’) biflavanone
Wood 3’’-3’’’-4’-4’’’-5-5’’-7-7’’-Octahydroxy-(3-8’’) Bandaranayake
biflavanone and 3’’-4’-4’’’-5-5’’-7-7’’- et al.,1975
heptahydroxy-(3-8’’) biflavanone
42 G. thwaitesii Timber, II-3, I-4’, II-4’, I-5, II-5,I-7,II-7- Heptahydroxy Gunatilaka et
bark (I-3,II-8) biflavanone, I-4’, Ii-4’, I-5, II-5,I-7,II- al., 1983
7-hexahydroxy (I-3,II-8) biflavanone, II-3,II-
3’,I-4,II-4’,I-5,II-5,I-7,II-7- octahydroxy (I-3,II-
45
8) biflavanone, I-4’, II-3’, II-4’, I-5, II-5, I-7, II-

7-heptahydroxy (I-3,II-8) biflavanone, I-4’-II-3’-
II-4’-I-5-II -5-I-7-II-7-Heptahydroxy-(I-3-II-8)
biflavanone, I-4’-II-4’-I-5-II-5-I-7 –II-7-
hexahydroxy-(I-3-II-8) biflavanone,
II-3-I-4’-II-4’-I-5-II-5-I-7-heptahydroxy-(I-3-II-
8) biflavanone, II-3-II-3’-I-4’-II-4’-I -5-II-5-I-7-
II-7-octahydroxy-(I-3-II-8) biflavanone,
I-4’-II-3’-II-4’-I-5-II -5-I-7-II-7-Heptahydroxy-
(I-3-II-8) biflavanone, I-4’-II-4’-I-5-II-5-I-7 –II-
7-hexahydroxy-(I-3-II-8) biflavanone, and
II-3-I-4’-II-4’-I-5-II- 5-I-7-II-7-heptahydroxy-(I-
3-II-8) biflavanone
43 G. volkensii Heartwood GB-1a, GB-2a, morelloflavone, and Herbin et al.,
volkensiflavone 1970
44 G. wightii Leaf Fukugicide, GB-1, GB- 2, GB-1a, and Pandey et al.,
amentoflavone 2015
45 G. xanthochymus Leaf Agathisflavone and 7-O-methyl amentoflavone Parveen et al.,
1994
Fukugicide, GB-1, GB- 2, GB-1a, and Pandey et al.,
amentoflavone 2015
Fruit Volkensiflavone, morelloflavone, GB-1, and Baslas and
GB-1a Kumar 1979
3-8’’- 3’’-4’-4’’’-5-5’’-7’’-Heptahydroxy Baslas and
biflavanone, 3-8’’- 4’-4’’-5-5’’-7-7’’- Kumar 1981
hexahydroxy biflavanone, fukugetin, and
volkensiflavone
Leaf, root GB-2a glucoside, GB-2a, and fukugetin Li et al.,2014
and fruit
Wood, leaf GB-1a, GB-2, volkensiflavone, fukugiside, Konoshima et
xanthochymoside, and morelloflavone al., 1970
4. Depsidones
Depsidones comprise benzoic acid and phenol skeletons condensed at the ortho-positions
through ester and ether linkages (Figure 7). This class of compounds is well known in
Garcinia species (Ha et al., 2012).
HO O
HO O O
O HO
O O
O OCH3 O
O
HO O HO O
H3CO OH
OH OH
Brevipsidone C Cowadepsidone Parvifolidone B
Figure 7. Structures of brevipsidone C (simple despidone), cowadespidone (monoprenylated

despidone) and parvifolidone B (geranyl substituted despidone)
46
Table 4. Despidones reported from Garcinia species

Sl. Garcinia species Plant part Depsidones Reference
No.
1 G. assigu Stem bark Garcinisidone A Ito et al., 1997
2 G. atroviridis Root Atrovirisidone, Permana et al., 2001,
Atrovirisidone B 2005
3 G. brevipedicellata Stem bark Brevipsidones A-D Ngoupayo et al., 2008
4 G. buchananii Stem bark Garcinisidone G Stark et al., 2015a
5 G. celebica Bark Garcinisidone H Bui et al., 2016
6 G. cowa Twig Cowadepsidone Cheenpracha et al.,
2011
7 G. dulcis Stem bark Garcinisidone A Ito et al., 1997
8 G. latissima Stem bark Garcinisidone A Ito et al., 1997
9 G. neglecta Leaf Garcinisidone B-F Ito et al., 2001
10 G. oliveri Bark Oliveridepsidones A-D Ha et al., 2012
11 G. parvifolia Leaf Garcidepsidone A, B, C, and Xu et al., 2000
D
Garcidepsidone B Rukachaisirikul et al.,
2008
Twig Parvifolidones A, B Rukachaisirikul et al.,
2006
12 G. puat Leaf Garcinisidone B-F Ito et al., 2001
13 G. schomburgkiana Root Schomburgdepsidones A, B Sukandar et al., 2016a
5. Biphenyls
Biphenyls, reported as potential phytoalexins, are restricted to certain families and Clusiaceae
is one among the families reported to contain biphenyls. Biphenyls are biosynthetically
closely related to benzophenones and in a phylogenetic tree, biphenyl synthase (BIS) and
benzophenone synthase (BPS) group together closely, indicating that they arise from a
common ancestral gene. Biphenyl synthase (BIS) and benzophenone synthase (BPS) catalyze
the formation of identical linear tetraketide intermediates from benzoyl-CoA (Beerhues
and Liu, 2009).
OH
OCH3 OCH3 OCH3
HO OH HO OH
OH OH
OCH3
Garcibiphenyl C Schomburgbiphenyl 3-hydroxy-4-geranyl-5-methoxybiphenyl
Figure 8. Structures of simple biphenyl (garcibiphenyl C), monoprenylated biphenyl
(schomburgbiphenyl) and geranyl substituted biphenyl (3-hydroxy,4-geranyl,5-methoxy biphenyl)
47
Table 5. Biphenyls reported from Garcinia species

Sl. Garcinia species Plant part Biphenyls Reference
No.
1 G. bancana Twigs [1,1'-Biphenyl]-2-(3-methyl-2-butenyl)-3- Rukachaisirikul et al.,
methoxy- 4,4',5,6-tetraol 2005
2 G. bracteata Twigs Bractebiphenyls A-C, doitungbiphenyl A, Li et al., 2015
doitungbiphenyl B, 2,2-dimethyl-3,5-
dihydroxy-7-(4-hydroxyphenyl) chromane,
oblongifoliagarcinine A, and
schomburgbiphenyl
3 G. fucsa Root Nigrolineabiphenyl B Nontakham et al.,
2014
4 G. linii Root Garcibiphenyl C, D and E Chen et al., 2006
Garcibiphenyl A and B Chen et al., 2004
5 G. mangostana Root bark 3-Hydroxy-4-geranyl-5-methoxybiphenyl Dharmaratne et al.,
2005
6 G. multiflora Twig Multiflorabiphenyls A and B Xu et al., 2016a
Leaf Multiflorabiphenyls B-D Fu et al., 2015
Stem Multiflorabiphenyls A-C Gao et al., 2016
Stem bark Multiflorabiphenyls A Jing et al., 2013
7 G. nigrolineata Twig Nigrolineabiphenyls A and B Rukachaisirikul et al.,
2005a
8 G. oblongifolia Leaf Oblongifoliagarcinines A-D Wu et al., 2008
9 G. oligantha Stem 3-Methoxy-5-methoxycarbonyl-4-hydroxy Liu et al., 2015
biphenyl
10 G. Wood Schomburgbiphenyl Mungmee et al.,2013
schomburkiana Aucuparin, nigrolineabiphenyl B and Mungmee et al., 2012
Garcibiphenyl C
Stem Schomburgbiphenyl A and B Ito et al., 2013
11 G. spp Twig Doitungbiphenyls A and B Siridechakorn et al.,
2014
12 G tetralata Twig Tetralatabiphenyls A-C Hu et al., 2016
6. Phloroglucinols
Phloroglucinols are an interesting group of phenolic compounds, based on a phloroglucinol
or 1,3,5-benzenetriol skeleton. Phloroglucinols can be divided into subclasses such as acyl
phloroglucinols, phloroglucinol glycosides and prenylated/geranylated phloroglucinols
(Dakanali and Theodorakis, 2011). About 700 naturally occurring phloroglucinol compounds
were reported, of which acylphloroglucinols (APGs) comprise the largest group of natural
phloroglucinol compounds (Singh et al., 2010). Several Garcinia species have been reported
to contain phloroglucinol derivatives (Zhou, et al., 2009). Benzophenones such as
nemerosone and clusianone with close resemblance to phloroglucinol derivatives were also
considered under the phloroglucinol category (Dakanali and Theodorakis, 2011).
COOCH3 O
OH
OH HO O
MeO2C O
O
O H3CO
HO OMe OH O
O
Subellinone Atrovirinone
Parvifoliol A
Figure 9. Structurs of monoprenylated phloroglucinol (parvifoliol A), polyprenylated phloroglucinol

(subellinone) and phloroglucinic acid ester linked to a quinone moiety (atrovirinone)
48
Ultra performance liquid chromatography (UPLC) coupled with precursor ion

discovery (PID) and tandem mass (MS/MS) scans has been reported as an efficient analytical
tool for rapid screening of polycyclic polyprenylated acyl phloroglucinols from Garcinia
species (Zhou, et al., 2009).
Phloroglucinol and its derivatives were reputed with biological activities such as
antibacterial, cytotoxic, antiproliferative and antiangiogenic effects and have been widely
used in medicine, cosmetics, pesticides, paints and dyes (Singh et al., 2010). The
phloroglucinol Garsubellin A induces biosynthesis of acetylcholine, a neurotransmitter that at
low concentrations can lead to Alzheimer’s disease (Fukuyama et al., 1997).
Table 6. Phloroglucinols reported from Garcinia species

Sl. Garcinia species Plant part Phloroglucinols Reference
No.
1 G. atroviridis Root Atrovirinone Permana et al., 2001
2 G. cowa Twig Garcicowins A-D Lin et al., 2010
3 G. eugeniaefolia Stem bark Enervosanone Taher et al., 2007
4 G. goudotiana Leaf Goudotianone 1 and 2 Mahamodo et al.,

2014
5 G. multiflora Root Garcinialone Chien et al., 2008
6 G. nujiangensis Leaf Nujiangefolins A-C Xia et al., 2012

7 G. parvifolia Twig Parvifoliols A-G Rukachaisirikul et al.,
2006
Leaf Parvifoliols B-E Rukachaisirikul et al.,
2008
8 G. schomburgkiana Fruit Oblongifolin C, garcicowin B, and Le et al., 2016
garciyunnanin
9 G. subelliptica Heartwood Garcinielliptone HF Wu et al., 2008
Garcinielliptone HA, HB, HC, HD, and Lu et al., 2008
HF
Pericarp Garcinielliptone FB Wu et al., 2005
Fruit Garcinielliptone Lin et al., 2005
Wood Subellinone Fukuyama et al.,

1993
Garsubellins A Fukuyama et al.,
1997
Garsubellins B-E Fukuyama et al.,
1998
Cohulupone Lin et al., 2010a
Seed Garcinielliptone A, B, C and D, and Weng et al., 2003
Garsubellins A
Garcinielliptone K, L and M Weng et al., 2004
Garcinielliptone R Lin et al., 2012
Garcinielliptone P Lin et al., 2010a
10 G. verrucosa Stem bark Garcicosin Rajaonarivelo et
ssp orientalis al., 2009
49
7. Flavonoids
A variety of simple flavonoids such as quercetin, luteolin and apigenin were also reported
from different Garcinia species.
Table 7. Flavonoids reported from Garcinia species

Sl. Garcinia species Plant part Flavonoids References
No.
1 G. andamanica Leaf Scutellarein-7-diglucoside and Alam et al., 1986
sorbifolin-6-galactoside
4′-Hydroxy wogonin 7-neohesperidoside Alam et al., 1987
2 G. bracteata Stem Bracflavones A and B, quercetin, Hu et al., 2014
luteolin, apigenin, rhamnazin, and pilloin
7-Methoxy-4',6-dihydroxy-8-isobutyryl- Li et al., 2015
flavone
Twig Bracteflavones A, bracteflavones, Yang et al., 2015
artocarmin D, 6-prenyl apigenin,
cycloartocarpesin, and artochamin C
3 G. brevipedicellata Stem bark Pilloin Ngoupayo et al.,
2007
4 G. celebica Stem bark Epicatechin Elfita et al., 2009
5 G. conrauana Stem bark Eriodictyol Waterman and
Chrichton, 1980
6 G. cowa Stem Quercetin Shen et al., 2007
7 G. dulcis Branch 3'-(3-Methyl-but-2-enyl) naringenin, Harrison et al., 1994
Ripe fruit Dulcinoside, dulcisisoflavone, and Deachathai et al.,
dulcisflavan 2005
8 G. epunctata Stem bark Taxifolin 6-C-glucoside Mbafor et al., 1989
9 G. eugenifolia Stem bark Epicatechin Taher et al., 2007
10 G. gracilis Leaf Apigenin-8-C-α-L-rhamnopyranosyl- Supasuteekul et al.,
(1→2)-β-D-glucopyranoside 2016
11 G. hombroniana Bark 3,3',4',5,5',7-Hexahydroxyflavone, Jamila et al., 2014
3,3',5,5',7-pentahydroxyflavanone, and
3,3',4',5,7-pentahydroxyflavone
12 G. kola Seed Acacetin, apigenin-4'-5-7-trimethyl Iwu and Igboko, 1982
ether, and fisetin
Naringin-7-rharmnoglucoseside Okwu and Morah
2007
13 G. livingstonei Seed Eriodictyol Srivastava and
Sharma 1966
14 G. mangostana Fruit hull Taxifolin-3-o--L-rhamnoside Huang et al., 2001
Epicatechin Yu et al., 2007
Aromadendrin-8-C-glucopyranoside, and Abdallah et al., 2016
epicatechin
15 G. multiflora Heart wood Apigenin Fa-Ching et al., 1975
16 G. neglecta Leaf Apigenin and narigenin Ito et al., 2001
17 G. nervosa Leaf Nervosin, irigenin, and 7-methyl Ilyas et al., 1994
tectoirigenin
18 G. parvifolia Leaf Nigrolineaisoflavone A Rukachaisirikul et al.,
2008
19 G. paucinervis Stem Pauciisoflavone A Hu et al., 2014
20 G. purpurea Pericarp Vitexin and apigenin-7-o-(6''-methyl Iinuma et al., 1996
ester)-glucuronide
21 G. schomburgkiana Branch Kaempferol, dihydrokaempferol and Meechai et al., 2016
(-)-5,7,3′,5′-tetrahydroxyflavanone
22 G. vitiens Leaf Vitexin Parveen et al., 1994
23 G.xipshuanbannaensis Fruit Luteolin and 3’,5,7-4’-methoxy-flavone Shen et al., 2006
50
Conclusions
Garcinia species are rich depository of structurally diverse secondary metabolites such as
biflavonoids, prenylated and caged xanthones and polyisoprenylated benzophenones. Most of
the Garcinia species are not yet explored for their chemical constituents or bioactivities.
Literature survey revealed that, of the nearly 250 Garcinia species, less than 50% have been
studied for their chemical constituents. Xanthones are the major class of phenolic compounds
in Garcinia species, followed by benzophenones and biflavonoids. The chapter enlists the
major phenolic compounds xanthones, benzophenones and biflavonoids, along with minor
constituents biphenyls, despidones, phloroglucinols and simple flavonoids reported in
Garcinia species world over.
References
1. Abdallah HM, El-Bassossy H, Mohamed GA, El-Halawany AM, Alshali KZ and
Banjar ZM. 2016. Phenolics from Garcinia mangostana inhibit advanced glycation
endproducts formation: Effect on amadori Products, cross-linked structures and protein
thiols. Molecules, 21(2), 251.
2. Abderamane B, Tih AE, Ghogomu RT, Blond A and Bodo B. 2016. New flavonoid C-
O-C dimers and other chemical constituents from Garcinia brevipedicellata stem
heartwood. Z. Naturforsch.C. DOI: 10.1515/znc-2015-0125.
3. Abe F, Nagafuji S, Okabe H, Akahane H, Estrada-Muñiz E, Huerta-Reyes M and
Reyes-Chilpa R. 2004. Trypanocidal constituents in plants 3 leaf of Garcinia
intermedia and heartwood of Calophyllum brasiliense. Biol. Pharm. Bull., 27(1), 141-
143.
4. Acuna UM, Dastmalchi K, Basile MJ and Kennelly EJ. 2012. Quantitative high-
performance liquid chromatography photo-diode array (HPLC-PDA) analysis of
benzophenones and biflavonoids in eight Garcinia species. J. Food Compos. Anal.,
25(2), 215-220.
5. Acuna UM, Jancovski N and Kennelly EJ. 2009. Polyisoprenylated benzophenones
from Clusiaceae: Potential drugs and lead compounds. Curr. Top. Med. Chem., 9(16),
1560-1580.
6. Adawadkar PD, Srinivasan R and Yemul SS. 1976. Coloring matters of Garcinia
morella: Part VIII Morellinol, dihydromorelloflavone and morelloflavone-7”-β-
glucoside. Indian J. Chem. Sect. B, 17, 19-21.
7. Afzal M and Alhassan JM. 1980. Synthesis and biosynthesis of phytoxanthones.
Heterocycles, 14(8), 1173-1205.
8. Aisha AFA, Abu-Salah KM, Ismail Z and Majid AMSA. 2013. Determination of total
xanthones in Garcinia mangostana fruit rind extracts by ultraviolet (UV)
spectrophotometry. J. Med. Plants Res., 7(1), 29-35.
9. Alam MS, Kamil M and Ilyas M. 1987. 4′-Hydroxywogonin 7-neohesperidoside from
Garcinia andamanica. Phytochemistry, 26(6), 1843-1844.
10. Alam MS, Qasim MA, Kamil M and Ilyas M. 1986. Sorbifolin 6-galactoside from
Garcinia andamanica. Phytochemistry, 25(12), 2900-2901.
11. Ali S, Goundar R, Sotheeswaran S, Beaulieu C and Spino C. 2000. Benzophenones of
Garcinia pseudoguttifera (Clusiaceae). Phytochemistry, 53(2), 281-284.
51
12. Alkadi KA, Adam A, Taha M, Hasan MH and Shah SAA. 2014. Prenylated xanthone
and rubraxanthone with antiplatelet aggregation activity in human whole blood isolated
from Garcinia griffithii. Orient. J. Chem., 29(4), 1291-1295.
13. Al-Shagdari A, Alarcón AB, Cuesta-Rubio O, Piccinelli AL and Rastrelli L. 2013.
Biflavonoids, main constituents from Garcinia bakeriana leaf. Nat. Prod.
Commun., 8(9), 1237-1240.
14. Amelia P, Elya B and Hanafi M. 2015. Antioxidative activity of xanthone from
Garcinia benthami Pierre Leaf. Int. J. PharmTech. Res., 7, 254-257.
15. Ampofo SA and Waterman PG. 1986. Xanthones from three Garcinia species.
Phytochemistry, 25(10), 2351-2355.
16. Anantachoke N, Tuchinda P, Kuhakarn C, Pohmakotr M and Reutrakul V. 2012.
Prenylated caged xanthones: chemistry and biology. Pharm. Biol., 50(1), 78-91.
17. Ansari WH, Rahman W, Barraclough D, Maynard R and Scheinmann F. 1976.
Biflavanoids and a flavanone-chromone from the leaf of Garcinia dulcis (Roxb) Kurz.
J. Chem. Soc., Perkin Trans., 1(13), 1458-1463.
18. Anu Aravind AP, Asha KRT and Rameshkumar KB. 2015. Phytochemical analysis and
antioxidant potential of the leaf of Garcinia travancorica Bedd. Nat. Prod. Res., 30 (2),
232-236.
19. Arwa PS, Zeraik ML, Ximenes VF, da Fonseca LM, da Bolzani SV and Silva DHS.
2015. Redox-active biflavonoids from Garcinia brasiliensis as inhibitors of neutrophil
oxidative burst and human erythrocyte membrane damage. J. Ethnopharmacol., 174,
410-418.
20. Asai F, Tosa H, Tanaka T and Iinuma M. 1995. A xanthone from pericarps of Garcinia
mangostana. Phytochemistry, 39(4), 943-944.
21. Asano J, Chiba K, Tada M and Yoshii T. 1996. Cytotoxic xanthones from Garcinia
hanburyi. Phytochemistry, 41(3), 815-820.
22. Auranwiwat C, Trisuwan K, Saiai A, Pyne SG and Ritthiwigrom T. 2014. Antibacterial
tetraoxygenated xanthones from the immature fruits of Garcinia cowa. Fitoterapia, 98,
179-183.
23. Babu V, Ali SM, Sultana S and Ilyas M. 1988. A biflavonoid from Garcinia nervosa.
24. Baggett S, Protiva P, Mazzola EP, Yang H, Ressler ET, Basile MJ, Weinstein B and
Kennelly EJ. 2005. Bioactive benzophenones from Garcinia xanthochymus Fruits. J.
Nat. Prod., 68(3), 354-360.
25. Balasubramanian K and Rajagopalan K. 1988. Novel xanthones from Garcinia
mangostana, structures of BR-xanthone-A and BR-xanthone-B. Phytochemistry, 27(5),
1552-1554.
26. Bandaranayake WM, Selliah SS, Sultanbawa MUS and Ollis WD. 1975. Biflavonoids
and xanthones of Garcinia terpnophylla and Garcinia echinocarpa. Phytochemistry,
14(8), 1878-1880.
27. Baslas RK and Kumar P. 1979. Chemical examination of the fruits of Garcinia
xanthochymus. Curr. Sci., 48 (18).
52
28. Baslas RK, and Kumar P. 1981. Isolation and characteristation of biflavnone and
xanthones in the fruits of Garcinia xanthochymus. Acta Cienc. Indica, Chem., 71, 31-
34.
29. Beerhues L and Liu B. 2009. Biosynthesis of biphenyls and benzophenones-Evolution
of benzoic acid-specific type III polyketide synthases in plants. Phytochemistry. 70 (15-
16), 1719-1727.
30. Bennet GJ and Lee HH. 1989. Xanthones from guttiferae. Phytochemistry, 28(4), 967-
998.
31. Bui TQ, Bui AT, Nguyen KT, Nguyen VT, Trinh BT and Nguyen LHD. 2016. A
depsidone and six triterpenoids from the bark of Garcinia celebica. Tetrahedron Lett.,
57(23), 2524-2529.
32. Cao SG, Sng, VH, Wu XH, Sim KY, Tan BHK, Pereira JT and Goh SH. 1998. Novel
cytotoxic polyprenylated xanthonoids from Garcinia gaudichaudii
(Guttiferae). Tetrahedron, 54(36), 10915-10924.
33. Carroll AR, Suraweera L, King G, Rali T and Quinn RJ. 2009. Guttiferones O and P,
prenylated benzophenone MAPKAPK-2 inhibitors from Garcinia solomonensis. J. Nat.
Prod., 72(9), 1699-1701.
34. Castardo JC, Prudente AS, Ferreira J, Guimarães CL, Delle Monache F, Cechinel Filho
V, Otuki FO and Cabrini DA. 2008. Anti-inflammatory effects of hydroalcoholic
extract and two biflavonoids from Garcinia gardneriana leaf in mouse paw oedema. J.
Ethnopharmacol., 118(3), 405-411.
35. Castro AP, de Mattos AC, Pereira NA, Anchieta NF, Silva MS, Dias DF and Marques
MJ. 2015. Potent schistosomicidal constituents from Garcinia brasiliensis. Planta
Med., 81(9), 733-741.
36. Chairungsrilerd N, Takeuchi K, Ohizumi Y, Nozoe S and Ohta T. 1996. Mangostanol, a
prenyl xanthone from Garcinia mangostana. Phytochemistry, 43(5), 1099-1102.
37. Chanmahasathien W, Li Y, Satake M, Oshima Y, Ruangrungsi N and Ohizumi Y.
2003. Prenylated xanthones with NGF-potentiating activity from Garcinia
xanthochymus. Phytochemistry, 64(5), 981-986.
38. Chantarasriwong O, Batova A, Chavasiri W and Theodorakis EA. 2010. Chemistry and
biology of the caged Garcinia xanthones. Chem. Eur. J., 16(33), 9944-9962.
39. Chattopadhyay SK and Kumar S. 2006. Identification and quantification of two
biologically active polyisoprenylated benzophenones xanthochymol and
isoxanthochymol in Garcinia species using liquid chromatography-tandem mass
spectrometry. J. Chromatogr. B, 844(1), 67-83.
40. Cheenpracha S, Phakhodee W, Ritthiwigrom T, Prawat U and Laphookhieo S. 2011. A
new depsidone from the twigs of Garcinia cowa. Heterocycles, 83, 1139-1144.
41. Chen FC, Lin YM and Hung JC. 1975. A new biflavanone glucoside from Garcinia
multiflora. Phytochemistry, 14(3), 818-820.
42. Chen JJ, Chen IS and Duh CY. 2004. Cytotoxic xanthones and biphenyls from the root
of Garcinia linii. Planta Med., 70(12), 1195-1200.
43. Chen JJ, Peng CF, Huang HY and Chen IS. 2006. Benzopyrans, biphenyls and
xanthones from the root of Garcinia linii and their activity against Mycobacterium
tuberculosis. Planta Med., 72(05), 473-477.
53
44. Chen JJ, Ting CW, Hwang TL and Chen IS. 2009. Benzophenone derivatives from the
fruits of Garcinia multiflora and their anti-inflammatory activity. J. Nat. Prod., 72(2),
253-258.
45. Chen LG, Yang LL and Wang CC. 2008. Anti-inflammatory activity of mangostins
from Garcinia mangostana. Food Chem. Toxicol., 46(2), 688-693.
46. Chen Y, Fan H, Yang GZ, Jiang Y, Zhong FF and He HW. 2010. Prenylated xanthones
from the bark of Garcinia xanthochymus and their 1,1-diphenyl-2-picrylhydrazyl
(DPPH) radical scavenging activities. Molecules, 15(10), 7438-744.
47. Chiang YM, Kuo YH, Oota S and Fukuyama Y. 2003. Xanthones and benzophenones
from the stems of Garcinia multiflora. J. Nat. Prod., 66(8), 1070-1073.
48. Chien SC, Chyu CF, Chang IS, Chiu HL and Kuo YH. 2008. A novel polyprenylated
phloroglucinol, garcinialone, from the roots of Garcinia multiflora. Tetrahedron Lett.,
49(36), 5276-5278.
49. Chin YW, Jung HA, Chai H, Keller WJ and Kinghorn AD. 2008. Xanthones with
quinone reductase-inducing activity from the fruits of Garcinia mangostana
(Mangosteen). Phytochemistry, 69(3), 754-758.
50. Cotterill PJ, Scheinmann F and Puranik GS. 1977. Phenolic compounds from the
heartwood of Garcinia indica. Phytochemistry, 16(1), 148-149.
51. Crichton EG, and Waterman PG. 1979. Manniflavanone, a new 3, 8-linked flavanone
dimer from the stem bark of Garcinia mannii. Phytochemistry, 18(9), 1553-1557.
52. Croteau R, Kutchan TM and Lewis NG. 2000. Natural products (secondary
metabolites). Biochem. Mol. Biol. Plants, 1250-1318.
53. Cuesta-Rubio O, Padron A, Castro HV, Pizza C and Rastrelli L. 2001. Aristophenones
A and B: A new tautomeric pair of polyisoprenylated benzophenones from Garcinia
aristata. J. Nat. Prod., 64(7), 973-975.
54. Cuesta-Rubio O, Piccinelli AL and Rastrelli L. 2005. Chemistry and biological activity
of polyisoprenylated benzophenone derivatives. Stud. Nat. Prod. Chem., 32, 671-720.
55. Dakanali M and Theodorakis EA. 2011. Polyprenylated Phloroglucinols and
Xanthones. In: Biomimetic Organic Synthesis. ed. Erwan Poupon, Bastien Nay. Wiley
& Sons, pp. 433-467.
56. Dal Molin MM, Silva S, Alves DR, Quintao NLM, Delle Monache F, Cechinel Filho V
and Niero R. 2012. Phytochemical analysis and antinociceptive properties of the seeds
of Garcinia achachairu. Arch. Pharm. Res., 35(4), 623-631.
57. Deachathai S, Mahabusarakam W, Phongpaichit S and Taylor WC. 2005. Phenolic
compounds from the fruit of Garcinia dulcis. Phytochemistry, 66(19), 2368-2375.
58. Deng YX, Pan SL, Zhao SY, Wu MQ, Sun ZQ, Chen XH and Shao ZY. 2012.
Cytotoxic alkoxylated xanthones from the resin of Garcinia hanburyi. Fitoterapia,
83(8), 1548-1552.
59. Derogis PB, Martins FT, de Souza TC, de CM, Maria E, Souza Filho JD, Doriguetto
AC, De Souza KRD, Veloso MP and Dos Santo MH. 2008. Complete assignment of
the 1H and 13C NMR spectra of garciniaphenone and keto‐enol equilibrium statements
for prenylated benzophenones. Magn. Reson. Chem. , 46(3), 278-282.
60. Dharmaratne HRW, Piyasena KGNP and Tennakoon SB. 2005. A geranylated biphenyl
derivative from Garcinia mangostana. Nat. Prod. Res., 19(3), 239-243.
54
61. Ee GCL, Daud S, Taufiq-Yap YH, Ismail NH and Rahmani M. 2006. Xanthones from
Garcinia mangostana (Guttiferae). Nat. Prod. Res., 20(12), 1067-1073.
62. Ee GCL, Foo CH, Jong VYM, Ismail NH, Sukari MA, Yap YT and Awang K. 2012. A
new xanthone from Garcinia nitida. Nat. Prod. Res., 26(9), 830-835.
63. Ee GCL, Mong XH and Sukari MA. 2003. Cuneifolin, a new xanthone from Garcinia
cuneifolia (Guttiferae). Nat. Prod. Sci., 9(3), 174-176.
64. Elfita E, Muharni M, Latief M, Darwati D, Widiyantoro A, Supriyatna S, Bahtic HH,
Dachriyanusf D, Cosg P, Maesg L, Fouberth K, Apers S and Pieters L. 2009.
Antiplasmodial and other constituents from four Indonesian Garcinia spp.
65. Elya B, He HP, Kosela S, Hanafi M and Hao X J. 2008. A new cytotoxic xanthone
from Garcinia rigida. Fitoterapia, 79(3), 182-184.
66. Elya B, He HP, Kosela S, Hanafi M and Hao XJ. 2006. A new benzophenone from the
stem bark of Garcinia benthami. Nat. prod. Res., 20(12), 1059-1062.
67. Elya B, He HP, Kosela S, Hanafi M and Hao XJ. 2006a. Two new xanthons from
Garcinia rigida leaf. Nat. prod. Res., 20(9), 788-791.
68. Fa-Ching C, Yuh-Meei L and Jeng-Ching H. 1975. Phenolic compounds from the
heartwood of Garcinia multiflora. Phytochemistry, 14(1), 300-303.
69. Feng F, Liu WY, Chen YS, Guo QL and You QD. 2007. Five novel prenylated
xanthones from Resina Garciniae. J. Asian Nat Prod Res., 9(8), 735-741.
70. Fotso GW, Ntumy AN, Ngachussi E, Dube M, Mapitse R, Kapche GD, Andrae-
Marobela K, Ngadjui BT and Abegaz B M. 2014. Epunctanone, a new benzophenone,
and further secondary metabolites from Garcinia epunctata Stapf (Guttiferae). Helv.
Chim. Acta, 97(7), 957-964.
71. Fouotsa H, Lannang AM, Mbazoa CD, Rasheed S, Marasini BP, Ali Z, Devkotae KP,
Kengfacka AE, Shaheenb F, Choudhary MI and Sewald N. 2012. Xanthones inhibitors
of α-glucosidase and glycation from Garcinia nobilis. Phytochem. Lett., 5(2), 236-239.
72. Fouotsa H, Lannang AM, Dzoyem JP, Tatsimo SJ, Neumann B, Mbazoa CD,
Razakarivony AA, Nkengfack AE, Eloff JN and Sewald N. 2015. Antibacterial and
antioxidant xanthones and benzophenone from Garcinia smeathmannii. Planta Med.,
81(7), 594-599.
73. Fu W, Wu M, Zhu L, Lao Y, Wang L, Tan H, Yuan Q and Xu H. 2015. Prenylated
benzoylphloroglucinols and biphenyl derivatives from the leaf of Garcinia multiflora
Champ. RSC Adv., 5(95), 78259-78267.
74. Fukuyama Y, Kamiyama A, Mima YN and Kodama M. 1991. Prenylated xanthones
from Garcinia subelliptica. Phytochemistry, 30(10), 3433-3436.
75. Fukuyama Y, Kuwayama A and Minami H. 1997. Garsubellin A, a novel
polyprenylated phloroglucin derivative, increasing choline acetyltransferase (ChAT)
activity in postnatal rat septal neuron cultures. Chem. Pharm. Bull., 45(5), 947-949.
76. Fukuyama Y, Minami H and Kuwayama A. 1998. Garsubellins, polyisoprenylated
phloroglucinol derivatives from Garcinia subelliptica. Phytochemistry, 49(3), 853-857.
77. FukuyamaY, Kaneshi A, Tani N and Kodama M. 1993. Subellinone, a
polyisoprenylated phloroglucinol derivative from Garcinia subelliptica.
55
78. Gao XM, Ji BK, Li YK, Ye YQ, Jiang ZY, Yang HY, Du G, Zhou M, Pan XX, Liu
WX and Hu QF. 2016. New biphenyls from Garcinia multiflora. J. Braz. Chem. Soc.,
27(1), 10-14.
79. Gao XM, Yu T, Cui MZ, Pu JX, Du X, Han QB, Hua QF, Liua TC, Luob KQ, and Xu
HX. 2012. Identification and evaluation of apoptotic compounds from Garcinia
oligantha. Bioorg. Med. Chem. Lett., 22(6), 2350-2353.
80. Gao XM, Yu T, Lai FSF, Pu JX, Qiao CF, Zhou Y, Liua X, Songa JZ, Luob KQ and
Xu HX. 2010. Novel polyisoprenylated benzophenone derivatives from Garcinia
paucinervis. Tetrahedron Lett., 51(18), 2442-2446.
81. Geiger H and Quinn C. 1988. Biflavonoids: The Flavonoids Advances in Research
since 1980. Harborne JB. ed. Academic Press, New York.
82. Gil B, Sanz MJ, Terencio MC, Gunasegaran R, Paya M and Alcaraz MJ. 1997.
Morelloflavone, a novel biflavonoid inhibitor of human secretory phospholipase A2
with anti-inflammatory activity. Biochem. Pharmacol., 53(5), 733-740.
83. Goh SH, Jantan I, Gray AI and Waterman PG. 1992. Prenylated xanthones from
Garcinia opaca. Phytochemistry, 31(4), 1383-1386.
84. Gontijo VS, de Souza TC, Rosa IA, Soares MG, da Silva MA, Vilegas W and dos
Santos MH. 2012. Isolation and evaluation of the antioxidant activity of phenolic
constituents of the Garcinia brasiliensis epicarp. Food Chem., 132(3), 1230-1235.
85. Gopalakrishnan G and Balaganesan B. 2000. Two novel xanthones from Garcinia
mangostana. Fitoterapia, 71(5), 607-609.
86. Gopalakrishnan G, Banumathi B and Suresh G. 1997. Evaluation of the antifungal
activity of natural xanthones from Garcinia mangostana and their synthetic derivatives.
J Nat. Prod., 60, 519-524.
87. Gottlieb OR. 1968. Biogenetic proposals regarding aucuparins and xanthones.
88. Govindachari TR, Kalyanaraman PS, Muthukumaraswamy N and Pai BR. 1971.
Xanthones of Garcinia mangostana Linn. Tetrahedron, 27(16), 3919-3926.
89. Gunatilaka AAL, De Silva AJ, Sotheeswaran S, Balasubramaniam S, and Wazeer MI.
1984. Terpenoid and biflavonoid constituents of Calophyllum calaba and Garcinia
spicata from Sri Lanka. Phytochemistry, 23(2), 323-328.
90. Gunatilaka AAL, Sriyani HB, Sotheeswaran S and Waight ES. 1983. 2,5-dihydroxy-1,
6-dimethoxyxanthone and biflavonoids of Garcinia thwaitesii. Phytochemistry, 22(1),
233-235.
91. Guo YE, Wang LL, Li ZL, Niu SL, Liu XQ, Hua HM, Chenc H, Chu J and Zhang TC.
2011. Triterpenes and xanthones from the stem bark of Garcinia tetralata. J. Asian Nat.
Prod. Res. , 13(05), 440-443.
92. Gustafson KR, Blunt JW, Munro MHG, Fuller RW, McKee TC, Cardellina JH,
McMahon JB, Cragg GM and Boyd MR. 1992. HIV Inhibitory Natural-Products. 8.
The Guttiferones, HIV-Inhibitory Benzophenones Symphonia globulifera, Garcinia
livingstonei, Garcinia ovalifolia and Clusia rosea. Tetrahedron, 48(46), 10093-10102.
93. Gutierrez-Orozco F and Failla ML. 2013. Biological activities and bioavailability of
mangosteen xanthones: A critical review of the current evidence. Nutrients, 5(8), 3163-
3183.
56
94. Ha LD, Hansen PE, Duus F, Pham HD and Nguyen LHD. 2012. Oliveridepsidones A-
D, antioxidant depsidones from Garcinia oliveri. Magn. Reson. Chem., 50(3), 242-245.
95. Han AR, Kim JA, Lantvit DD, Kardono LB, Riswan S, Chai H, de Blanco EJC,
Farnsworth NR, Swanson SM and Kinghorn AD. 2009. Cytotoxic xanthone
constituents of the stem bark of Garcinia mangostana (mangosteen). J. Nat. Prod.,
72(11), 2028-2031.
96. Han QB and Xu HX. 2009. Caged Garcinia xanthones: Development since 1937. Curr.
Med. Chem., 16(28), 3775-3796.
97. Han QB, Lee SF, Qiao CF, He ZD, Song JZ, Sun HD and Xu HX. 2005. Complete
NMR assignments of the antibacterial biflavonoid GB1 from Garcinia kola. Chem.
Pharm. Bull., 53(8), 1034-1036.
98. Han QB, Qiao CF, Song JZ, Yang NY, Cao XW, Peng Y, Yang DJ, Shen SL and Xu H
X. 2007. Cytotoxic prenylated phenolic compounds from the twig bark of Garcinia
xanthochymus. Chem. Biodivers., 4(5), 940-946.
99. Han QB, Yang NY, Tian HL, Qiao CF, Song JZ, Chang DC, Chend SL, Luob KQ and
Xu HX. 2008. Xanthones with growth inhibition against HeLa cells from Garcinia
xipshuanbannaensis. Phytochemistry, 69(11), 2187-2192.
100. Harrison LJ, Leong LS, Leong YW, Sia GL, Sim KY and Tan HTW. 1993. Xanthones
from Garcinia forbesii. Phytochemistry, 33(3), 727-728
101. Harrison LJ, Leong LS, Leong YW, Sia GL, Sim KY and Tan HTW. 1994. Xanthone
and flavonoid constituents of Garcinia dulcis (Guttiferae). Nat. Prod. Lett., 5(2), 111-
116.
102. Hartati S, Kadono LBS, Kosela S and Harrison LJ. 2008. A new pyrano xanthone from
the stem barks of Garcinia tetrandra Pierre. Pak. J. Bio.Sci., 8(1), 137-142.
103. Hartati S, Soemiati A, Wang HB, Kardono LB, Hanafi M, Kosela S and Qin GW.
2008a. A novel polyisoprenyl benzophenone derivative from Garcinia eugeniaefolia. J.
Asian nat. Prod. Res., 10(6), 509-513.
104. Hartati S, Wang HB, Kardono LS, Kosela S and Qin GW. 2007. Chemical constituents
of Garcinia maingayii. Zongguo tianran Yaowu, 5(4), 272-276.
105. Hay AE, Hélesbeux JJ, Duval O, Labaïed M, Grellier P and Richomme P. 2004.
Antimalarial xanthones from Calophyllum caledonicum and Garcinia vieillardii. Life
Sci., 75(25), 3077-3085.
106. Hay AE, Merza J, Landreau A, Litaudon M, Pagniez F, Le Pape P, and Richomme P.
2008. Antileishmanial polyphenols from Garcinia vieillardii. Fitoterapia, 79(1), 42-46.
107. Hemshekhar M, Sunitha K, Santhosh MS, Devaraja S, Kemparaju K, Vishwanath BS
and Girish KS. 2011. An overview on genus Garcinia: Phytochemical and therapeutical
aspects. Phytochem. Rev. , 10(3), 325-351.
108. Herbin GA, Jackson B, Locksley HD, Scheinmann F and Wolstenholme WA. 1970.
The biflavonoids of Garcinia volkensii (Guttiferae). Phytochemistry, 9(1), 221-226.
109. Hostettman K and Marston A. 2002. Twenty years of research into medicinal plants:
Results and perspectives. Phytochem. Rev., 1, 275-285.
110. Hu Q, Niu D, Wang S, Qin Y, Yang Z, Zhao G, Yang Z, Gao X and Chen Z. 2014.
New flavones from Garcinia bracteata and their biological activities. Chem. Nat.
Compd., 50(6), 985-988.
57
111. Hu QF, Wang YD, Zhu DL, Yu ZH, Zhan JB, Xing HH, Ma HY, Yang Y, Li YK,
Chen ZY and Gao XM. 2016. Three new biphenyls from the twigs of Garcinia
tetralata and their anti-tobacco mosaic virus activity. J. Asian Nat. Prod. Res., 1-7.
112. Huang YL, Chen CC, Chen YJ, Huang RL and Shieh BJ. 2001. Three xanthones and a
benzophenone from Garcinia mangostana. J. nat. prod., 64(7), 903-906.
113. Hussain RA and Waterman PG. 1982. Lactones, flavonoids and benzophenones from
Garcinia conrauana and Garcinia mannii. Phytochemistry, 21(6), 1393-1396.
114. Hussain RA, Owegby AG, Parimoo P and Waterman PG. 1982. Kolanone, a novel
polyisoprenylated benzophenone with antimicrobial properties from the fruit of
Garcinia kola. Planta Med., 44(02), 78-81.
115. Iinuma M, Ito T, Miyake R, Tosa H, Tanaka T and Chelladurai V. 1998. A xanthone
from Garcinia cambogia. Phytochemistry, 47(6), 1169-1170.
116. Iinuma M, Tosa H, Tanaka T, Asai F and Shimano R. 1995. Two new xanthones from
the root bark of Garcinia subelliptica. Heterocycles, 1(40), 279-284.
117. Iinuma M, Tosa H, Tanaka T, Asai F and Shimano R. 1995a. Two xanthones with a 1,
1-dimethylallyl group in root bark of Garcinia subelliptica. Phytochemistry, 39(4), 945-
947.
118. Iinuma M, Tosa H, Tanaka T, Asai F and Shimano R. 1995b. Three xanthones from
root bark of Garcinia subelliptica. Phytochemistry, 38(1), 247-249.
119. Iinuma M, Tosa H, Tanaka T, Kanamaru S, Asai F, Kobayashi Y, Miyauchi K and
Shimano R. 1996. Antibacterial activity of some Garcinia benzophenone derivatives
against methicillin-resistant Staphylococcus aureus. Biol. Pharm. Bull., 19(2), 311-314.
120. Iinuma M, Tosa H, Tanaka T, Shimano R, Asai F and Yonemori S. 1994. Two
xanthones from root bark of Garcinia subelliptica. Phytochemistry, 35(5), 1355-1360.
121. Ilyas M, Kamil M, Parveen M and Khan MS. 1994. Isoflavones from Garcinia nervosa.
122. Ito C, Itoigawa M, Mishina Y, Tomiyasu H, Litaudon M, Cosson JP, Mukainaka T,
Tokuda H, Nishino H and Furukawa H. 2001. Cancer chemopreventive agents. New
depsidones from Garcinia plants. J. Nat. Prod., 64(2), 147-150.
123. Ito C, Itoigawa M, Miyamoto Y, Onoda S, Rao KS, Mukainaka T, Tokuda H, Nishino
H Furukawa H. 2003. Polyprenylated benzophenones from Garcinia assigu and their
potential cancer chemopreventive activities. J. Nat. Prod., 66(2), 206-209.
124. Ito C, Itoigawa M, Takakura T, Ruangrungsi N, Enjo F, Tokuda H, Nishino M and
Furukawa H. 2003a. Chemical constituents of Garcinia fusca: Structure elucidation of
eight new xanthones and their cancer chemopreventive activity 1. J. Nat. Prod., 66(2),
200-205.
125. Ito C, Matsui T, Noda E, Ruangrungsi N and Itoigawa M. 2013. Biphenyl derivatives
from Garcinia schomburgkiana and the cytotoxicity of the isolated compounds. Nat.
Prod. Commun., 8(9), 1265-1267.
126. Ito C, Miyamoto Y, Nakayama M, Kawai Y, Rao KS and Furukawa H. 1997. A novel
depsidone and some new xanthones from Garcinia Species. Chem. Pharm. Bull., 45(9),
1403-1413.
127. Iwu M and Igboko O. 1982. Flavonoids of Garcinia kola seeds. J. Nat. Prod., 45(5),
650-651.
58
128. Iwu MM, Igboko OA and Tempesta MS. 1990. Biflavonoid constituents of Garcinia
kola roots. Fitoterapia, 61(2), 178-181.
129. Jabit L, Khalid R, Abas F, Shaari K, Hui LS, Stanslas J and Lajis NH. 2007. Cytotoxic
xanthones from Garcinia penangiana Pierre. Z. Naturforsch. C, 62(11-12), 786-792.
130. Jackson B, Locksley HD and Scheinmann F. 1968. The structure of the “GB”
biflavanones from Garcinia buchananii Baker and G. eugeniifolia Wall.
Chem.Commun., (18), 1125-1127.
131. Jackson B, Locksley HD, Moore I and Scheinmann F. 1968a. Extractives from
Guttiferae. Part IX. The isolation of buchanaxanthone and two related xanthones from
Garcinia buchananii Baker. J. Chem. Soc. C, 2579-2583.
132. Jackson B, Locksley HD and Scheinmann F. 1969. Extractives from Guttiferae. Part
XIII. Isolation and structure of five xanthones from Garcinia eugeniifolia wall. J.
Chem. Soc. C, (16), 2201-2203.
133. Jackson B, Locksley HD, Scheinmann F and Wolstenholme WA. 1971. Extractives
from Guttiferae Part XXII The isolation and structure of four novel biflavanones from
the heartwoods of Garcinia buchananii Baker and G. eugeniifolia Wall. J. Chem. Soc.
C: Organic, 3791-3804.
134. Jackson DN, Yang L, Wu S, Kennelly EJ and Lipke PN. 2015. Garcinia
benzophenones promote hyphal apoptosis and potentiate activity of fluconazole in
Candida albicans biofilms. Planta Med., 81(11), PU2.
135. Jamila N, Khairuddean M, Khan SN and Khan N. 2014. Complete NMR assignments
of bioactive rotameric (3→ 8) biflavonoids from the bark of Garcinia hombroniana,
Magn. Reson. Chem., 52(7), 345-352.
136. Jamila N, Khairuddean M, Khan SN, Khan N and Osman H. 2014a. Phytochemicals
from the bark of Garcinia hombroniana and their biological activities. Rec. Nat.
Prod., 8(3), 312-316.
137. Jamila N, Khairuddean M, Yaacob NS, Kamal NNSNM, Osman H, Khan SN and Khan
N. 2014b. Cytotoxic benzophenone and triterpene from Garcinia hombroniana. Bioorg.
Chem., 54, 60-67.
138. Jantan I and Saputri FC. 2012. Benzophenones and xanthones from Garcinia
cantleyana var cantleyana and their inhibitory activities on human low-density
lipoprotein oxidation and platelet aggregation. Phytochemistry, 80, 58-63.
139. Ji X, Avula B and Khan IA. 2007. Quantitative and qualitative determination of six
xanthones in Garcinia mangostana L by LC-PDA and LC-ESI-MS. J. Pharm. Biomed.
Anal., 43(4), 1270-1276.
140. Jiang HZ, Quan XF, Tian WX, Hu JM, Wang PC, Huang SZ, Chenga ZQ, Lianga WJ,
ZhouaJ, Ma XF and Zhao YX. 2010. Fatty acid synthase inhibitors of phenolic
constituents isolated from Garcinia mangostana. Bioorg. Med. Chem. Lett., 20(20),
6045-6047.
141. Jing WY, Jiang C, Ji F, Hua HM and Li ZL. 2013. Chemical constituents from the stem
barks of Garcinia multiflora. J. Asian Nat. Prod. Res., 15(11), 1152-1157.
142. Joong VYM, Ee GCL, Hin Y, Yap T, Khong HY and Chan MKY. 2012.
Benzophenone constituents from the roots of Garcinia eugenifolia. Res. J. Chem.
Environ., 16(1), 36-39.
59
143. Joshi BS and Viswanathan N. 1970. The isolation and structure of two biflavones from
Garcinia talboti. Phytochemistry, 9(4), 881-888.
144. Jung HA, Su BN, Keller WJ, Mehta RG and Kinghorn AD. 2006. Antioxidant
xanthones from the pericarp of Garcinia mangostana (Mangosteen). J. Agric. Food.
Chem., 54(6), 2077-2082.
145. Kabangu K, Galeffi C, Aonzo E, Nicoletti M, and Messana I. 1987. A new biflavonoid
from the bark of Garcinia kola. Planta Med., 53, 275-277.
146. Kaennakam S, Siripong P and Tip-pyang S. 2015. Kaennacowanols A-C, three new
xanthones and their cytotoxicity from the roots of Garcinia cowa. Fitoterapia, 102,
171-176.
147. Kaikabo AA, Samuel BB and Eloff JN. 2009. Isolation and activity of two antibacterial
biflavonoids from leaf extracts of Garcinia livingstonei (Clusiaceae). Nat. prod.
Commun., 4(10), 1363-1366.
148. Kapadia GJ, Oguntimein B and Shukla YN. 1994. High-speed counter-current
chromatographic separation of biflavanoids from Garcinia kola seeds. J. Chromatogr.
A, 673(1), 142-146.
149. Karanjgaokar CG, Radhakrishnan PV and Venkataraman K. 1967. Morelloflavone, a 3-
(8-)flavonylflavanone, from the heartwood of Garcinia Morella. Tetrahedron Lett., 8
(33), 3195-3198.
150. Karanjgoakar CG, Rao AR, Venkataraman K, Yemul SS and Palmer KJ. 1973. The
constitution of xanthochymol and isoxanthochymol. Tetrahedron Lett., 14(50), 4977-
4980.
151. Kardono LB, Hanafi M, Sherley G, Kosela S and Harrison LJ. 2006. Bioactive
constituents of Garcinia porrecta and G. parvifolia grown in Indonesia. Pak. J. Biol.
Sci., 9(3), 483-486.
152. Kartha G, Ramachandran GN, Bhat HB, Nair PM, Raghavan VKV and Venkataraman
K. 1963. The constitution of morellin. Tetrahedron Lett., 4(7), 459-472.
153. Kaur R, Chattopadhyay SK, Tandon S and Sharma S. 2012. Large scale extraction of
the fruits of Garcinia indica for the isolation of new and known polyisoprenylated
benzophenone derivatives. Ind. Crops Prod., 37(1), 420-426.
154. Khalid RM, Jabit ML, Abas F, Stanslas J, Shaari K and Lajis NH. 2007. Cytotoxic
xanthones from the leaf of Garcinia urophylla. Nat. Prod. Commun., 2(3), 271-276.
155. Kijjoa A, Gonzalez MJ, Pinto MM, Nascimento MS, Campos N, Mondranondra IO,
Silva AM, Eaton G and Herz W. 2008. Cytotoxicity of prenylated xanthones and other
constituents from the wood of Garcinia merguensis. Planta Med., 74(8), 864-866.
156. Klaiklay S, Sukpondma Y, Rukachaisirikul V and Phongpaichit S. 2013.
Friedolanostanes and xanthones from the twigs of Garcinia hombroniana.
Phytochemistry, 85, 161-166.
157. Komguem J, Lannang AM, Tangmouo JG, Louh GN, Ngounou FN, Lontsi D,
Choudhary MI and Sondengam BL. 2006. Polyanxanthone, a xanthone from the stem
bark of Garcinia polyantha. Nat. Prod.Commun., 1(5), 363-365.
158. Komguem J, Meli AL, Manfouo RN, Lontsi D, Ngounou FN, Kuete V, Kamdemc HW,
Tanec P, Ngadjuia BT, Sondengama BL and Connolly JD. 2005. Xanthones from
60
Garcinia smeathmannii (Oliver) and their antimicrobial activity. Phytochemistry,

66(14), 1713-1717.
159. Konoshima M and Ikeshiro Y. 1970. Fukugiside, the first biflavonoid glycoside from
Garcinia spicata hook f. Tetrahedron Lett., 11(20), 1717-1720.
160. Konoshima M, Ikeshiro Y, Nishinaga A, Matsuura T, Kubota T and Sakamoto H. 1969.
The constitution of flavonoids from Garcinia spicata hook f. Tetrahedron Lett., 10(2),
121-124.
161. Konoshima M, Ikeshiro Y, Miyahara S and Yen KY. 1970a. The constitution of
biflavonoids from Garcinia plants. Tetrahedron Lett., 11(48), 4203-4206.
162. Kosela S, Hu LH, Yip SC, Rachmatia T, Sukri T, Daulay TS, Tana GK, Vittala JJ and
Sim KY. 1999. Dulxanthone E: A pyranoxanthone from the leaf of Garcinia dulcis.
163. Kuete V, Komguem J, Beng VP, Meli AL, Tangmouo JG, Etoa FX and Lontsi D. 2007.
Antimicrobial components of the methanolic extract from the stem bark of Garcinia
smeathmannii Oliver (Clusiaceae). S. Afr. J. Bot., 73(3), 347-354.
164. Kumar S, Sharma S and Chattopadhyay SK. 2009. High-performance liquid
chromatography and LC-ESI-MS method for identification and quantification of two
isomeric polyisoprenylated benzophenones isoxanthochymol and camboginol in
different extracts of Garcinia species. Biomed Chromatogr, 23,888-907.
165. Lannang AM, Komguem J, Ngninzeko FN, Tangmouo JG, Lontsi D, Ajaz A,
Choudhary MI, Sondengam BL and Rahman AU. 2006. Antioxidant benzophenones
and xanthones from the root bark of Garcinia smeathmannii. Bull. Chem. Soc. Ethiop.,
20(2), 247-252.
166. Lannang AM, Komguem J, Ngninzeko FN, Tangmouo JG, Lontsi D, Ajaz, A,
Choudhary MI, Ranjit R, Devkota KP and Sondengam BL. 2005. Bangangxanthone A
and B, two xanthones from the stem bark of Garcinia polyantha Oliv. Phytochemistry,
66(19), 2351-2355.
167. Lannang AM, Louh GN, Lontsi D, Specht S, Sarite SR, Flörke U, Hussain H, Hoerauf
A and Krohn K. 2008. Antimalarial compounds from the root bark of Garcinia
polyantha Olv. J. Antibiot, 61(8), 518-523.
168. Lavaud A, Richomme P, Gatto J, Aumond MC, Poullain C, Litaudon M,
Andriantsitohaina R and Guilet D. 2015. A tocotrienol series with an oxidative terminal
prenyl unit from Garcinia amplexicaulis. Phytochemistry, 109, 103-110.
169. Le DH, Nishimura K, Takenaka Y, Mizushina Y and Tanahashi T. 2016.
Polyprenylated benzoylphloroglucinols with DNA polymerase inhibitory activity from
the fruits of Garcinia schomburgkiana. J. Nat. Prod. 79 (7),1798-1807.
170. Lee HH and Chan HK. 1977. 1,3,6-Trihydroxy-7-methoxy-8-(3,7-dimethyl-2,6-
octadienyl) xanthone from Garcinia cowa. Phytochemistry, 16(12), 2038-2040.
171. Li DH, Li CX, Jia CC, Sun YT, Xue CM, Bai J, Hua HM, Liu XQ and Li ZL. 2016a.
Xanthones from Garcinia paucinervis with in vitro anti-proliferative activity against
HL-60 cells. Arch. Pharmacal Res., 39(2), 172-177.
172. Li LM, Zhou J, Lou J, Wang YD, Zhou K, Dong W, Gao XM, Hu QF and Jiang ZY.
2015. A new flavone from stems of Garcinia bracteata and its anti-TMV activity.
Zhongguo Zhong Yao Za Zhi, 40(21), 4205-4207.
61
173. Li P, Anandhi Senthilkumar H, Figueroa M, Wu SB, Fata JE, Kennelly EJ and Long C.
2016. UPLC-QTOFMSE-Guided dereplication of the endangered Chinese species
Garcinia paucinervis to identify additional benzophenone derivatives. J. Nat. Prod., 79
(6), 1619-1627.
174. Li Y, Chen Y, Xiao C, Chen D, Xiao Y and Mei Z. 2014. Rapid screening and
identification of α-amylase inhibitors from Garcinia xanthochymus using enzyme-
immobilized magnetic nanoparticles coupled with HPLC and MS. J. Chromatogr.
B, 960, 166-173.
175. Li Y, Wang Z, Wu X, Yang Y, Qin Y, Xia C, Meng Y, Li M, Gao XM and Hu Q. 2015.
Biphenyl derivatives from the twigs of Garcinia bracteata and their biological
activities. Phytochem. Lett., 11, 24-27.
176. Likhitwitayawuid K, Phadungcharoen T and Krungkrai J. 1998. Antimalarial xanthones
from Garcinia cowa. Planta Med., 64(1), 70-72.
177. Likhitwitayawuid K, Phadungcharoen T, Mahidol C and Ruchirawat S. 1997. 7-O-
methylgarcinone E from Garcinia cowa. Phytochemistry, 45(6), 1299-1301.
178. Lin CN, Wang JP and Weng JR. 2005. Anti-inflammatory and cure for ageing,
Alzheimer’s disease on phloroglucinol derivatives. U.S. Patent Application 11/078,194.
179. Lin G and Xu HX. 2010. Cytotoxic acylphloroglucinol derivatives from the twigs of
Garcinia cowa. J. Nat. Prod., 73, 104-108.
180. Lin KW, Huang AM, Tu HY, Lee LY, Wu CC, Hour TC, Yang SC, Pu YS and Lin C.
N. 2010a. Xanthine oxidase inhibitory triterpenoid and phloroglucinol from
guttiferaceous plants inhibit growth and induced apoptosis in human NTUB1 cells
through a ROS-dependent mechanism. J. Agric. Food. Chem., 59(1), 407-414.
181. Lin KW, Huang AM, Yang SC, Weng JR, Hour TC, Pu YS and Lin CN. 2012.
Cytotoxic and antioxidant constituents from Garcinia subelliptica. Food. Chem.,
135(2), 851-859.
182. Lin YM, Anderson H, Flavin MT, Pai YHS, Mata-Greenwood E, Pengsuparp T,
Pezzuto JM, Scinazi RF, Hughes SH and Chenn FC. 1997. In vitro anti-HIV activity of
biflavonoids isolated from Rhus succedanea and Garcinia multiflora. J. Nat.
Prod., 60(9), 884-888.
183. Liu G, Li L, Wang H, Yang J, Lou J, Hu Q, Ye Y and Gao X. 2015. A new biphenyl
from Garcinia oligantha and its cytotoxicity. Asian J. Chem., 27(7), 2731.
184. Locksley HD. 1973.The Chemistry of Biflavanoid Compounds. In: Fortschritte der
Chemie Organischer Naturstoffe Springer Vienna, pp. 207-312.
185. Louh GN, Lannang AM, Mbazoa CD, Tangmouo JG, Komguem J, Castilho P, Qamarc
NN, Lontsia D, Choudhary MI and Sondengam BL. 2008. Polyanxanthone A, B and C,
three xanthones from the wood trunk of Garcinia polyantha Oliv. Phytochemistry,
69(4), 1013-1017.
186. Lu YH, Wei BL, Ko HH and Lin CN. 2008. DNA strand-scission by phloroglucinols
and lignans from heartwood of Garcinia subelliptica Merr. and Justicia plants.
187. Madubunyi II. 1995. Antimicrobial activities of the constituents of Garcinia kola seeds.
Int. J. Pharmacogn., 33(3), 232-237.
62
188. Magadula J, Kapingu MC, Bezabih M and Abegaz BM. 2008. Polyisoprenylated
benzophenones from Garcinia semseii (Clusiaceae). Phytochem. Lett., 1(4), 215-218.
189. Magadula JJ and Mbwambo ZH. 2014. Garcinia Plant Species of African Origin:
Ethnobotanical, Pharmacological and Phytochemical Studies. Open Science Publishers,
New York.
190. Magadula JJ. 2010. A bioactive isoprenylated xanthone and other constituents of
Garcinia edulis. Fitoterapia, 81(5), 420-423.
191. Mahabusarakam W, Chairerk P and Taylor WC. 2005. Xanthones from Garcinia cowa
Roxb latex. Phytochemistry, 66(10), 1148-1153.
192. Mahabusarakam W, Wiriyachitra P and Taylor WC. 1987. Chemical constituents of
Garcinia mangostana. J. Nat. Prod., 50(3), 474-478.
193. Mahamodo S, Rivière C, Neut C, Abedini A, Ranarivelo H, Duhal N, Roumy V,
Hennebelle T, Sahpaz S, Lemoine A, Razafimahefa B, Bailleul F, Razafimahefa D and
Andriamihaja B. 2014. Antimicrobial prenylated benzoylphloroglucinol derivatives and
xanthones from the leaf of Garcinia goudotiana. Phytochemistry, 102, 162-168.
194. Mandal S, Das PC and Joshi PC. 1992. Naturally occuring xanthones from terrestrial
flora. J. Indian Chem. Soc., 69(10), 611-636.
195. Martins FT, dos Santos MH, Coelho CP, Barbosa LC, Dias GC, Fracca MP, Neves
PP, Stringheta PC and Doriguetto AC. 2011. A powder X-ray diffraction method for
detection of polyprenylated benzophenones in plant extracts associated with HPLC for
quantitative analysis. J. Pharm. Biomed. Anal., 54(3), 451-457.
196. Masuda T, Yamashita D, Takeda Y and Yonemori S. 2005. Screening for tyrosinase
inhibitors among extracts of seashore plants and identification of potent inhibitors from
Garcinia subelliptica. Biosci. Biotech. Biochem., 69(1), 197-201.
197. Masullo M, Bassarello C, Suzuki H, Pizza C and Piacente S. 2008. J. Agric. Food
Chem., 56, 5205-5210.
198. Masullo M, Bassarello C, Bifulco G and Piacente S. 2010. Polyisoprenylated
benzophenone derivatives from the fruits of Garcinia cambogia and their absolute
configuration by quantum chemical circular dichroism calculations. Tetrahedron, 66(1),
139-145.
199. Matsumoto K, Akao Y, Kobayashi E, Ito T, Ohguchi K, Tanaka T and Nozawa Y.
2003. Cytotoxic benzophenone derivatives from Garcinia species display a strong
apoptosis-inducing effect against human leukemia cell lines. Biol. Pharm. Bull., 26(4),
569-571.
200. Mbafor JT, Fomum ZT, Promsattha R, Sanson DR and Tempesta MS. 1989. Isolation
and characterization of taxifolin 6-C-glucoside from Garcinia epunctata. J. Nat. Prod.,
52(2), 417-419.
201. Mbwambo ZH, Kapingu MC, Moshi MJ, Machumi F, Apers S, Cos P, Ferreira D,
Marais JPJ, Berghe DV, Maes L, Vlietinck A and Pieters L. 2006. Antiparasitic activity
of some xanthones and biflavonoids from the root bark of Garcinia livingstoneii. J.
Nat. Prod., 69(3), 369-372.
202. Meechai I, Phupong W, Chunglok W and Meepowpan P. 2016. Anti-radical activities
of xanthones and flavonoids from Garcinia schomburgkiana. Int. J. Pharm. Pharm.
Sci., 8(9).
63
203. Meesakul P, Pansanit A, Maneerat W, Sripisut T, Ritthiwigrom T, Machana T,

Cheenpracha S and Laphookhieo S. 2016. Xanthones from Garcinia propinqua Roots.
Nat. Prod. Commun., 11(1), 87.
204. Mercader A and Pomilio AB. 2012. (Iso) Flav (an) ones, chalcones, catechins, and
theaflavins as anticarcinogens: Mechanisms, anti-multidrug resistance and QSAR
studies. Curr. Med. Chem., 19(25), 4324-4347.
205. Merza J, Aumond MC, Rondeau D, Dumontet V, Le Ray AM, Séraphin D and
Richomme P. 2004. Prenylated xanthones and tocotrienols from Garcinia virgata.
206. Merza J, Mallet S, Litaudon M, Dumontet V, Séraphin D and Richomme P. 2006. New
cytotoxic guttiferone analogues from Garcinia virgata from New Caledonia. Planta
Med., 72(01), 87-89.
207. Messi BB, Ndjoko-Ioset K, Hertlein-Amslinger B, Lannang AM, Nkengfack AE,
Wolfender JL, Hostettmann K and Bringmann G. 2012. Preussianone, a new flavanone-
chromone biflavonoid from Garcinia preussii Engl. Molecules, 17(5), 6114-6125.
208. Mian VJY, Lian GEC and Yen KH. 2010. Xanthone from Garcinia eugenifolia
(Clusiaceae). In: Science and Social Research (CSSR), 2010 International
Conference,pp 786-788 IEEE.
209. Michel T, Destandau E, Fougere L, Elfakir C. 2012. New hyphenated CPC-HPLC-
DAD-MS strategy for simultaneous isolation, analysis and identification of
phytochemicals: Application to xanthones from Garcinia mangostana. Anal. Bioanal.
Chem., 404, 2963- 2972.
210. Minami H, Hamaguchi K, Kubo M and Fukuyama Y. 1998. A benzophenone and a
xanthone from Garcinia subelliptica. Phytochemistry, 49(6), 1783-1785.
211. Minami H, Kinoshita M, Fukuyama Y, Kodama M, Yoshizawa T, Sugiura M,
Nakagawa K and Tago H. 1994. Antioxidant xanthones from Garcinia subelliptica.
212. Minami H, Takahashi E, Kodama M and Fukuyama Y. 1996. Three xanthones from
Garcinia subelliptica. Phytochemistry, 41(2), 629-633.
213. Mishra A, Bapat MM, Tilak JC and Devasagayam T. 2006. Antioxidant activity of
Garcinia indica (kokam) and its syrup. Curr. Sci. India, 91(1), 90-93.
214. Momo IJ, Kuete V, Dufat H, Michel S and Wandji J. 2011. Antimicrobial activity of
the methanolic extract and compounds from the stembark of Garcinia lucida Vesque
(Clusiaceae). Int. J. Pharm. Pharmaceut. Sc., 3(11), 215-217.
215. Mungmee C, Sitthigool S, Buakeaw A and Suttisri R. 2013. A new biphenyl and other
constituents from the wood of Garcinia schomburgkiana. Nat. Prod. Res., 27(21),
1949-1955.
216. Mungmee C, Supotchana Sitthigool R and Buakeaw A. 2012. Xanthones and biphenyls
from Garcinia schomburgkiana and their cytotoxicity. Thai J. Pharm. Sci., 36, 6-9.
217. Na Z, Hu HB and Fan QF. 2010. A novel caged-prenylxanthone from Garcinia
bracteata. Chin. Chem. Lett., 21(4), 443-445.
218. Ngoupayo J, Noungoue DT, Lenta BN, Tabopda TK, Khan SN, Ngouela S, Shaiq MA
and Tsamo E. 2007. Brevipsidone, a new depsidone and other alpha-glucosidase
64
inhibitors from Garcinia brevipedicellata (Clusiaceae). Nat. Prod. Commun., 2(11),

1141-1144.
219. Ngoupayo J, Tabopda TK and Ali MS. 2009. Antimicrobial and immunomodulatory
properties of prenylated xanthones from twigs of Garcinia staudtii. Bioorg. Med.
Chem., 17(15), 5688-5695.
220. Ngoupayo J, Tabopda TK, Ali MS and Tsamo E. 2008. ALPHA-Glucosidase Inhibitors
from Garcinia brevipedicellata (Clusiaceae). Chem. Pharm. Bull., 56(10), 1466-1469.
221. Nguyen HD, Trinh BT and Nguyen LHD. 2011. Guttiferones Q-S, cytotoxic
polyisoprenylated benzophenones from the pericarp of Garcinia cochinchinensis.
Phytochem. Lett., 4(2), 129-133.
222. Nguyen HD, Trinh BT, Tran QN, Nguyen HD, Pham HD, Hansen PE, Duus F,
Connolly JD and Nguyen LHD. 2011a. Friedolanostane, friedocycloartane and
benzophenone constituents of the bark and leaf of Garcinia benthami.
223. Nguyen LHD and Harrison LJ. 2000. Xanthones and triterpenoids from the bark of
Garcinia vilersiana. Phytochemistry, 53(1), 111-114.
224. Nguyen LHD, Venkatraman G, Sim, KY and Harrison LJ. 2005. Xanthones and
benzophenones from Garcinia griffithii and Garcinia mangostana. Phytochemistry,
66(14), 1718-1723.
225. Nguyen LHD, Vo HT, Pham HD, Connolly JD and Harrison LJ. 2003. Xanthones from
the bark of Garcinia merguensis. Phytochemistry, 63(4), 467-470.
226. Nilar and Harrison LJ. 2002. Xanthones from the heartwood of Garcinia mangostana
227. Niu SL, Li ZL, Ji F, Liu GY, Zhao N, Liu XQ, Jing YK and Hua HM. 2012. Xanthones
from the stem bark of Garcinia bracteata with growth inhibitory effects against HL-60
cells. Phytochemistry, 77, 280-286.
228. Nontakham J, Charoenram N, Upamai W, Taweechotipatr M and Suksamrarn S. 2014.
Anti-Helicobacter pylori xanthones of Garcinia fusca. Arch. Pharmacal. Res., 37(8),
972-977.
229. Nuangnaowarat W, Phupong W, Intereya K and Isaka M. 2010. New prenylated
xanthone from the branch of Garcinia costata. Heterocycles, 81(10), 2377-2384.
230. Obolskiy D, Pischel I, Siriwatanametanon N and Heinrich M. 2009. Garcinia
mangostana L.: A phytochemical and pharmacological review. Phytother. Res., 23 (8)
1047-1065.
231. Okudaira C, Ikeda Y, Kondo S, Furuya S, Hirabayashi Y, Koyano T, Saito Y and
Umezawa K. 2000. Inhibition of acidic sphingomyelinase by xanthone compounds
isolated from Garcinia speciosa. J. Enzyme Inhib. Med. Chem., 15(2), 129-138.
232. Okwu DE and Morah FNI. 2007. Isolation and characterization of flavanone glycoside
4I, 5, 7-trihydroxy flavanone rhamnoglucose from Garcinia kola seed. J. Appl. Sci., 7,
306-309.
233. Ollis WD, Redman BT, Sutherland IO and Jewers K. 1969. The constitution of
bronianone. J. Chem. Soc. D, (15), 879-880.
65
234. On S, Aminudin N, Ahmad F, Sirat H M and Taher M. 2016. Chemical constituents

from stem bark of Garcinia prainiana and their bioactivities. Internat.J. Pharmacog.
Phytochem. Res., 8(5), 756-760.
235. Osorio E, Londoño J and Bastida J. 2013. Low-Density lipoprotein (LDL)-Antioxidant
biflavonoids from Garcinia madruno. Molecules, 18(5), 6092-6100.
236. Osorio E, Montoya G, and Bastida J. 2009. Phytochemical characterization of a
biflavonoid fraction from Garcinia madruno: Inhibition of human LDL oxidation and
its free radical scavenging mechanism. Vitae, 16(3), 369-377.
237. Padhye S, Ahmad A, Oswal N and Sarkar FH. 2009. Emerging role of Garcinol, the
antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs. J. Hemat.
Oncol. 2(38).
238. Pandey R, Chandra P, Kumar B, Srivastva M, Aravind AA, Shameer PS and
Rameshkumar KB. 2015. Simultaneous determination of multi-class bioactive
constituents for quality assessment of Garcinia species using UHPLC-QqQ LIT-
MS/MS. Ind. Crops Prod., 77, 861-872.
239. Pang X, Yi T, Yi Z, Cho SG, Gu W, Pinkaew D, Fujise, K and Liu M. 2009.
Morelloflavone, a biflavonoids inhibits tumor angiogenesis by targeting Rho GTPases
and extracellular signal regulated kinase signaling pathway. Cancer Res., 69(2), 518-
525.
240. Panthong K, Hutadilok-Towatana N and Panthong A. 2009. Cowaxanthone F, a new
tetraoxygenated xanthone and other anti-inflammatory and antioxidant compounds
from Garcinia cowa. Can. J. Chem., 87(11), 1636-1640.
241. Panthong K, Pongcharoen W, Phongpaichit S and Taylor W C. 2006. Tetraoxygenated
xanthones from the fruits of Garcinia cowa. Phytochemistry, 67(10), 999-1004.
242. Parthasarathy U, Nirmal Babu K, Senthil Kumar R, Ashis GR, Mohan S and
Parthasarathy VA. 2013. Diversity of Indian Garcinia-A Medicinally Important Spice
Crop in India. In: II International Symposium on Underutilized Plant Species: Crops for
the Future-Beyond Food Security. 979, pp. 467-476.
243. Parveen M and Khan NUD. 1988. Two xanthones from Garcinia mangostana.
244. Parveen M, Ilyas M, Mushfiq M, Busudan OA and Muhaisen HM. 2004. A new
biflavonoid from leaf of Garcinia nervosa. Nat. Prod. Res., 18(3), 269-275.
245. Parveen N, Singh MP, Khan NU and Logani MK. 1994. Flavonoidic constituents of
Garcinia xanthochymus leaf. Fitoterapia, 65, 89.
246. Pelter A, Warren R, Chexal KK, Handa BK and Rahman W. 1971. Biflavonyls from
Guttifereae-Garcinia livingstonii. Tetrahedron, 27(8), 1625-1634.
247. Pereira IO, Marques MJ, Pavan ALR, Codonho BS, Barbieri, CL, Beijo LA and Dos
Santos MH. 2010. Leishmanicidal activity of benzophenones and extracts from
Garcinia brasiliensis Mart fruits. Phytomed., 17(5), 339-345.
248. Peres V, Nagem TJ and de Oliveira FF. 2000. Tetraoxygenated naturally occurring
xanthones. Phytochemistry, 55(7), 683-710.
249. Permana D, Abas F, Maulidiani F, Shaari K, Stanslas J, Ali AM and Lajis NH. 2005.
Atrovirisidone B, a new prenylated depsidone with cytotoxic property from the roots of
Garcinia atroviridis. Z. Naturforsch. C, 60(7-8), 523-526.
66
250. Permana D, Lajis NH, Mackeen MM, Ali AM, Aimi N, Kitajima M and Takayama H.
2001. Isolation and bioactivities of constitutents of the roots of Garcinia atroviridis. J.
Nat. Prod., 64(7), 976-979.
251. Phongi BMC, Totte J, Pieters LAC, Hoof LV, Van Den Berghe TVDA and Vlietinck
AJ. 1987. Structure and chemotherapeutical activity of a polyisoprenylated
benzophenone from the stem bark of Garcinia huillensis. J. Ethnopharmacol., 21, 75-
84.
252. Pieme CA, Ambassa P, Yankep E and Saxena AK. 2015. Epigarcinol and isogarcinol
isolated from the root of Garcinia ovalifolia induce apoptosis of human promyelocytic
leukemia (HL-60 cells). BMC research notes, 8(1), 700.
253. Pinkaew D, Cho SG, Hui DY, Wiktorowicz JE, Hutadilok-Towatana N,
Mahabusarakam W and Fujise K. 2009. Morelloflavone blocks injury-induced
neointimal formation by inhibiting vascular smooth muscle cell migration. Biochim.
Biophys. Acta. (BBA)-General Subjects, 1790(1), 31-39.
254. Porto AL, Machado SM, de Oliveira CM, Bittrich V, Maria do Carmo EA and
Marsaioli AJ. 2000. Polyisoprenylated benzophenones from Clusia floral resins.
255. Quan GH, Oh SR, Kim JH, Lee HK, Kinghorn AD and Chin YW. 2010. Xanthone
constituents of the fruits of Garcinia mangostana with anticomplement activity.
Phytother. Res., 24(10), 1575-1577.
256. Rahman M, Riaz M and Desai UR. 2007. Synthesis of biologically relevant
biflavanoids-A review. Chem. Biodivers., 4(11), 2495-2527.
257. Rajaonarivelo M, Rakotonandrasana O, Raharinjato F, Martin MT, Dumontet V,
Rasoanaivo P, Gueritte F. 2009. New cytotoxic compounds from Madagascar plants.
In: Proceedings of Biomedical symposium, Antanarivo, Madagascar, p. 65.
258. Rambeloson VHV, Rasoanaivo LH, Wadouachi A, Randrianasolo R, Krebs HC and
Raharisololalao A. 2014. Two new xanthones from Garcinia chapelieri:
Chapexanthone A; chapexanthone B. J. Pharmacog. Phytochem., 2(5), 164-171.
259. Rao AR, Sarma MR, Venkataraman K and Yemul SS. 1974. A benzophenone and
xanthone with unusual hydroxylation patterns from the heartwood of Garcinia
pedunculata. Phytochemistry, 13(7), 1241-1244.
260. Rao AR, Venkataraman K and Yemul SS. 1973. The structure of bronianone.
Tetrahedron Lett., 14(50), 4981-4982.
261. Rao AR, Venkatswamy G and Pendse D. 1980. Camboginol and cambogin.
262. Rao BS. 1937. Morellin, a constituent of the seeds of Garcinia morella. J. Chem. Soc.,
853-855.
263. Rao RR and Natarajan S. 1950. On 'morellin', the antibacterial principle of the seeds of
Garcinia morella Desrous. Curr. Sci., 19(2), 59-60.
264. Ren Y, Lantvit DD, de Blanco EJC, Kardono LB, Riswan S, Chai H, Cottrellg CE,
Farnsworth NR, Swanson SM, Ding Y, Li XC, Marais JPJ, Ferreira D and Kinghorn
AD. 2010. Proteasome-inhibitory and cytotoxic constituents of Garcinia lateriflora:
Absolute configuration of caged xanthones. Tetrahedron, 66(29), 5311-5320.
67
265. Reutrakul V, Anantachoke N, Pohmakotr M, Jaipetch T, Sophasan S, Yoosook C,

Kasisit J, Napaswat C, Santisuk T, Tuchinda P and Tuchinda P. 2007. Cytotoxic and
anti-HIV-1 caged xanthones from the resin and fruits of Garcinia hanburyi. Planta
Med., 73(1), 33-40.
266. Roux D, Hadi HA, Thoret S, Guénard D, Thoison O, Païs M and Sévenet T. 2000.
Structure-activity relationship of polyisoprenyl benzophenones from Garcinia pyrifera
on the tubulin/microtubule system. J. Nat. Prod., 63(8), 1070-1076.
267. Rukachaisirikul V, Kaewnok W, Koysomboon S, Phongpaichit S and Taylor WC.
2000a Caged-tetraprenylated xanthones from Garcinia scortechinii. Tetrahedron,
56(43), 8539-8543.
268. Rukachaisirikul V, Kamkaew M, Sukavisit D, Phongpaichit S, Sawangchote P and
Taylor WC. 2003. Antibacterial xanthones from the leaf of Garcinia nigrolineata. J.
Nat. Prod., 66(12), 1531-1535.
269. Rukachaisirikul V, Naklue W, Phongpaichit S, Towatana NH and Maneenoon K. 2006.
Phloroglucinols, depsidones and xanthones from the twigs of Garcinia parvifolia.
Tetrahedron, 62(36), 8578-8585.
270. Rukachaisirikul V, Naklue W, Sukpondma Y and Phongpaichit S. 2005. An
antibacterial biphenyl derivative from Garcinia bancana MIQ. Chem. Pharm. Bull.,
53(3), 342-343.
271. Rukachaisirikul V, Pailee P, Hiranrat A, Tuchinda P, Yoosook C, Kasisit J and
Reutrakul V. 2003a. Anti-HIV-1 protostane triterpenes and digeranylbenzophenone
from trunk bark and stems of Garcinia speciosa. Planta Med., 69(12), 1141-1146.
272. Rukachaisirikul V, Painuphong P, Sukpondma Y, Koysomboon S, Sawangchote P and
Taylor WC. 2003b. Caged-triprenylated and-tetraprenylated xanthones from the latex
of Garcinia scortechinii. J. Nat. Prod., 66(7), 933-938.
273. Rukachaisirikul V, Ritthiwigrom T, Pinsa A, Sawangchote P and Taylor WC. 2003c.
Xanthones from the stem bark of Garcinia nigrolineata. Phytochemistry, 64(6), 1149-
1156.
274. Rukachaisirikul V, Tadpetch K, Watthanaphanit A, Saengsanae N, and Phongpaichit S.
2005a. Benzopyran, biphenyl, and tetraoxygenated xanthone derivatives from the twigs
of Garcinia nigrolineata. J. Nat. Prod., 68(8), 1218-1221.
275. Rukachaisirikul V, Trisuwan K, Sukpondma Y and Phongpaichit S. 2008. A new
benzoquinone derivative from the leaf of Garcinia parvifolia. Arch. Pharmacal Res.,
31(1), 17-20.
276. Ryu HW, Cho JK, Curtis-Long MJ, Yuk HJ, Kim YS, Jung S, Kima YS, Lee BW and
Park KH. 2011. α-Glucosidase inhibition and antihyperglycemic activity of prenylated
xanthones from Garcinia mangostana. Phytochemistry, 72(17), 2148-2154.
277. Ryu HW, Curtis-Long MJ, Jung S, Jin YM, Cho JK, Ryu YB, Lee WS and Park KH.
2010. Xanthones with neuraminidase inhibitory activity from the seedcases of Garcinia
mangostana. Bioorg. Med. Chem., 18(17), 6258-6264.
278. Sabu T, Mohanan N, Krishnaraj MV, Shareef SM, Shameer PS and Roy PE. 2013.
Garcinia pushpangadaniana (Clusiaceae), a new species from southern Western Ghats,
India. Phytotaxa, 116(2), 51-56.
68
279. Saelee A, Phongpaichit S and Mahabusarakam W. 2015. A new prenylated biflavonoid

from the leaf of Garcinia dulcis. Nat. Prod. Res., 29(20), 1884-1888.
280. Sahu A, Das B and Chatterjee A. 1989. Polyisoprenylated benzophenones from
Garcinia pedunculata. Phytochemistry, 28(4), 1233-1235.
281. Sakunpak A and Panichayupakaranant P. 2012. Antibacterial activity of Thai edible
plants against gastrointestinal pathogenic bacteria and isolation of a new broad
spectrum antibacterial polyisoprenylated benzophenone, chamuangone. Food
Chem., 130(4), 826-831.
282. Santa-Cecília FV, Freitas LA, Vilela FC, Veloso CDC, da Rocha CQ, Moreira ME,
Diasa DF, Giusti-Paivab A and dos Santos MH. 2011. Antinociceptive and anti-
inflammatory properties of 7-epiclusianone, a prenylated benzophenone from Garcinia
brasiliensis. Eur. J. Pharmacol., 670(1), 280-285.
283. Sarma J, Shameer PS, Mohanan NN. 2016. A new species of Garcinia (Clusiaceae)
from Assam, north east India. Phytotaxa, 252(1), 73-76.
284. See I, Ee GCL, Teh SS, Kadir AA and Daud S. 2014. Two new chemical constituents
from the stem bark of Garcinia mangostana. Molecules, 19(6), 7308-7316.
285. See I, Ee GCL, Teh SS, Mah SH, Karjiban RA, Daud S and Jong VYM. 2016. A New
benzophenone from Garcinia benthamiana. Rec. Nat. Prod., 10(3), 355-361.
286. Semwal RB, Semwal, DK, Vermaak I and Viljoen A. 2015. A comprehensive scientific
overview of Garcinia cambogia. Fitoterapia, 102, 134-148.
287. Sen AK, Sarkar KK, Majumder C and Banerji N. 1981. Minor xanthones of Garcinia
288. Sen AK, Sarkar KK, Mazumder PC, Banerji N, Uusvuori R and Hase TA. 1982. The
structures of garcinones A, B and C: Three new xanthones from Garcinia mangostana.
289. Sen AK, Sarkar KK, Mazumder PC, Banerji N, Uusvuori R and Haset TA. 1980. A
xanthone from Garcinia mangostana. Phytochemistry, 19(10), 2223-2225.
290. Shadid KA, Shaari K, Abas F, Israf DA, Hamzah AS, Syakroni N, Saha K and Lajis
NH. 2007. Cytotoxic caged-polyprenylated xanthonoids and a xanthone from Garcinia
cantleyana. Phytochemistry, 68(20), 2537-2544.
291. Shen J and Yang J. 2007. Chemical constituents of branch of Garcinia cowa Roxb.
Zhongcaoyao, 38, 993-994.
292. Shen J and Yang JS. 2006. Chemical constituents from fruit of Garcinia cowa. Chinese
Pharmaceut. J., 41(9), 660-661.
293. Shen J, Tian Z and Yang JS. 2007. The constituents from the stems of Garcinia cowa
Roxb. and their cytotoxic activities. Die Pharmazie, 62(7), 549-551.
294. Shen J, Yang JS and Zhou SX. 2006. Chemical constituents from the fruit of Garcinia
xipshuanbannaensis. Zhongguo Tianran Yaowu, 4(6), 440-443.
295. Singh IP, Sidana J, Bharate SB and Foley WJ. 2010. Phloroglucinol compounds of
natural origin: Synthetic aspects. Nat. Prod. Rep. 27, 393-416.
296. Siridechakorn I, Maneerat W, Sripisut T, Ritthiwigrom T, Cheenpracha S and
Laphookhieo S. 2014. Biphenyl and xanthone derivatives from the twigs of a Garcinia
sp. (Clusiaceae). Phytochem. Lett., 8, 77-80.
69
297. Siridechakorn I, Phakhodee W, Ritthiwigrom T, Promgool T, Deachathai S,

Cheenpracha S, Prawat U and Laphookhieo S. 2012. Antibacterial dihydrobenzopyran
and xanthone derivatives from Garcinia cowa stem barks. Fitoterapia, 83(8), 1430-
1434.
298. Soemiati A, Kosela S, Hanafi M and Harrison LJ. 2006. Garcinopicrobenzophenone, a
novel polyprenyl benzophenone from the bark of Indonesian Garcinia picrorrhiza Miq.
ACGC Chem. Res. Commun. 20, 1-5.
299. Sordat-Diserens I, Hamburger M, Rogers C and Hostettmannt K. 1992. Dimeric
xanthones from Garcinia livingstonei. Phytochemistry, 31(10), 3589-3593.
300. Sordat-Diserens I, Rogers C, Sordat B and Hostettmann K. 1992a. Prenylated
xanthones from Garcinia livingstonei. Phytochemistry, 31(1), 313-316.
301. Spino C, Lal J, Sotheeswaran S and Aalbersberg W. 1995. Three prenylated phenolic
benzophenones from Garcinia myrtifolia. Phytochemistry, 38(1), 233-236.
302. Srivastava SN and Sharma V. 1966. Chemical constituents of Garcinia livingstonei T
Anders. Curr. Sci., 35(11), 290.
303. Sriyatep T, Siridechakorn I, Maneerat W, Pansanit A, Ritthiwigrom T, Andersen RJ
and Laphookhieo S. 2015. Bioactive prenylated xanthones from the young fruits and
flowers of Garcinia cowa. J. Nat. Prod., 78(2), 265-271.
304. Stark TD, Lösch S, Salger M, Balemba OB, Wakamatsu J, Frank O and Hofmann T.
2015. A new NMR approach for structure determination of thermally unstable
biflavanones and application to phytochemicals from Garcinia buchananii. Magn.
Reson. Chem., 53(10), 813-820.
305. Stark TD, Matsutomo T, Lösch S, Boakye PA, Balemba OB, Pasilis SP and Hofmann
T. 2012. Isolation and structure elucidation of highly antioxidative 3, 8 ″-linked
biflavanones and flavanone-C-glycosides from Garcinia buchananii bark. J. Agric.
Food Chem., 60(8), 2053-2062.
306. Stark TD, Salger M, Frank O, Balemba OB, Wakamatsu J and Hofmann T. 2015a.
Antioxidative compounds from Garcinia buchananii stem bark. J. Nat. Prod., 78(2),
234-240.
307. Steller H. 1995. Mechanisms and genes of cellular suicide. Science, 267(5203), 1445-
1449.
308. Sukandar ER, Ersam T, Fatmawati S, Siripong P, Aree T and Tip-pyang S. 2016.
Cylindroxanthones A-C, three new xanthones and their cytotoxicity from the stem bark
of Garcinia cylindrocarpa. Fitoterapia, 108, 62-65.
309. Sukandar ER, Siripong P, Khumkratok S and Tip-pyang S. 2016a. New depsidones and
xanthone from the roots of Garcinia schomburgkiana. Fitoterapia, 111, 73-77.
310. Sukpondma Y, Rukachaisirikul V and Phongpaichit S. 2005. Xanthone and
Sesquiterpene derivatives from the fruits of Garcinia scortechinii. J. Nat. Prod., 68(7),
1010-1017.
311. Suksamrarn S, Suwannapoch N, Phakhodee W, Thanuhiranlert J, Ratananukul P,
Chimnoi N and Suksamrarn A. 2003. Antimycobacterial activity of prenylated
xanthones from the fruits of Garcinia mangostana. Chem. Pharm. Bull., 51(7), 857-
859.
70
312. Suksamrarn S, Suwannapoch N, Ratananukul P, Aroonlerk N and Suksamrarn A. 2002.

Xanthones from the green fruit hulls of Garcinia mangostana. J. Nat. Prod., 65(5),
761-763.
313. Sultanbawa MUS.1980. Xanthonoids of tropical plants. Tetrahedron, 36(1), 1465-1506.
314. Supasuteekul C, Nonthitipong W, Tadtong S, Likhitwitayawuid K., Tengamnuay P and
Sritularak B. 2016. Antioxidant, DNA damage protective, neuroprotective, and α-
glucosidase inhibitory activities of a flavonoid glycoside from leaf of Garcinia gracilis.
Revista Brasileira de Farmacognosia, 26(3), 312-320.
315. Taher M, Idris MS and Arbain D. 2007. Antimicrobial, antioxidant, anti-inflammatory
and cytotoxic activities of Garcinia eugenifolia and Calophyllum enervosum. Iranian J.
Pharmacol. Therapeut., 6(1), 93-98.
316. Taher M, Susanti D, Rezali MF, Zohri FSA, Ichwan SJA, Alkhamaiseh SI and Ahmad
F. 2012. Apoptosis, antimicrobial and antioxidant activities of phytochemicals from
Garcinia malaccensis Hk. f. Asian Pacific journal of tropical medicine, 5(2), 136-141.
317. Tan WN, Khairuddean M, Wong KC, Khaw KY and Vikneswaran M. 2014. New
cholinesterase inhibitors from Garcinia atroviridis. Fitoterapia, 97, 261-267.
318. Tan WN, Khairuddean M, Wong KC, Tong WY and Ibrahim D. 2016. Antioxidant
compounds from the stem bark of Garcinia atroviridis. J. Asian Nat. Prod. Res., 18(8),
804-811.
319. Tang YX, Fu WW, Wu R, Tan HS, Shen ZW and Xu HX. 2016. Bioassay-Guided
isolation of prenylated xanthone derivatives from the leaves of Garcinia oligantha. J.
Nat. Prod., 79(7), 1752-1761.
320. Tang ZY, Xia ZX, Qiao SP, Jiang C, Shen GR, Cai MX and Tang XY. 2015. Four new
cytotoxic xanthones from Garcinia nujiangensis. Fitoterapia, 102, 109-114.
321. Tantapakul C, Phakhodee W, Ritthiwigrom T, Cheenpracha S, Prawat U, Deachathai S
and Laphookhieo S. 2012. Rearranged benzophenones and prenylated xanthones from
Garcinia propinqua twigs. J. Nat. Prod., 75(9), 1660-1664.
322. Terashima K, Kondo Y, Aqil M and Niwa M. 1999. A new xanthone from the Stems of
Garcinia Kola. Nat. Prod. Lett., 14(2), 91-97.
323. Terashima K, Kondo Y, Aqil M, Niwa M. 1995. Garcinianin, a novel biflavonoid from
the roots of Garcinia kola. Heterocycles, 41, 2245-2250.
324. Terashima K, Kondo Y, Aqil M, Waziri M and Niwa M. 1999a. A study of
biflavanones from the stems of Garcinia kola (Guttiferae). Heterocycles, 50(1), 283-
290.
325. Terashima K, Shimamura T, Tanabayashi M, Aqil M, Akinniyi JA and Niwa M. 1997.
Constituents of the seeds of Garcinia kola: Two new antioxidants, garcinoic acid and
garcinal. Heterocycles, 8(45), 1559-1566.
326. Thoison O, Cuong DD, Gramain A, Chiaroni A, Van Hung N and Sévenet T. 2005.
Further rearranged prenylxanthones and benzophenones from Garcinia bracteata.
Tetrahedron, 61(35), 8529-8535.
327. Thongtheeraparp W, Wiriyachitra P and Taylor WC. 1994. Xanthones of Garcinia
cowa. Planta Med., 60(4), 365-368.
71
328. Trisuwan K, Rukachaisirikul V, Phongpaichit S and Hutadilok-Towatana N. 2013.

Tetraoxygenated xanthones and biflavanoids from the twigs of Garcinia merguensis.
Phytochem. Lett., 6(4), 511-513.
329. Tshibangu PT, Kapepula PM, Kapinga MK, Lupona HK, Ngombe NK, Kalenda DT,
Marini RD, Jansen O, Wauters JN, Angenot L, Ph Hubert and Rozet E. 2016.
Fingerprinting and validation of a LC-DAD method for the analysis of biflavanones in
Garcinia kola-based antimalarial improved traditional medicines. J. Pharm. Biomed.
Anal.,125, 382-390.
330. Venkataraman K. 1973. Pigments of Garcinia species. Indian National Science
Academy, New Delhi. 39(A)6, 365-381.
331. Vo HT, Ngo NT, Bui TQ, Pham HD and Nguyen LHD. 2015. Geranylated
tetraoxygenated xanthones from the pericarp of Garcinia pedunculata. Phytochem.
Lett., 13, 119-122.
332. Vo HT, Nguyen NTT, Maas G, Werz, UR, Pham HD and Nguyen LHD. 2012.
Xanthones from the bark of Garcinia pedunculata. Phytochem. Lett., 5(4), 766-769.
333. Vo HT, Nguyen NTT, Nguyen HT, Do KQ, Connolly JD, Maas G, Heilmannc J, Werzb
UR, Phama HD and Nguyen LHD. 2012a. Cytotoxic tetraoxygenated xanthones from
the bark of Garcinia schomburgkiana. Phytochem. Lett., 5(3), 553-557.
334. Waffo AFK, Mulholland D, Wansi JD, Mbaze LM, Powo R, Mpondo TN, Fomum ZT,
König W, Nkengfack AE. 2006. Afzeliixanthones A and B, Two new prenylated
xanthones from Garcinia afzelii ENGL. (Guttiferae). Chem. Pharm. Bull., 54, 448-451.
335. Wahyuni FS, Byrne LT, Dianita R, Jubahar J, Lajis NH and Sargent MV. 2004. A new
ring-reduced tetraprenyltoluquinone and a prenylated xanthone from Garcinia cowa.
Aust. J. Chem., 57(3), 223-226.
336. Wang LL, Li Z L Xu YP, Liu XQ, Pei YH, Jing YK and Hua HM. 2008. A new
cytotoxic caged polyprenylated xanthone from the resin of Garcinia hanburyi. Chin.
Chem. Lett., 19(10), 1221-1223.
337. Waterman PG and Crichton EG. 1980. Pyrones from the bark of Garcinia conrauana:
Conrauanalactone, a novel C 20 derived α-pyrone. Phytochemistry, 19(6), 1187-1189.
338. Waterman PG and Crichton EG. 1980a. Xanthones and biflavonoids from Garcinia
densivenia stem bark. Phytochemistry, 19(12), 2723-2726.
339. Waterman PG and Crichton EG. 1980b. Xanthones, benzophenones and triterpenes
from the stem bark of Garcinia ovalifolia. Planta Med., 40(12), 351-355.
340. Waterman PG and Hussain RA. 1982. Major xanthones from Garcinia quadrifaria and
Garcinia staudtii stem barks. Phytochemistry, 21(8), 2099-2101.
341. Waterman PG and Hussain RA. 1983. Systematic significance of xanthones,
benzophenones and biflavonoids in Garcinia. Biochem. Syst. Ecol., 11(1), 21-28.
342. Weng JR, Lin CN, Tsao LT and Wang JP. 2003. Novel and anti‐Inflammatory
constituents of Garcinia subelliptica. Chem.Europ. J., 9(9), 1958-1963.
343. Weng JR, Tsao LT, Wang JP, Wu RR and Lin CN. 2004. Anti-inflammatory
phloroglucinols and terpenoids from Garcinia subelliptica. J. Nat. Prod., 67(11), 1796-
1799.
72
344. Williams RB, Hoch J, Glass TE, Evans R, Miller JS, Wisse JH and Kingston DG. 2003.
A novel cytotoxic guttiferone analogue from Garcinia macrophylla from the Suriname
rainforest. Planta Med., 69(9), 864-866.
345. Wittenauer J, Falk S, Schweiggert-Weisz U and Carle R. 2012. Characterisation and
quantification of xanthones from the aril and pericarp of mangosteens (Garcinia
mangostana L) and a mangosteen containing functional beverage by HPLC-DAD-MSn.
Food Chem., 134(1), 445-452.
346. Wu CC, Lu YH, Wei BL, Yang SC, Won SJ and Lin CN. 2008. Phloroglucinols with
prooxidant activity from Garcinia subelliptica. J. Nat. Prod., 71(2), 246-250.
347. Wu CC, Weng JR, Won SJ and Lin CN. 2005. Constituents of the pericarp of Garcinia
subelliptica. J. Nat. Prod., 68(7), 1125-1127.
348. Wu J, Xu YJ, Cheng XF, Harrison LJ, Sim KY and Goh SH. 2001. A highly rearranged
tetraprenylxanthonoid from Garcinia gaudichaudii (Guttiferae). Tetrahedron
Lett., 42(4), 727-729.
349. Wu X, Ke CQ, Yang YP and Ye Y. 2008. New biphenyl constituents from Garcinia
oblongifolia. Helv. Chim. Acta, 91(5), 938-943.
350. Xia Z, Zhang H, Xu D, Lao Y, Fu W, Tan H, Cao P,Yang L and Xu H. 2015.
Xanthones from the leaf of Garcinia cowa induce cell cycle arrest, apoptosis, and
autophagy in cancer cells. Molecules, 20(6), 11387-11399.
351. Xia ZX, Zhang DD, Liang S, Lao YZ, Zhang H, Tan HS, Chen SL, Wang XH and Xu
HX. 2012. Bioassay-guided isolation of prenylated xanthones and polycyclic
acylphloroglucinols from the leaf of Garcinia nujiangensis. J. Nat. Prod., 75(8), 1459-
1464.
352. Xu G, Feng C, Zhou Y, Han QB, Qiao CF, Huang SX, Chang DC, Zhao QS, Luo KQ
and Xu HX. 2008. Bioassay and ultraperformance liquid chromatography/mass
spectrometry guided isolation of apoptosis-inducing benzophenones and xanthone from
the pericarp of Garcinia yunnanensis Hu. J. Agric. Food. Chem., 56(23), 11144-11150.
353. Xu L, Lao Y, Zhao Y, Qin J, Fu W, Zhang Y and Xu H. 2015. Screening active
compounds from Garcinia species native to China reveals novel compounds targeting
the STAT/JAK signaling pathway. Biomed. Res. Int., 10, 1-10.
354. Xu T, Deng Y, Zhao S and Shao Z. 2016. A new xanthone from the pericarp of
Garcinia mangostana. J. Chem. Res., 40(1), 10-11.
355. Xu X, Shi J, Li L, Zhu D, Yu Z, Yu W, Zhou M, Hu Q, Guo Y, Lou J, Gao X and Deng
L. 2016a. Biphenyls from the twigs of Garcinia multiflora and their anti-tobacco
mosaic virus activities. Rec. Nat. Prod., 10(5), 566-571.
356. Xu YJ, Cao SG, Wu XH, Lai YH, Tan BHK, Pereira JT, Goh SH, Venkatramana G,
Harrison LJ and Sim KY. 1998. Griffipavixanthone, a novel cytotoxic bixanthone from
Garcinia griffithii and G. pavifolia. Tetrahedron Lett., 39(49), 9103-9106.
357. Xu YJ, Chiang PY, Lai YH, Vittal JJ, Wu XH, Tan BKH, Imiyabir Z and Goh SH.
2000. Cytotoxic prenylated depsidones from Garcinia parvifolia. J. Nat. Prod., 63(10),
1361-1363.
358. Xu YJ, Lai YH, Imiyabir Z and Goh SH. 2001. Xanthones from Garcinia parvifolia. J.
Nat. Prod., 64(9), 1191-1195.
73
359. Xu YJ, Yip SC, Kosela S, Fitri E, Hana M, Goh SH and Sim KY. 2000. Novel
Cytotoxic, polyprenylated heptacyclic xanthonoids from Indonesian Garcinia
gaudichaudii (Guttiferae). Org. Lett., 2(24), 3945-3948.
360. Xu Z, Huang L, Chen XH, Zhu XF, Qian XJ, Feng GK, Lan WJ and Li HJ. 2014.
Cytotoxic prenylated xanthones from the pericarps of Garcinia mangostana. Molecules,
19(2), 1820-1827.
361. Yamaguchi LF, Katto MJ and Mascio PD. 2008. Perspectives in Biflavonoids-A
Review. In: Recent Progress in Medicinal Plants. Ed. Govil JN, Singh VK and Mishra
SK. Vol. 20, pp. 1-54.
362. Yang H, Figueroa M, To S, Baggett S, Jiang B, Basile MJ, Weinsteinand IB and
Kennelly EJ. 2010. Benzophenones and biflavonoids from Garcinia livingstonei fruits.
J. Agric. Food. Chem., 58(8), 4749-4755.
363. Yang J, Ding L, Hu L, Jin S, Liu W, You Q and Guo Q. 2012. Rapid characterization of
caged xanthones in the resin of Garcinia hanburyi using multiple mass spectrometric
scanning modes: The importance of biosynthetic knowledge based prediction. J.
Pharm. Biomed. Anal., 60, 71-79.
364. Yang NY, Han QB, Cao XW, Qiao CF, Song JZ, Chen SL, Yang DJ, Yiu H and Xu
HX. 2007. Two new xanthones isolated from the stem bark of Garcinia lancilimba.
Chem. Pharm. Bull., 55(6), 950-952.
365. Yang Y, Li L and Lou J. 2015. Isoprenylated flavones from Garcinia bracteata and
their anti-tobacco mosaic virus activity. Heterocycles, 91(2), 375-380.
366. Yates P and Stout GH. 1958. The structure of mangostin. J. Am. Chem. Soc., 80(7),
1691-1700.
367. Yu L, Zhao M, Yang B, Zhao Q and Jiang Y. 2007. Phenolics from hull of Garcinia
mangostana fruit and their antioxidant activities. Food Chem., 104(1), 176-181.
368. Zarena AS and Sankar KU. 2009. Supercritical carbon dioxide extraction of xanthones
with antioxidant activity from Garcinia mangostana: Characterization by HPLC/LC-
ESI-MS. J. Supercrit. Fluids, 49(3), 330-337.
369. Zhang DD, Zhang H, Lao YZ, Wu R, Xu JW, Murad F, Bian K and Xu HX. 2015.
Anti-Inflammatory effect of 1,3,5,7- tetrahydroxy-8-isoprenylxanthone isolated from
twigs of Garcinia esculenta on stimulated macrophage. Mediators Inflammation, 2015,
1-11.
370. Zhang LJ, Chiou CT, Cheng JJ, Huang HC, Kuo LMY, Liao CC, Bastow KF, Lee KH
and Kuo YH. 2010. Cytotoxic polyisoprenyl benzophenonoids from Garcinia
subelliptica. J. Nat. Prod., 73(4), 557-562.
371. Zhang Y, Song Z, Hao J, Qiu S and Xu Z. 2010a. Two new prenylated xanthones and a
new prenylated tetrahydroxanthone from the pericarp of Garcinia mangostana.
Fitoterapia, 81(6), 595-599.
372. Zhao Y, Liu JP, Lu D, Li PY and Zhang LX. 2012. Two new xanthones from the
pericarp of Garcinia mangostana. Nat. Prod. Res., 26(1), 61-65.
373. Zhong FF, Chen Y, Mei ZN and Yang GZ. 2007. Xanthones from the bark of Garcinia
xanthochymus. Chin. Chem. Lett., 18(7), 849-851.
74
374. Zhou X, He L, Wu X, Zhong Y, Zhang J, Wang Y, Wangb B, Xu Z and Qiu S. 2015.

Two new xanthones from the pericarp of Garcinia mangostana. Nat. Prod. Res., 29(1),
19-23.
375. Zhou X, Huang R, Hao J, Huang H, Fu M, Xu Z, Zhou Y, Li XE, Qiu SX and Wang, B.
2011. Two new prenylated xanthones from the pericarp of Garcinia mangostana
(mangosteen). Helv. Chim. Acta., 94(11), 2092-2098.
376. Zhou Y, Han QB, Song JZ, Qiao CF, and Xu HX. 2008. Characterization of
polyprenylated xanthones in Garcinia xipshuanbannaensis using liquid
chromatography coupled with electrospray ionization quadrupole time-of-flight tandem
mass spectrometry. J. Chromatogr. A, 1206(2), 131-139.
377. Zhou Y, Huang SX, Song JZ, Qiao CF, Li SL, Han QB and Xu HX. 2009. Screening of
polycyclic polyprenylated acylphloroglucinols from Garcinia species using precursor
ion discovery (PID) scan and ultra performance liquid chromatography electrospray
ionization Q-TOF tandem mass spectrometry. J. Am. Soc. Mass. Spectrom., 20(10),
1846-1850.
378. Zhou Y, Liu X, Yang J, Han QB, Song J Z, Li SL, Qiaoa CF, Ding LS and Xu HX.
2008a. Analysis of caged xanthones from the resin of Garcinia hanburyi using ultra-
performance liquid chromatography/electrospray ionization quadrupole time-of-flight
tandem mass spectrometry. Anal. Chim. Acta., 629(1), 104-118.
75
Chapter 3
Phytochemical investigation of the Western Ghats endemic species

Garcinia imberti Bourd.
K. B. Rameshkumar1*, Renu Pandey2, Lekshmi N Menon1, Brijesh Kumar2 and V. George3
1
Phytochemistry and Phytopharmacology Division, Jawaharlal Nehru Tropical Botanic Garden and
Research Institute, Palode, Thiruvananthapuram-695562, Kerala, India
2
Sophisticated Analytical Instrument Facility, CSIR-Central Drug Research Institute, Lucknow-
226031, Uttar Pradesh, India
3
Amity Institute of Phytochemistry and Phytomedicine, Peroorkada, Thiruvananthapuram 695 005,
Kerala, India
*
Abstract
Phytochemical investigation of the stem bark of Garcinia imberti, a Western Ghats endemic
species, resulted in the isolation and characterization of the biflavonoid morelloflavone, the
triterpenoid 2-hydroxy-3-acetoxy-urs-12-en-28-oic acid and the steroid stigmasterol. The
high content of morelloflavone (0.76% w/w) in the stem bark, estimated by HPTLC, projects
the plant as a rich source of the bioactive biflavonoid. The major compound from the hexane
extract of the leaves was isolated and characterized as the triterpenoid friedelin. HPTLC
estimation showed high content of friedelin in the plant leaves (2.2% w/w). Quantitative
screening of the phenolic compounds present in the leaf methanol extract of G. imberti was
carried out using UHPLC-QqQLIT-MS/MS technique. Twenty two phenolic compounds
comprising xanthones -mangostin and gambogic acid), biflavonoids (fukugiside, GB-2,
GB-1, GB-1a, amentoflavone), benzophenone (garcinol), flavonoids (epicatechin, isoorientin,
orientin, isovitexin, vitexin, kaempferol-3-O-rutinoside, luteolin, quercetin, apigenin,
kaempferol) and phenolic acids (protocatechuic acid, caffeic acid, ferulic acid, vanillic acid)
were identified and estimated in the leaves of the plant. The LC-MS study revealed the
biflavonoid GB1 in abundance in the leaf methanol extract (22.1000 mg/g). The plant was
also found as a rich source of essential oils and the volatile chemical studies revealed
caryophyllene derivatives as the major constituents of the essential oils from leaf, bark and
fruits.
Keywords: Garcinia imberti, Morelloflavone, GB1, Friedelin, Essential oil, Caryophyllene,

UHPLC-QqQLIT-MS/MS
Introduction
Garcinia species have multiple applications in culinary, pharmaceutical and nutraceutical
field. The genus has been the subject of elaborate phytochemical studies worldwide that
revealed it as a rich source of diverse compounds such as xanthones, benzophenones,
biflavanoids, flavonoids, acids, and lactones (Han et al., 2008). The phytochemicals reported
from Garcinia species exhibited a wide range of pharmacological activities such as anti-
microbial, anti-HIV, anti-diabetic, antioxidant and cytotoxic (Kim et al., 2008, Hemshekhar,
76
2011). The Western Ghats, one among the 36 global biodiversity hot spots, hosts 9 Garcinia
species, of which 7 are endemic to the region (Maheswari, 1964, Sabu et al., 2013). Of the 9
Garcinia species distributed in the Western Ghats, G. gummi gutta and G. indica are
cultivated widely and studied for their constituents and bioactivities. However, most of the
endemic species are yet to be studied for their phytochemicals or potential utilities.
Garcinia imberti Bourd. is an evergreen tree, endemic to the Agastyamala forests of
the Western Ghats (Figure 1). The species was originally described by T. F. Bourdillon in
1899 and rediscovered after nearly a century by Mohanan et al from the Agasthyamala Hills
(Bourdillon, 1899, Mohanan, 1997). G. imberti is least investigated for their phytochemicals
or bioactivities (Rameshkumar et al., 2005). Present chapter elaborates the phytochemical
investigation of G. imberti and reports the presence of sesquiterpenoids, triterpenoids,
steroids, flavonoids, biflavonoids, xanthones, benzophenones, and phenolic acids in the plant.
Conventional phytochemical investigation techniques such as extraction, separation and
characterization as well as modern rapid analytical techniques such as LC-MS and GC-MS
were utilized for the phytochemical profiling.
Figure 1. Garcinia imberti twig with fruit
1. Phytochemical investigation of the stem bark of Garcinia imberti

The plant parts were collected from Chemmungi forest area of south Western Ghats,
Thiruvananthapuram district, Kerala state, India and authenticated by Mr. M.S. Kiran Raj,
JNTBGRI. A voucher specimen (TBGT No.40076) has been deposited at the JNTBGRI
Herbarium (TBGT). IR spectra of the isolated compounds were taken on an ABB FTLA-
2000 spectrometer, UV spectra using Shimadzu (1650 PC) UV-Visible spectrometer, NMR
spectra using JEOL FT-NMR (300MHz) and Mass spectra using JEOL JMS-600
spectrometer.
Analyses of the hexane and methanol extracts of the stem bark of the plant resulted in the
isolation and characterization of the steroid stigmasterol (1), the triterpenoid 2-hydroxy, 3-
acetoxy urs-12-en, 28-oic acid (2) and the biflavonoid morelloflavone (3) (Figure 2). The
isolated compounds were identified by detailed spectroscopic studies and comparison with
literature data.
77
Compound 1 was isolated by column chromatography of the hexane extract of the

stem bark. The compound was eluted in the solvent system hexane: chloroform (9:1) and
identified as stigmasterol by comparison of the NMR and MS data (Conolly and Hill, 1994).
The steroid is a common phytochemical distributed widely in the plant kingdom and has been
isolated previously from several Garcinia species as well (Elfita et al., 2009).
Compound 2 was eluted from the hexane extract using the solvent system hexane: chloroform
(1:1) and was identified as 2-hydroxy-3-acetoxy-urs-12-en-28-oic acid by analyzing the
mass spectra, 1H and 13C NMR spectral data and comparison of the spectral data with those
reported in the literature (Chaturvedula et al., 2004). Despite the large number of literature
reports of different urs-12-en triterpenoids with different possible substitutions and
stereochemical orientations, the occurrence of ursolic acid derivatives with acetoxy group at
3- position and a free carboxylic acid group at C-17 are rare. The compound has been
reported to possess polymerase -lyase activity (Chaturvedula et al 2004). The ursane
triterpenoid has been isolated for the first time from Clusiaceae family.
Compound 3 was isolated by column chromatography of the stem bark methanol
extract. The compound was eluted using hexane: EtOAc (7.5:2.5) and was identified as
3’’’,4’,4’’’,5,5’’,7,7’’-heptahydroxy-3(8’’)-flavonyl flavonone (morelloflavone) by
comparison of the spectral data with those reported in the literature (Li et al., 2002). The
biflavonoid morelloflavone, first reported from Garcinia morella by Karanjgaokar et al. is a
common constituent among Garcinia species (Karanjgaokar et al., 1967). It is also the first
biflavonoid reported with a flavone and a flavonone unit. Morelloflavone has been reported
as anti inflammatory, anti HIV, anti fungal, anti tumor, hypocholesterolemic and anti
plasmodial (Lin et al., 1997, Li et al., 2002, Pang et al., 2009, Ngouamegne et al., 2008). The
biflavonoid also inhibits tyrosinase, the major enzyme responsible for skin melanization
(Masuda et al., 2005) and prevents restenosis (Pinkaew et al., 2009).
Stigmasterol (1): Colourless crystals, mp: 160-162o C. Rf: 0.48 (chloroform 100%). IR (KBr
cm-1): 3435, 2961, 2937, 2889, 2864, 1461, 1382, 1368, 1061, 970cm-1. EI-MS (70 eV) m/z
(%): 412 (M+, 70), 369 (8), 351 (13), 300 (28), 273 (17), 271 (28), 255 (30), 231 (10), 213
(20), 161 (19), 159 (22), 145 (42), 121 (26), 105 (36), 83 (60), 55 (100). 1H NMR (300 MHz,
CDCl3): 0.84(3H,d, J= 6.6Hz, H-27); 0.81(3H,d, J= 7.2 Hz, H-26); 5.03 (1H, dd,
J=15.1, 8.4, H-23); 5.14 (1H, dd, J=15.1, 8.4, H-22);  1.02(d, J= 6.6 Hz, H-21); 1.01 (s,
H-19); 0.69 (s, H-18); 5.35(1H, d, J= 4.8 Hz, H-6); 3.52 (m, H-3). 13C NMR (75 MHz,
CDCl3): 12.0 (CH3), 12.2 (CH3), 19.0 (CH3), 19.4 (CH3), 21.1 (CH3), 21.1 (CH2), 21.2 (CH3),
24.3 (CH2), 25.4 (CH2), 28.9 (CH2), 31.6 (CH2), 31.9 (CH x 2), 36.5 (C), 37.2 (CH2), 39.7
(CH2), 40.5 (CH), 42.3 (C), 50.1 (CH), 51.2 (CH), 55.9 (CH), 56.9 (CH), 71.8 (CH), 121.7
(CH), 129.3 (CH), 138.3 (CH), 140.7 (C)
2-Hydroxy-3-acetoxy-urs-12-en-28-oic acid (2): Colourless crystals, mp: 199-202º C. Rf:

0.54 (hexane: chloroform: methanol, 5:4.5:0.5), []D: – 40.9 (c 0.10, MeOH), IR (KBr):
3450, 2970, 2931, 2873, 1720, 1693, 1458, 1373, 1245, 1049, 1029, 960, cm-1. 1H NMR (300
MHz, CDCl3): 1.02 (1H, m, H-1ax), 2.1 (1H, m, H-1eq), 3.76 (1H, m, H-2), 4.51 (1H,
d, J= 9 Hz, H-3), 1.96 (2H, m, H-11), 5.23 (1H, m, H-12), 2.20 (1H, d, J=12Hz). 13C NMR
(75 MHz, CDCl3): 16.3 (CH3), 16.7 (CH3 x 2), 17.3 (CH3), 17.9 (CH2), 20.8 (CH3 x 2), 22.9
78
(CH2), 23.1 (CH3), 23.7 (CH2), 27.6 (CH2), 28.2 (CH3), 30.3 (CH2), 32.4 (CH2), 36.3 (CH2),
37.6 (C), 38.4 (CH), 38.6 (CH), 38.8 (C), 39.2 (C), 41.7 (C), 47.0 (CH), 47.1 (C), 47.3 (CH2),
52.2 (CH), 54.6 (CH), 66.2 (CH), 84.3 (CH), 124.6 (CH), 138.0 (C), 171.4 (C), 179.5 (C).
FAB-MS (pos.) m/z (%): 537 [M+Na]+ (3), 514 (5), 469 (10), 455 (19), 437 (100), 262 (31),
248 (50), 203 (62), 189 (58), 133 (81).
(-) Morelloflavone (3): Yellow solid from acetone/methanol, mp: 210o C (decomposing), Rf:
0.62 (CHCl3: MeOH, 17.0: 3.0), []D: – 59.9 (c 0.10, MeOH), IR (KBr): 3224, 1643, 1610,
1515, 1426, 1448, 1367, 1261, 1184, 1164, 839, cm-1, UV/Vis max (MeOH) nm: 341, 288,
277 and 227, 1H NMR (300 MHz, CDCl3): 5.76 (1H, d, J=12 Hz, H-2), 4.77 (1H, d, J=12 Hz,
H-3), 12.94 (1H, s, 5-OH), 5.96 (1H, s, H-6), 6.35 (1H, s, H-3’’), 6.26 (1H, s, H-6’’) 13C
NMR (75 MHz, CDCl3): 48.9, 81.3, 95.7, 96.6, 99.1, 100.8, 101.9, 102.7, 103.7, 113.6,
114.8, 116.5, 119.3, 121.6, 128.6, 128.7, 128.9, 146.3, 150.0, 155.7, 157.4, 161.1, 161.9,
163.3, 163.9, 164.3, 166.9, 182.1, 196.5
2. Phytochemical investigation of the leaves of Garcinia imberti

Compound 4 was isolated from the hexane extract of the leaves and identified as the
triterpenoid friedelin by comparison of the spectral data with those reported in the literature
(Antonisamy et al., 2011). Friedelin has been reported in different Garcinia species as well
(Magadula, 2010, Jantan and Saputri, 2012). Friedelin and its derivates have anti-cancer,
analgesic, anti-inflammatory, anti-bacterial, antioxidant, hepatoprotective, vascularizing
activities and have potential to be used in pharmaceuticals or functional foods for the
treatment or prevention of cardiovascular and cerebrovascular diseases and tumours
(Moiteiro et al., 2006, Antonisamy et al., 2011, Sunil et al., 2013, ).
Friedelin (4): White solid, m.p. 242-246°C. MS m/z (rel. int.): 449 [M+Na] + (8), 341 [M-
Me]+ (4), 302(14), 289 (7), 273[M-Me-H20 ] + (24), 246 (16), 231 (16), 205 (24), 191 (20),
163 (24), 149 (22), 125 (62), 123 (64), 109 (66), 95 (84), 81 (68), 69 (100). 1H NMR (CDCl3,
500 MHz) δ: 1.96 (1 H, m, H-1a), 1.71 (1 H, m, J = 10.1, H-1b), 2.37 (1 H, dd, J = 10, 3.5
and 4 Hz, H-2a), 2.26(1H,M,H-2b), 1.219-1.698(m, H3-H22), 0.86(3H, d, J=6.1Hz, Me-23),
0.70(3H,s, Me-24), 0 .84(3H,s,Me-25), 0.93(3H,s,Me-26), 1.03(3H,s,Me-27), 1.16(3H,s,Me-
28), 0.98(3H, s ,H-29), 0.98(3H,s,H-30). 13C NMR (500 MHz, CDCl3): δ 22.3 (C-1), 41.5 (C-
2), 213.3 (C-3), 58.2 (C-4), 42.2 (C-5), 41.3 (C- 6), 18.2 (C-7), 53.1 (C-8), 37.4 (C-9), 59.5
(C-10), 35.6 (C-11), 32.4 (C-12), 38.3 (C-13), 39.7 (C-14), 30.5 (C- 15), 36.0 (C-16), 30.0
(C-17), 42.8 (C-18), 35.3 (C-19), 28.2 (C-20), 32.8 (C-21), 29.6 (C-22), 6.8 (C-23), 14.7 (C-
24), 18.2 (C-25), 18.7 (C-26), 20.3 (C-27), 32.1 (C- 28), 31.8 (C-29), 35.0 (C-30)
3. HPTLC estimation of the major compounds in Garcinia imberti

Among the different analytical techniques, HPTLC has emerged as a widely applied
technique for qualitative and quantitative purposes in natural product analysis and the method
has successfully been explored for the estimation of bioactive compounds from plant sources
(Reich and Schibli, 2006, Aravind et al., 2008). In the present study, the HPTLC estimations
were carried out using Camag HPTLC system (Switzerland) equipped with LinomatV sample
applicator and Camag TLC scanner 3.
79
COOH
HO
AcO
HO
Stigmasterol 2- Hydroxy-3-acotoxy-urs-12-en-28-oic acid
OH
HO O
OH
OH
OH O
HO O
OH O
Friedelin
Morelloflavone
Figure 2. Structures of compounds 1 to 4
3.1. HPTLC estimation of morelloflavone in G. imberti stem bark

The dried, powdered stem bark (5 g) was extracted with methanol using Soxhlet apparatus for
6h and made up to 200 ml using methanol. Morelloflavone isolated from the plant was used
as the standard compound. 1.5 L of the extract was applied on the pre-coated silica gel plate
60F254 (E. Merk, Germany) along with standard morelloflavone (1.0 to 2.5g gave linear
response). The separation was carried out in twin trough chamber using the solvent system
chloroform: methanol (17:3) as mobile phase. Quantitation was carried out in absorbance
mode at 254 nm. The percentage content of morelloflavone was found 0.76 ±0.09 % (w/w) in
the stem bark. The plant can be considered as a new natural source of the bioactive
biflavonoid morelloflavone.
3.2. HPTLC estimation of friedelin in G. imberti leaves

The dried, powdered leaf sample (2 g) was extracted with hexane using Soxhlet apparatus for
6h and made up to 100 ml using hexane. For estimation of friedelin in the leaf samples, the
solvent system hexane-chlorofom-ethylacetate (9:0.5:0.5) gave the best resolution. 3.0 L of
the hexane extract was applied on the pre-coated silica gel plate 60F254 (E. Merk, Germany).
Standard friedelin at concentrations 0.5-4.0µg gave linear response with regression equation
y=257x+356.8 and the regression (r2) 0.949 indicated a good linear relationship between peak
area and concentration of the analyte. The specificity of the developed method was confirmed
by close Rf values of standard friedelin (0.31). The content of friedelin was 2.2 ±0.5% (w/w).
The high content of friedelin proposes the plant as a novel source of the compound.
80
4. UHPLC-QqQLIT-MS/MS analysis of G. imberti leaf methanol extract

Liquid chromatography-mass spectrometry using different combination of separation,
ionisation and mass analysing techniques have proven as an efficient tool for the qualitative
as well as quantitative characterization of phytochemicals (Wu et al., 2013). The hyphenated
analytical technique provided extremely powerful tools for natural product researchers that
offered both the separation and characterization in single run. Several Garcinia species have
been studied by various LC-MS techniques like LC-ESI-MS, UPLC-Q-TOF-MS and HPLC-
DAD-MSn and reported the distribution of acids, benzophenones, xanthones, biflavonoids
and acylphloroglucinols (Acuna et al, 2012, Ji et al, 2007; Zhou et al, 2010).
In the present study, the dried leaf powder (2g) was defatted with hexane and
extracted with methanol using Soxhlet apparatus. The methanol extract (1mg/ml) was diluted
with acetonitrile and spiked with internal standard curcumin (20 ng/mL final working
concentration) and 4 µL aliquot was injected into the UHPLC-MS/MS system for analysis. A
mixed standard stock solution (1 mg/mL) of the selected analytes were also prepared and
diluted with acetonitrile to get final concentrations of 0.1 to 300 ng/mL, along with internal
standard curcumin (20 ng/mL). The separation was achieved on Waters Acquity UPLCTM
system (Waters, Milford, MA, USA) equipped with binary solvent manager, sample manager,
column oven and photodiode array detector (PAD). The chromatographic separation of
selected analytes was carried out on an Acquity UPLC BEH C18 column (50 mm × 2.1 mm
id, 1.7µm) at a column temperature of 25°C. Analysis was done with gradient elution of 0.1%
formic acid in water (A) and acetonitrile (B) as mobile phase at a flow rate of 0.3 mL/min.
The 7.5 min UPLC gradient elution program was as follows: 0-0.70 min, 5-15% B; 0.7-2.5
min, 15-23% B; 2.5-2.8 min, 23-33% B, 2.8-4.0 min, 33-40% B; 4.0-4.8 min, 40-95% B; 4.8-
6.8 min, 95-95% B; 6.8-7.5 min, 95-5% B; equilibration time 1.5 min. The LC was interfaced
with hybrid linear ion trap triple-quadrupole mass spectrometer (API 4000 QTRAP™
MS/MS system from AB Sciex, Concord, ON, Canada) equipped with an electrospray (Turbo
V) ion source. AB Sciex Analyst software version 1.5.1 was used to control the LC-MS/MS
system and for data acquisition and processing. Precursor ion scan was used for the screening
and MRM acquisition mode for quantification of the analytes. All the analytes with internal
standard (IS) were detected in negative electrospray ionization and mass spectra were
recorded in the range of m/z 100-1000 at a cycle time of 9s with a step size of 0.1 Da.
Nitrogen was used as the nebulizer, heater, and curtain gas as well as the collision activated
dissociation gas (CAD). The optimized mass spectrometric source parameters were; ion spray
voltage set at -4200 V, curtain gas, nebulizer gas (GS1) and heater gas (GS2) were set at
20psi and source temperature was set at 550°C. The compound dependent MRM parameters:
DP, EP, CE and CXP were optimized for each investigated analyte by injecting the individual
standard solution into the mass spectrometer to achieve the most abundant, specific and stable
MRM transition.
The MS spectra generated for all the compounds by ESI-MS in the negative ion mode
gave the deprotonated molecule [M-H]-. The structures were further identified through
characteristic fragment ions. The detected compounds and their quantities were shown in
Table 1 and Figure 3. Among the 22 phenolic compounds, content of the biflavonoid GB-1
was the highest (22.1000 mg/g) in the leaf extract of G. imberti, followed by the xanthone
gambogic acid (2.8500 mg/g) and the biflavonoid GB-1a (2.4700 mg/g).
81
O OH O OH OH
O O
OH OCH3 OH O
OH OH OH
OH OH OCH3 OH
OH
OH OH OH
Protocatechuic acid Caffeic acid Ferulic acid Vanillic acid Epicatechin
OH OH
OH OH Glu
Glu
OH O OH O OH O
OH OH O
OH
Glu Glu
OH O OH O OH O
OH O
Isoorientin Orientin Isovitexin Vitexin

OH OH
OH OH OH OH
OH O OH O OH O
OH O
O-rutinosyl
OH
OH O
OH O OH O
OH O
Kaempferol-3-O-rutinoside Luteolin Quercetin Apigenin
OH OH
HO O HO O
OH
OH OH
OH O
OH O OH O
GluO O HO O
OH OH
OH O
OH
OH OH OH O
Kaempferol Fukugiside GB-1
OH O
OH OH
OH O HO O
OH O
OH OH OH
OH
OH O OH O
OH O HO O
OH OH OH O
OH
OH O OH OH
OH O
GB-2 GB-1a Amentoflavone
O
H O O
O O OH
HO
OCH3 O O O O
HO HO
HO O OH H
OH O
Mangostin Gambogic acid Garcinol
Figure 3. Structures of the 22 phenolic compounds detected in Garcinia imberti leaf methanol extract
by UHPLC-QqQLIT-MS/MS method
82
Table 1. The content (mg/g) of 22 phenolic compounds in the leaf extract of Garcinia imberti
Retention Compound Content (mg/g)
Time (min) (mean ± SD, n=3)
Phenolic acids
1.43 Protocatechuic acid 0.9890 ± 0.002
1.81 Caffeic acid 0.1420 ± 0.005
2.47 Ferulic acid 0.5220 ± 0.001
3.31 Vanillic acid 0.0008 ± 0.0002
Flavonoids
1.79 Epicatechin 0.9240 ± 0.001
1.91 Isoorientin 0.6070 ± 0.005
2.04 Orientin 0.5340 ± 0.004
2.26 Isovitexin 1.4100 ± 0.029
2.28 Vitexin 1.1800 ± 0.015
2.53 Kaempferol-3-O-rutinoside 0.0637 ± 0.0005
3.62 Luteolin 0.1053 ± 0.0004
3.63 Quercetin 0.1920 ± 0.026
4.04 Apigenin 0.7010 ± 0.027
4.14 Kaempferol 0.2820 ± 0.003
Biflavonoids
3.56 Fukugiside 0.2910 ± 0.002
3.57 GB-2 0.3850 ± 0.012
4.05 GB-1 22.1000 ± 1.054
4.46 GB-1a 2.4700 ± 0.165
4.52 Amentoflavone 0.0440 ± 0.003
Xanthones
5.71 -Mangostin 0.0056 ± 0.001
6.19 Gambogic acid 2.8500 ± 0.032
Benzophenone
6.50 Garcinol 0.3290 ± 0.011
5. Volatile chemical profile of Garcinia imberti

Hydrodistillation of the stem bark, leaves and fruits revealed G. imberti as a rich source of
essential oil. The oil yield was 0.62 % v/w for stem bark, 0.32% for leaf and 1.50% for fruits.
A total of 25 volatile compounds were detected by GC-MS analysis of the essential oils
(Table 2). The major constituents were humulene and -caryophyllene in stem bark and leaf
oil, while caryophyllene oxide and humulene epoxide were the major constituents in fruit oil
(Figure 4). The caryophyllene derivatives such as humulene, caryophyllene and their oxides
are biosynthetically derived from the common humulyl intermediate (Cane, 1999). The plant
can be considered as a rich source of the caryophyllene compounds. It will be interesting to
study the chemical ecological aspects of the high content of caryophyllene compounds in the
species.
O O
E-caryophyllene -Humulene Caryophyllene oxide Humulene epoxide II
Figure 4. Structures of major volatile chemicals of Garcinia imberti
83
Table 2. Volatile chemical profiles of Garcinia imberti leaf, stem bark and fruits
Compound RRI LF SB FR
-Elemene 1338 0.1 -- --
-Cubebene 1348 0.3 -- --
-Ylangene 1373 0.3 -- --
-Copaene 1376 0.4 -- 0.1
-Cubebene 1387 0.3 -- --
2-epi--funebrene 1415 -- -- 6.7
β-Funebrene 1414 -- -- 2.9
-Caryophyllene 1419 38.1 41.4 1.8
-Copaene 1430 0.4 3.7
-Humulene 1452 30.5 50.8 5.4
Allo aromadendrene 1458 5.5
α-Acoradiene 1464 0.3 -- --
9 epi E- Caryophyllene 1466 -- -- 8.7
β-Acoradiene 1469 4.5 -- --
cis β-Guaiene 1492 0.1 -- --
β-Alaskene 1498 2.5 -- --
E-γ-Bisabolene 1507 0.1 -- --
-Amorphene 1511 0.4 -- --
Germacrene B 1559 0.3 -- --
Caryophyllene oxide 1582 0.3 2.3 33.2
Humulene epoxide II 1608 -- 1.4 21.3
1,10-di epi Cubenol 1618 0.1 -- --
Caryophylla-4(12),8(13) diene 1639 -- -- 2.0
Cubenol 1645 0.1 -- --
14- Hydroxy 9-epi-E-caryophyllene 1668 -- -- 1.5
-Costol 1688 -- -- 3.3
Total % 84.6 95.9 90.6
Sesquiterpene- hydrocarbons 84.1 92.2 29.3
Sesquiterpene-oxygenated 0.5 3.7 61.3
Total sesquiterpenoids 84.6 97.9 92.6
RRI: Relative retention index calculated on HP-5 column
Conclusions
Garcinia species were studied worldwide for the variety of interesting secondary metabolites
and the present study revealed the Western Ghats endemic species G. imberti as a rich source
of the bioactive biflavonoids morelloflavone and GB-1, along with the triterpenoid friedelin.
The species is also a rich source of the volatile caryophyllene compounds. The chapter also
elaborates a comprehensive quantitative analysis of multi class bioactive constituents
including prenylated xanthones, polyisoprenylated benzophenones, biflavonoids, phenolic
acids and flavonoids in leaf methanol extract of G. imberti using UHPLC-QqQLIT-MS/MS
method.
84
References
1. Acuna UM, Dastmalchi K, Basile MJ and Kennelly EJ. 2012. Quantitative high-performance
liquid chromatography photo diode array (HPLC-PDA) analysis of benzophenones and
biflavonoids in eight Garcinia species. J. Food Comp. Anal., 25, 215-220.
2. Antonisamy P, Duraipandiyan V and Ignacimuthu S. 2011. Anti-inflammatory, analgesic and
antipyretic effects of friedelin isolated from Azima tetracantha Lam. in mouse and rat
models. J. Pharm. Pharmacol., 63 (8), 1070-1077.
3. Aravind SG, Arimboor R, Rangan M, Madhavan SN and Arumughan C. 2008. Semi-
preparative HPLC preparation and HPTLC quantification of tetrahydroamentoflavone as
marker in Semecarpus anacardium and its polyherbal formulations. J. Pharm. Biomed. Anal.,
48, 808-813.
4. Bourdillon TF. 1899. Descriptiones of some new or rare trees from Travancore. J. Bombay
Natural History Society, 12, 349-353.
5. Cane DE. 1999. Sesquiterpene biosynthesis: cyclization mechanisms. In: Cane DE. (Ed.),
Comprehensive Natural Products Chemistry: Isoprenoids Including Carotenoids and Steroids,
Vol. 2. Elsevier, Oxford, pp. 155-200.
6. Chaturvedula VSP, Gao Z, Jones SH, Feng X, Hecht SM and Kingston DGI. 2004. A new
ursane triterpene from Monochaetum vulcanicum that inhibits DNA polymerase lyase. J. Nat.
Prod., 67, 899-901.
7. Conolly JD and Hill RA. 1994. Dictionary of Natural Products, Chapman and Hall.
8. Elfita E, Muharni M, Latief M, Darwati D, Widiyantoro A, Supriyatna S, Bahti HH,
Dachriyanus D, Cos P, Maes L, Foubert K, Apers S and Pieters L. 2009. Antiplasmodial and
other constituents from four Indonesian Garcinia spp. Phytochemistry, 70(7), 907-912.
9. Han QB, Yang NY, Tian HL, Qiao CF, Song JZ, Chang DC, Chen SL, Luo KQ and Xu HX.
2008. Xanthones with growth inhibition against HeLa cells from Garcinia
xipshuanbannaensis. Phytochemistry, 69, 2187-2192.
10. Hemshekhar M. 2011. An overview on genus Garcinia: Phytochemical and therapeutical
aspects, Phytochem. Rev., 10, 325-351.
11. Jantan I and Saputri FC. 2012. Benzophenones and xanthones from Garcinia cantleyana var.
cantleyana and their inhibitory activities on human low-density lipoprotein oxidation and
platelet aggregation. Phytochemistry, 80, 58-63.
xanthones in Garcinia mangostana L. by LC-PDA and LC-ESI-MS. J. Pharm. Biomed.
Anal., 43, 1270-1276.
13. Karanjgaokar CG, Radhakrishnan PV and Venkataraman K. 1967. Morelloflavone, a 3-(8-)
flavonyl flavanone, from the heartwood of Garcinia morella. Tetrahedron Lett., 8, 3195-
3198.
14. Kim HP, Park H, Son KH, Chang HW and Kang SS. 2008. Biochemical pharmacology of
biflavonoids: Implications for anti-inflammatory action. Arch. Pharmacal Res., 31, 265-273.
15. Li XC, Joshi AS, Elsohly HN, Khan SI, Jacob MR, Zhang Z, Khan IA, Ferreira D, Walker
LA, Broedel SE, Raulli RE and Cihlar RL. 2002. Fatty acid synthase inhibitors from plants:
Isolation, structure elucidation and SAR studies. J. Nat. Prod., 65, 1909-1914.
16. Lin YM, Anderson H, Flavin MT and Pai YHS. 1997. In vitro anti-HIV of biflavonoids
isolated from Rhus succedanea and Garcinia multiflora. J. Nat. Prod., 60, 884-888.
85
17. Magadula JJ. 2010. A bioactive isoprenylated xanthone and other constituents of Garcinia
edulis. Fitoterapia, 81(5), 420-423.
18. Maheswari JK. 1964. Taxonomic studies on Indian Guttiferae III. The genus Garcinia Linn.
Bull. Bot. Surv. India, 6, 107-135.
19. Masuda T, Yamashita D, Takeda Y and Yonemori S. 2005. Screening for tyrosinase
inhibitors among extracts of seashore plants and identification of potent inhibitors from
Garcinia subelliptica. Biosc. Biotech. Biochem., 69, 197-201.
20. Mohanan N, Shaju T, Rajkumar G and Pandurangan AG. 1997. Rediscovery of Garcinia
imberti Bourd. (Clusiaceae)- A little known endemic species of Western Ghats. Indian J.
Forestry, 20, 383-385.
21. Moiteiro C, Curto M J M, Mohamed N, Bailen M , Martinez-Diaz R and Gonzalez-Coloma
A. 2006. Biovalorization of friedelane triterpenes derived from cork processing industry
byproducts. J. Agric. Food Chem., 54 (10), 3566-3571.
22. Ngouamegne ET, Fongang RS, Ngovela S, Boyom FF, Rohmer M, Tsamo E, Gut J and
Rosenthal PJ. 2008. Endodesmiadiol, a friedelane triterpenoid, and other antiplasmodial
compounds from Endodesmia calophylloides. Chem. Pharm. Bull., 56, 374-377.
23. Pang X, Yi T, Yi Z, Cho SG, Gu W, Pinkaew D, Fujise K and Liu M. 2009. Morelloflavone,
a biflavonoids inhibits tumor angiogenesis by targeting Rho GTPases and extracellular signal
regulated kinase signaling pathway. Cancer Res., 69, 518-525.
24. Pinkaew D, Cho SG, Hui DY, Wiktorowicz JE, Towatana NH, Mahabusarakam W,
Tonganunt M, Stafford LJ, Phongdara A, Liu M and Fujise K. 2009. Morelloflavone block
injury induced neointimal formation by inhibiting vascular smooth muscle cell migration.
Biochemica et Biophysica Acta., 1790, 31-39.
25. Rameshkumar KB, Shiburaj S and George V. 2005. Constituents and antibacterial activity of
the stem bark oil of Garcinia imberti. J. Trop. Med. Plants., 6, 271-273.
26. Reich E and Shibli A. 2006. High Performance Thin Layer Chromatography for the Analysis
of Medicinal Plants. Thieme Publishers, Germany.
27. Sabu T, Mohanan N, Krishnaraj MV, Shareef SM, Roy PE and Shameer PS. 2013. Garcinia
pushpangadanii, (Clusiaceae) a new species from southern Western Ghats, India. Phytotaxa,
116 (2), 51-56.
28. Sunil C, Duraipandiyan V, Ignacimuthu S and Al-Dhabi NA. 2013. Antioxidant, free radical
scavenging and liver protective effects of friedelin isolated from Azima tetracantha Lam.
leaves. Food Chem., 139 (1-4), 860-865.
29. Wu H, Guo J, Chen S, Liu X, Zhou Y, Zhang X and Xu X. 2013. Recent developments in
qualitative and quantitative analysis of phytochemical constituents and their metabolites
using liquid chromatography-mass spectrometry. J. Pharm. Biomed. Anal., 72, 267- 291.
30. Zhou Y, Lee S, Fung F, Choi K, Xu G, Liu X, Song JZ, Li SL, Qiao CF and Xu HX. 2010.
Qualitative and quantitative analysis of polycyclic polyprenylated acylphloroglucinols from
Garcinia species using ultra performance liquid chromatography coupled with electrospray
ionization quadrupole time-of-flight tandem mass spectrometry. Anal. Chim. Acta., 678, 96-
107.
86
Chapter 4
Phytochemical Investigation of the Western Ghats endemic species

Garcinia travancorica Bedd.
A. P. Anu Aravind 1, Renu Pandey2, Brijeshkumar2 and K. B. Rameshkumar1*
1
Phytochemistry and Phytopharmacology Division, Jawaharlal Nehru Tropical Botanic Garden and
Research Institute, Palode, Thiruvananthapuram- 695562, Kerala, India
2
Sophisticated Analytical Instrument Facility, CSIR-Central Drug Research Institute, Lucknow-
226031, Uttar Pradesh, India
*
Abstract
The leaves of Garcinia travancorica, an endemic species to the Western Ghats of south India,
yielded the polyisoprenylated benzophenones, 7-epi-nemorosone and garcinol along with the
biflavonoids GB-1a, GB-1, GB-2, morelloflavone and morelloflavone-7-O-β-D-glycoside
(fukugiside). G. travancorica leaves were found as a rich source of the biflavonoid glycoside
morelloflavone-7”-O-β-D-glycoside (7.12% dry wt) through a validated HPTLC estimation
method. Qualitative screening of multiclass secondary metabolites present in the fruits, leaves
and stem bark methanol extracts of G. travancorica using HPLC-QTOF-MS analysis resulted
in the identification of 23 compounds including two acids (hydroxycitric acid and
hydroxycitric acid lactone), eight biflavonoids (morelloflavone, GB-1, GB-1a, GB-2, GB-2a,
fukugiside, xanthochymusside and GB-1a glucoside), nine xanthones (α-mangostin, γ-
mangostin, 1,5-dihydroxy-3-methoxyxanthone, garciniaxanthone E, 4-(1,1-dimethylprop-2-
enyl)-1,3,5,8-tetrahydroxy-xanthone, garcinone A, garcinone B, garcinone C and
polyanxanthone C) and four polyisoprenylated benzophenones (gambogenone, aristophenone
A, garcinol and garciyunnanin A). G. travancorica was also found as a rich source of
essential oils and the aliphatic hydrocarbon n-undecane was the major volatile compound in
leaf, stem bark and fruit.
Keywords: Garcinia travancorica, fukugiside, n-Undecane, Essential oil, Biflavonoids,

Xanthones, Benzophenones, HPLC-QTOF-MS
Introduction
Garcinia species, with its rich diversity of biologically active compounds such as
biflavonoids, xanthones, benzophenones and acids, received considerable attention
worldwide from scientific as well as industrial sectors (Hemshekhar et al., 2011). Xanthones,
biflavonoids and benzophenones from different Garcinia species were reported to possess
remarkable levels of bioactivities against various ailments (Carvalho-Silva et al. 2012; Osorio
et al. 2013). Among the different phenolic compounds reported from Garcinia species, the
biological activities of biflavonoids are diverse, including anticancer, antibacterial,
antifungal, antiviral, anti-inflammatory, analgesic, antioxidant, vasorelaxant and anticlotting.
The mechanisms of activity of biflavonoids have also been elaborated in most of the cases
87
(Kim et al. 2008). Garcinia travancorica is a rare and endemic species, distributed in the
evergreen forests of Agastyamala region of southern Western Ghats of India, where scattered
populations were seen at altitude 1000-1300m (Mohanan and Sivadasan, 2002) (Figure 1).
The species is least investigated for their phytochemicals (Anuaravind et al., 2016) and the
present chapter reports the secondary metabolite profile of G. travancorica.
Figure 1. Garcinia travancorica twig with flower and fruit
1. Phytochemical investigation of the leaves of G. travancorica

Fresh leaves were collected from Chemunji forest area, part of the Agasthyamala forest
region of South Western Ghats, Thiruvananthapuram district, Kerala, India and a voucher
specimen (No. 66417) was deposited at the JNTBGRI Herbarium (TBGT).
UV spectra were recorded on a Shimadzu spectrophotometer -UV 1800, Japan. IR
spectra were taken with Alpha FT-IR, Bruker Optics. 1H and 13C NMR spectra were recorded
on a Bruker-Avance 400 MHz FT-NMR spectrometer operating at 400 MHz for 1H NMR and
100MHz for 13C NMR. The chemical shifts were expressed as δ (ppm, parts per million)
referring to internal standard, tetramethyl- silane (Me4Si). Mass spectra were recorded using
JEOL JMS 600 H mass spectrometer.
The polyisoprenylated benzophenones, 7-epi-nemorosone (1) and garcinol (2) were
isolated from the hexane extract by column chromatography. Structures of these compounds
were confirmed by UV, IR and NMR spectroscopic data, together with comparison of
literature data (Rao et al. 1980; Padhye et al. 2009; de Castro et al. 2011). The bioactive
benzophenone garcinol, also known as camboginol, was reported from different Garcinia
species and showed antiglycation, antioxidant and free radical scavenging activities (Sahu et
al. 1989; Rastogi & Mehrotra 1990; Yamaguchi et al. 2000; de Souza Marques et al. 2012).
The biflavonoids, namely GB-1a (3), GB-1 (4), GB-2 (5), morelloflavone (6) and
morelloflavone-7”-O-β-D-glycoside or fukugiside (7) were isolated from the methanol
extract by column chromatography (Figure 2). Structures of these compounds were
elucidated by NMR, MS and comparison with the literature spectroscopic data (Kapadia et al.
88
1994; Elfita et al. 2009). The (3˗˃8”) linked biflavonoids isolated from G. travancorica can
be generally divided into two groups; those made up of flavone and flavanone subunits and
those made up of two flavanone units. GB-1a, GB-1 and GB-2 were biflavanones, while
morelloflavone and morelloflavone-7”-O-β-D-glycoside were flavanone-flavone type
biflavonoids. Of the two types, biflavonones were the dominant type in different Garcinia
species, while the co-occurrence of the two types of biflavonoids is rare (Waterman and
Hussain 1983).
7-epi-Nemorosone (1): Yellow liquid; TLC: Hexane-ethylacetate (9:1), Rf = 0.76; UV

(CH3Cl, 0.1%) λmax/nm: 281, 265. HRMS m/z-501.3018 (M-H)- for C33H41O4 (calcd.
501.3005); MSn experiment m/z-501.3, 432.2, 417.2, 363.2, 309.1, 242.0, 145.0. 1H NMR
(CDCl3, 400 MHz, δ ppm): δ 2.09 (H-6a, m); 2.11 (H-6b, m); 1.52 (H-7, m); 7.55 (H-12, dd,
J= 7.6 and 1); 7.38 (H-13, t, J = 7.6); 7.39 (H-14, t, J= 7.6); 7.37 (H- 15, t, J = 7.6); 7.54 (H-
16, d, J = 7.6); 2.72 (H-17a, overlapped); 2.72 (H-17b, overlapped); 5.01 (H-18, m); 1.70
(3H, s,CH3 = 20); 1.70 (3H, s,CH3 = 21); 2.54 (H-22a, m); 2.55 (H- 22b, m); 5.04 (H-23, m);
1.54 (3H, s, CH3-25); 1.99 (H-27a, m); 2.16 (H-27b, m); 4.90 (H-28, m); 1.60 (3H,
overlapped, CH3-30); 1.64 (3H, overlapped, CH3-31); 1.51 (3H, s, CH3-32); 1.25 (3H, s,
CH3-33). 13C NMR (100 MHz, δ ppm ): δ 73.0 (C1); 192.6 (C2); 120.4 (C3); 193.9 (C4);
64.6 (C5); 41.5 (C6); 47.6 (C7); 48.6 (C8); 207.5 (C9); 197.5 (C10); 137.3 (C-11); 128.9 (C-
12), 127.8 (C-13); 132.5 (C-14); 127.7 (C-15); 128.8 (C-16); 23.7 (C-17); 120.4 (C-18);
134.5 (C-19); 17.9 (C-20); 25.8 (C-21); 30.2 (C-22); 119.9 (C-23); 133.3 (C- 24); 18.1 (C-
25); 25.6 (C-26); 29.7 (C-27); 123.3 (C-28); 132.5 (C- 29); 18.1 (C-30); 26.1 (C-31); 26.7 (C-
32); 23.7 (C-33).
Garcinol (2): Pale yellow crystal; TLC solvent system: hexane-chloroform (7:3); Rf = 0.27;
UV (CH3Cl, 0.1%) λmax (nm) 306, 244. IR 3200-3500, 1727, 1562 cm-1, HR-MS m/z:
603.3681 (M+H)+ for C38H51O6 (calcd. 603.3686); MSn experiment m/z: 603.3, 467.2, 411.1,
343.1, 287.0, 233.0, 177.0, 137.1, 95.0; 1H NMR (400 MHz, CD3OD): δ 7.05, 6.71, 6.69 (d;
J=8 Hz, aromatic protons) 4.9 1.58 1.68 (isopropylidine groups) 4.51 (isopropenyl group),
1.68 (Me), 0.97 and 1.17 (methyl groups) to 1.4 to 2.7 (methylene and methane). 13C NMR
spectrum of garcinol showed the presence of three methine carbons of trisubstituted olefinic
groups at δ 124.4, 124.6 and 122.6 and at δ 112.0 for a terminal methylene carbon. Other
assignments were δ 206.2 (C-9, C=O), 194.0 (C-2, C=O), 195.1 (C-4, C-OH), 199.0 (C-15,
C=O); 131.5 (C-12, CMe2), 132.3 (C-34, CMe2), 134.0 (C-26, CMe2); 149.8 (C-28, C (Me)
=CH2), δ 116.6 (C-17, Ar-CH), 149.8 (C-20, Ar-CH), 122.5 (C-21, Ar-CH); 145.2 (C-18, Ar-
C-OH), 132.5 (C-19, Ar-C-OH); 126.3 (C-16, Ar-C-C=O); 116.9 (C-3), 68.6 (C-1), 48.8 (C-
8), 47.9 (C-7), 59.9 (C-5), 43.0 (C-6, 23); 26.8, 27.4, 32.9, 37.4, 43.0 ( 5 CH2); 18.1, 18.3,
18.7, 25.9, 26.3 (6 Me, C=CMe); 23.3 (C(Me)=CH2); 17.6 and 26.7 (ring CMe2).
GB-1a (3): Yellow crystalline solid; TLC solvent system: Hexane-ethyl acetate (3:7); Rf =
0.37; UV (CH3OH, 0.1%) λmax/nm: 289, 207. IR: 3227, 1598, 1515, 1158, 1084, 830 cm-1.
HR-MS m/z: 543.1264 (M+H) + for C30H23O10 (calcd. 543.1291); MSn experiment m/z: 541.1,
447.0, 415.0, 389.1, 179.3. 1H NMR (CD3OD, 400 MHz, δ-ppm): δ 5.42 (1H, d, J=11.2 Hz,
H-2), 5.2 (1H, d, J=12 Hz, H-3), 5.91 (1H, d, J= 2 Hz, H-6), 5.72 (1H, d, J=2 Hz, H-8), 7.05
89
(2H, d, J=8.4 Hz, H-2’,6’), 6.61 (2H, d, J=8.4 Hz, H-3’,5’), 5.32 (1H, d, J=12 Hz, H-2’’),
2.67 (2H, m, H-3’’), 5.76 (1H, s, H-6’’), 7.07 (2H, d, J=8.4 Hz, H-2’’’,6’’’), 6.62 (2H, d,
J=8.4 Hz, H-3’’’,5’’’). 13C NMR: δ 80.5 (C-2), 48.4 (C-3), 197.0 (C-4), 163.0 (C-5), 96.6 (C-
6), 164.8 (C-7), 96.2 (C-8), 165.6 (C-9), 103.2 (C-10), 129.0 (C-1’), 127.9 (C-2’/6’), 115.7
(C-3’/5’), 158.7 (C-4’), 83.7 (C-2’’), 44.0 (C-3’’), 197.0 (C-4’’), 164.8 (C-5’’), 97.3 (C-6’’),
168 (C-7’’), 102.3 (C-8), 165.6 (C-9), 102.3 (C-10’’), 83.7 (C-1’’’), 129.8 (C-2’’’/6’’’), 116.3
(C-3’’’/5’’’), 158.7 (C-4’’’).
GB-1 (4): Yellow crystalline solid; TLC solvent system: Hexane-ethyl acetate (3:7); Rf =
0.48; UV (CH3OH, 0.1%) λmax/nm: 290, 211. IR: 3200, 1595, 1515, 1155, 1083, 828 cm-1.
HR-MS m/z: 559.1221 [M + H] + for C30H23O11 (Calcd. 559.1240) and 581.1043 [M + Na] +;
MSn experiment (M - H)- m/z: 557.1, 431.0, 285.0. 1H NMR (CD3OD, 400 MHz, δ-ppm): δ
5.66 (1H, d, J=12 Hz, H-2), 3.31 (1H, s, H-3), 5.90 (1H, d, J=2 Hz, H-6), 5.97 (1H, m, H-8),
7.15 (2H, d, J=8 Hz, H-2’,6’), 6.61 (2H, d, J=8 Hz, H-3’,5’), 4.50 (1H, m, H-2’’), 4.07 (2H,
m, H-3’’), 6.04 (1H, s, H-6’’), 7.17 (2H, d, J=8 Hz, H-2’’’,6’’’), 6.67 (2H, m, H-3’’’,5’’’).
13
C NMR (100 MHz, δ-ppm): δ 79.5 (C-2), 49.1 (C-3), 196.0 (C-4), 164.9 (C-5), 97.2 (C-6),
165.1 (C-7), 98.4 (C-8), 105.7 (C-9), 103.2 (C-10), 129.4 (C-1’), 124.0 (C-2’/6’), 115.7 (C-
3’/5’), 158.7 (C-4’), 82.8 (C-2’’), 71.0 (C-3’’), 196.0 (C-4’’), 165.7 (C-5’’), 98.9 (C-6’’),
165.8 (C-7’’), 102.0 (C-8’’), 168.8 (C-9’’), 103.3 (C-10’’), 129.9 (C-1’’’), 129.9 (C-
2’’’/6’’’), 116.1 (C-3’’’/5’’’), 158.7 (C-4’’’).
GB-2 (5): Yellow crystalline solid; TLC solvent system: Hexane-ethyl acetate (3:7); Rf =
0.62; UV (CH3OH, 0.1%) λmax/nm: 291, 207. IR: 3226, 1736, 1633, 1516, 1159, 1083, 830
cm-1. HR-MS m/z: 575.1175 (M + H)+ for C30H23O12 (cald. 575.1189) and 597.0993 (M +
Na) +; MSn experiment (M-H)- m/z: 573.1, 447.8, 447.0, 268.6. 1H NMR (DMSO-d6, 400
MHz, δ-ppm): δ 5.35 (1H, d, J=12 Hz, H-2), 4.48 (1H, d, J=12 Hz, H-3), 5.89 (1H, d, J=2 Hz,
H-6), 5.77 (1H, d, J=2, H-8), 7.11 (2H, d, J=2 Hz, H-2’,6’), 6.65 (2H, d, J=8 Hz, H-3’,5’),
12.14 (1H, s, Chelated OH), 4.67 (1H, d, J=12, H-2’’), 3.97 (2H, d, J=11, H-3’’), 5.93 (1H, s,
H-6’’), 6.85 (1H, s, H-2’’’), 6.81 (2H, d, J=8, H-5’’’), 6.79 (1H, d, J=8, H-6’’’), 11.7 (1H, s,
Chelated OH). 13C NMR (100 MHz, δ-ppm): δ 79.1 (C-2), 47.0 (C-3), 196.4 (C-4), 160.1 (C-
5), 94.9 (C-6), 160.7 (C-7), 96.0 (C-8), 162.7 (C-9), 100.9 (C-10), 127.8 (C-1’), 128.0 (C-
2’/6’), 115.3 (C-3’/5’), 157.7 (C-4’), 82.7 (C-2’’), 71.9 (C-3’’), 197.5 (C-4’’), 162.0(C-5’’),
96.0 (C-6’’), 166.3 (C-7’’), 101.2 (C-8’’), 163.5 (C-9’’), 106.0 (C-10’’), 127.8 (C-1’’’), 118.4
(C-2’’’/5’’’), 144.9 (C-3’’’), 145.0 (C-4’’’), 128.2 (C-6’’’).
Morelloflavone (6): Yellow crystalline solid; TLC solvent system: Ethyl acetate (100%); Rf
= 0.47; UV (CH3OH, 0.1%) λmax/nm: 376, 288. IR: 3348, 1557, 1410, 1269, 1167, 619 cm-1.
1
H NMR (CD3OD, 400 MHz, δ-ppm): δ 5.35 (1H, d, J=12 Hz, H-2), 4.48 (1H, d, J=12 Hz, H-
3), 5.89 (1H, d, J=2 Hz, H-6), 5.77 (1H, d, J=2, H-8), 7.11 (2H, d, J=2 Hz, H-2’,6’), 6.65 (2H,
d, J=8 Hz, H-3’,5’), 4.67 (1H, d, J=12, H-2’’), 3.97 (2H, d, J=11, H-3’’), 5.93 (1H, s, H-6’’),
6.85 (1H, s, H-2’’’), 6.81 (2H, d, J=8, H-5’’’), 6.79 (1H, d, J=8, H-6’’’). 13C NMR (100
MHz, δ-ppm): δ 80.9 (C-2), 49.9 (C-3), 196.3 (C-4), 163.7 (C-5), 96.2 (C-6), 166.4 (C-7),
95.2 (C-8), 162.1 (C-9), 101.5 (C-10), 128.0 (C-1’), 128.4 (C-2’), 114.4 (C-3’), 157.2 (C-4’),
114.4 (C-5’), 128.4 (C-6’), 162.8 (C-2’’), 102.4 (C-3’’), 179.5 (C-4’’), 159.7 (C-5’’), 97.9
90
(C-6’’), 161.3 (C-7’’), 100.0 (C-8’’), 154.0 (C-9’’), 103.0 (C-10’’), 121.6 (C-1’’’), 114.6 (C-
2’’’), 145 (C-3’’’), 147.6 (C-4’’’), 116.2 (C-5’’’), 120.3 (C-6’’’).
Morelloflavone-7’’-O-β-D-glycoside (7): Yellow crystalline solid; TLC solvent system:

Ethyl acetate-methanol (8:2); Rf = 0.57; α29 D + 46.49 (c. 1% CH3OH), UV (CH3OH, 0.1%)
λmax/nm: 377, 288. IR: 3252, 1738, 1593, 1364, 1069, 1083, 824 cm-1. HR-MS m/z:
717.1446 (M-H) - for C36H31O16 (calcd. 717.1461); MSn experiment (M-H) - m/z: 717.1,
555.0, 403.55. 1H NMR (DMSO-d6, 400 MHz, δ-ppm): δ 5.80 (1H, d, J=12 Hz, H-2), 4.91
(1H, d, J=12 Hz, H-3), 5.94 (1H, d, J=4.6 Hz, H-6), 5.96 (1H, d, J=4, H-8), 7.17 (2H, d, J=8.4
Hz, H-2’,6’), 6.53 (2H, d, J=8.4 Hz, H-3’,5’), 12.65 (1OH, s, OH-5) 6.47 (1H, s, H-3’’), 6.73
(2H, s, H-3’’), 7.25 (1H, s, H-2’’’), 6.93(1H, d, J=8.4, H-5’’’), 7.59 (1H, d, J=8, H-6’’’), 5.15
(1H, d, J=8, H-1’’’’), 3.3-3.8 (5H, m, H-2’’’’,3’’’’,4’’’’,5’’’’,6’’’’), 12.08 (1OH, s, OH-5’’).
13
C NMR (100 MHz, δ-ppm): δ 82.5 (C-2), 50.7 (C-3), 195.0 (C-4), 164.5 (C-5), 96.5 (C-6),
165.7 (C-7), 97.7 (C-8), 167.0 (C-9), 103.5 (C-10), 130.3 (C-1’), 129.6 (C-2’/6’), 115.5 (C-
3’/5’), 158.0 (C-4’), 165.8 (C-2’’), 103.5 (C-3’’), 182.0 (C-4’’), 162.0 (C-5’’), 100.0 (C-6’’),
161.2 (C-7’’), 103.5 (C-8’’), 155.0 (C-9’’), 106.4 (C-10’’), 123.7(C-1’’’), 114.9 (C-2’’’),
146.0 (C-3’’’), 152.5 (C-4’’’), 114.9 (C-5’’’), 120.6 (C-6’’’), 101.6 (C-1’’’’), 76.1 (C-2’’’’),
77.5 (C-3’’’’), 69.6 (C-4’’’’), 79.1 (C-5’’’’), 60.9 (C-6’’’’).
Figure 2. Structures of compounds 1 to 7
1.2. GC-MS analysis of low polar fraction of hexane extract

Column chromatographic separation of hexane extract of the leaves of G. travancorica using
100% hexane yielded a waxy white semi-solid. TLC of the fraction in reverse phase plates
using 100% methanol as the solvent system revealed that the fraction was mixture of several
91
compounds with very close Rf values. GC-MS analysis revealed n-heptacosane (C27H56), a
saturated hydrocarbon, as the major constituent of the waxy solid isolated from the leaves of
G. travancorica.
The role of hydrocarbons is to prevent desiccation and to act as agents in chemical
communications. n-Heptacosane is found in the epi-cuticular wax layer of different insects
and is the major male courtship pheromeone of Colias eurytheme (Sappington and Taylor,
1990). It has been reported that the cuticular hydrocarbons in social insects signal the
reproductive status of an individual and n-heptacosane has been identified as the major
hydrocarbon on the wax coat of the mated queen of the ants Ectatomma tuberculatum (Hora
et al., 2008).
2. HPTLC estimation of GB-2 and morelloflavone-7’’-O-β-D-glycoside

HPTLC estimation of the biflavonoids, GB-2 and morelloflavone-7’’-O-β-D-glycoside in the
leaves of G. travancorica were carried out using CAMAG HPTLC system, using the mobile
phase of 70% ethyl acetate in hexane (v/v). GB-2 gave Rf value of 0.30 and chromatogram of
the compound was recorded at 288 nm. Standard GB-2 in the range 0.2 to 1.0 µg per band
showed good linear response with correlation coefficient 0.983. The content of GB-2 was
0.91% (dry wt.).
Morelloflavone-7’’-O-β-D-glycoside in the leaves was estimated using ethylacetate-
methanol-formic acid (80:17.5:2.5 v/v) solvent system (Rf value 0.35). Development of the
plates in this mobile phase resulted in sharp, symmetric and well resolved peaks (Figure 3).
The HPTLC chromatogram of the compound was recorded in the visible range at 580 nm.
Peak area and concentration were subjected to linear regression analysis to calculate the
calibration equation and correlation coefficients. Morelloflavone-7’’-O-β-D-glycoside in the
range 0.5 to 1.5 µg per band gave linear response and the correlation coefficient 0.982
indicated a good linear relationship between peak area and concentration of standard. The
content of morelloflavone-7’’-O-β-D-glycoside was 7.12% (dry wt.).
Figure 3. HPTLC densitogram of morelloflavone-7’’-O-β-D-glycoside: A- UV (254 nm), B: Visible

(580 nm), C: 3D Graph
3. HPLC-QTOF-MS Analysis of G. travancorica leaves, stem bark and fruits

Isolation, purification and structural elucidation of compounds, using conventional methods,
from complex mixtures of natural origin are quite expensive in terms of time consumption
92
and labour (Shu, 1998; Konishi et al., 2007). The introduction of hyphenated analytical
techniques provided natural product researchers extremely powerful tools that provided both
the separation and characterisation in single run (Phonde and Magdum, 2015). Among the
different hyphenated analytical techniques, liquid chromatography-mass spectrometric
techniques became an important tool in phytochemical analysis for the rapid identification of
secondary metabolites (Rosenberg, 2003). LC-MS is a powerful technique for identifying
nontarget components where LC fractionate complex extracts with good resolution,
sensitivity and reproducibility and MS techniques generate mass spectra with greater
accuracy and precision (Shen et al., 2005; Konishi et al., 2007). G. travancorica fruits, leaves
and stem bark were subjected to HPLC-QTOF-MS analysis for the identification of
secondary metabolites present.
LC-MS analysis was carried out using Agilent 1200 HPLC (Agilent technologies,
USA) coupled with an Agilent 6520 QTOF-MS/MS system via an electrospray ionisation
interface (ESI). Agilent 1200 HPLC system consists of thermo stated column compartment
(G1316C) and diode-array detector (G1315D). The HPLC separation was carried out on a
Supelco Ascentis Express C18 column (10 cm × 2.1 mm, 2.7 µm) operated at 25°C. The
mobile phase, consisted of 0.1 % formic acid aqueous solution (A) and acetonitrile (B), was
delivered at a flow rate of 0.3 mL/min under the gradient program: 0-30 % (B) from 0 min to
5 min, 30-55 % (B) from 5 min to 10 min, 55-60 % (B) from 10 min to 15 min, 60-70 % (B)
from 15 min to 20 min, 70-80 % (B) from 20 min to 25 min, 80-85 % (B) from 25 min to 30
min, 85-95 % (B) from 30 min to 40 min, and return to initial condition over 5 min. The
sample injection volume was 5 µl.
In the ESI source, nitrogen was used as drying and collision gas. The heated capillary
temperature was set at 320°C and nebulizer pressure at 40 psi. The drying gas flow rate was
10 lit/min. VCap, fragmentor, skimmer and octapole RF peak voltages were set at 3500V,
150V, 65V and 750V respectively in the ion source. Detection was carried out in negative ion
mode within a mass range of m/z 100-1500 and resolving power above 15000 (FWHM). The
data analyses were performed using Mass Hunter software version B.04.00 build 4.0.479.0
(Agilent Technology, USA).
Figure 4. HPLC-QTOF-MS Base peak chromatograms of fruit, leaf, stem bark and mix reference
standards of G. travancorica. (GTF; fruit, GT-STD; mix reference standards, GTL; leaf, GTS; stem
bark)
93
A total of 23 compounds were identified by comparing retention times, MS spectra with

available standards (hydroxycitric acid, fukugiside, α-mangostin, GB-1a, GB-1 and GB-2),
HRMS of (M-H)- and fragmentation patterns (Table1, Figure 4, Figure 5). The proposed
HPLC-QTOF-MS/MS method for the qualitative analysis is rapid, sensitive and efficient for
simultaneous determination of acids, prenylated xanthones, benzophenoes and biflavonoids
present in the plant species.
Hydroxycitric acid and its derivative hydroxycitric acid lactone (garcinia acid) were
the two acids identified in fruits, leaves and stem bark of G. travancorica. Hydroxycitric acid
is an antiobesity agent and the distribution of the compound is reported from many Garcinia
species including G. indica, G. cambogia, G. atrovirdis and G. cowa. (Majeed et al., 1994;
Kumar et al., 2013).
Morelloflavone, GB-1a, GB-1, GB-2 and GB-2a were the biflavonoids and fukugiside
(morelloflavone-7’’-O-β-D-glycoside), xanthochymusside, GB-1a glucoside were the
biflavonoid glycosides identified from the plant. These compounds were distributed in all the
plant parts studied.
Xanthones identified from the fruits were α-mangostin, γ-mangostin, 1,5-dihydroxy-3-
methoxyxanthone, 4-(1, 1 – dimethylprop – 2 – enyl) -1, 3, 5, 8 – tetrahydroxy - xanthone,
garciniaxanthone E, garcinone A, garcinone B, garcinone C and polyanxanthone C, while γ-
mangostin and garcinone A were the xanthones identified from the leaves. γ-Mangostin,
garcinone A, 1,5-dihydroxy-3-methoxy xanthone, garcinone B and garcinone C were present
in the stem bark. Xanthones were especially noted for their potential antitumour and
chemopreventive abilities along with other biological activities such as antibacterial,
antifungal, antiviral, antioxidant and anti-inflammatory (Chin and Kinghorn 2008; Peres et al.
2000).
The benzophenones identified from the fruits were gambogenone, aristophenone A,

garcinol and garciyunnanin A. Aristophenone A and garcinol were present in the leaves,
while none of the benzophenones were detected in the stem bark of G. travancorica.
Garciyunnanin A with 3-monohydroxy benzophenone skeleton is rarely distributed in
Garcinia species (Xu et al., 2008). Most of the benzophenones reported from Garcinia
species were polyisoprenylated structural group and exhibited wide spectrum of biological
activities like antifungal, anti-HIV, antimicrobial, antioxidant, antiviral and cytotoxic (Kumar
et al., 2007; Williams et al., 2003; Diaz-Carballo et al., 2012).
The study reports the chemical finger printing of G. travancorica leaves, stem bark
and fruits using the hyphenated MS techniques. HPLC-QTOF-MS method was optimized and
established for selective, reliable and simultaneous determination of 23 multiclass chemical
constituents including acids, benzophenones, biflavonoids and xanthones present in the plant
species.
94
Table 1. Identification of compounds from Garcinia travancorica by HPLC-QTOF-MS analysis

Sl. RT Molecular HRMS, [M-H]- Error Fruit Leaf Stem
No. (min) Formula m/z, calc. Obs. (∆ppm) Compound bark
1 1.1 C6H6O7 189.0041 189.0042 -0.55 Hydroxycitric acid P P P
lactone
2 1.2 C36H30O16 717.1461 717.1468 -0.92 Fukugiside P P P
3 1.3 C36H32O17 735.1567 735.1564 0.32 Xanthochymusside P P P
4 1.5 C6H8O8 207.0146 207.0147 -0.32 Hydroxycitric acid P P P
5 1.5 C30H22O11 557.1089 557.1090 -0.12 GB-2a P P P
6 1.8 C30H20O11 555.0933 555.0933 0.1 Morelloflavone P N P
7 2.1 C3OH22O12 573.1038 573.1039 -0.15 GB-2 P P P
8 2.3 C36H32O15 703.1668 703.1666 0.44 GB-1a glucoside P P P
9 2.5 C30H22O11 557.1089 557.1090 -0.15 GB-1 P P P
10 5.5 C3OH22O10 541.1140 541.1143 0.52 GB-1a P P P
11 7 C24H2606 409.1657 409.1663 -1.16 α-Mangostin P N N
12 8 C14H10O5 257.0455 257.0451 1.62 1,5-Dihydroxy-3- P N P
methoxyxanthone
13 8.3 C18 H16O6 327.0874 327.0876 -0.59 4-(1,1-Dimethylprop- P N N
2-enyl)-1,3,5,8-
tetrahydroxy-
xanthone
14 11.2 C27H32O6 451.2126 451.2130 -0.95 Gambogenone P N N
15 13.4 C23H26O7 413.1606 413.1605 0.39 Garcinone C P N P
16 16 C23H24O6 395.1500 395.1502 -0.6 γ-Mangostin P P P
17 17.9 C28H32O6 463.2126 463.2128 -1.15 Garciniaxanthone E P N N
18 19.9 C23H2206 393.1344 393.1345 -0.45 Garcinone B P N P
19 20.4 C23H2405 379.1551 379.1553 -0.46 Garcinone A P P P
20 20.7 C33H42O6 533.2909 533.2901 1.49 Aristophenone A P P N
21 30.5 C28H32O4 431.2228 431.2235 -1.72 Polyanxanthone C P N N
22 35.1 C38H50O6 601.3535 601.3539 -0.69 Garcinol P P N
23 38.4 C38H50O5 585.3585 585.3582 0.6 Garciyunnanin A P N N
P: present, N: not present
4. Volatile chemical profile of Garcinia travancorica

Hydrodistillation revealed G. travancorica as rich source of essential oils with yield of
0.70%, 0.60% and 1.50% v/w respectively for leaf, stem bark and fruit. In total, 23
components were identified from the oils (Table 2). Fifteen components comprising 96.1%
of the leaf oil were identified. The major components in the leaf oil were n-undecane (44.0%)
followed by α-copaene (15.8%) and -amorphene (7.0%). Fifteen components comprising
95.0% of the stem bark oil were identified and n-undecane (39.0%) was the major constituent
followed by -alaskene (9.4%) and α-himachalene (6.4%). Fourteen components comprising
92.9% of fruit essential oil were identified where n-undecane (58.2%) was the major volatile
constituent, followed by α-copaene (8.2%) and -cadinene (6.7%). α-Copaene and α-
himachalene were the common sesquiterpene constituents in the oils.
95
Figure 5. Structures of compounds identified from Garcinia travancorica by HPLC-QTOF-MS/MS

analysis
96
Identification of the major compound n-undecane was further confirmed by the presence of
their characteristic 13C NMR signals in the 13C NMR spectra of the oil (Formacek and
Kubeczka, 2002) (Table 3, Figure 6, Figure 7). High content of the hydrocarbon n-
undecane, with gasoline type odour, may possibly contribute to the characteristic smell of the
plant. n-Undecane predominantly present in all the three oil samples. High quantity of n-
undecane in the plant parts may play a key role in pollination as the compound was reported
to possess pheromone type character which attracts the flies, moths and ants (Schiestl, 2000).
Table 2. Composition of the leaf, stem bark and fruit essential oils of Garcinia travancorica
Compound RRI Leaf Stem Fruit
Bark
Z-β-Ocimene 1037 ng 2.6 ng
n-Undecane 1100 40.1 39.0 58.2
-Ylangene 1373 1.0 ng 1.4
α-Copaene 1374 15.8 4.1 8.2
-Funebrene 1414 3.3 - 1.8
-Caryophyllene 1419 4.0 - 1.2
α-Funebrene 1402 - 3.9
-Trans bergamotene 1434 1.8 7.4 1.0
α-Himachalene 1449 3.1 6.4 1.9
Amorpha-4,11-diene 1451 2.2 4.1 1.5
α-Humulene 1452 0.1
Cis cadina-1(6),4- diene 1461 2.4 2.9 -
Trans cadina-1(6),4- diene 1476 1.0 - -
-Acoradiene 1469 - 3.4
ar-Curcumene 1481 - 2.3 1.6
-Himachalene 1482 2.3 - -
-Alaskene 1498 3.8 9.4 2.7
Epizonarene 1501 - 4.0 -
-Cadinene 1513 - - 6.7
-Bisabolene 1505 - 1.2 -
Amorphene 1512 7.0 - -
-Curcumene 1514 - 4.3 -
-Cadinene 1522 4.5 - 4.2
1-Epi-cubenol 1627 - - 2.5
Total identified 92.4 95.0 92.9
Monoterpene hydrocarbons (%) ng 2.6% ng
Oxygenated monoterpenes (%) - - -
Sesquiterpene hydrocarbons (%) 52.1% 53.4% 34.7%
Oxygenated sesquiterpenes (%) - - -
Aliphatic hydrocarbons 40.1% 39.0% 58.2%
ng: Negligible (<0.1%); RRI: Relative retention index calculated on HP-5 column
b d e d b
H3C CH3
a c e e c a
Figure 6. Structure of n-undecane
97
Table 3. NMR spectroscopic data of n- undecane (CDCl3, δ in ppm)

Carbon Atom δC δH
a 14.13 0.90
b 22.71 1.30
c 31.94 1.26
d 29.63 0.90
e 29.67 0.90
Figure 7. 13C NMR of essential oils and n- undecane: A- Leaf oil, B- Stem bark oil, C-Fruit oil and
D- n-undecane
Conclusions
Seven phenolic compounds including two polyisoprenylated benzophenones and five
biflavonoids were isolated and characterised from G. travancorica leaves. The study
highlights the plant as a rich source of the biflavonoid morelloflavone-7”-O-β-D-glycoside.
HPLC-QTOF-MS method was optimized and established for selective, reliable and
simultaneous determination of 23 multiclass chemical constituents including two acids, four
benzophenones, seven biflavonoids and nine xanthones from G. travancorica fruits, leaves
and stem bark. The essential oil composition of the leaves, stem bark and fruit of G.
travancorica revealed the plant as a rich source of essential oils and the oils were
predominated by the presence of aliphatic hydrocarbon n- undecane.
References
1. A. P. Anu Aravind, K. R. T. Asha and K. B. Rameshkumar. 2016. Phytochemical analysis
and antioxidant potential of the leaves of Garcinia travancorica Bedd. Nat. Prod. Res., 30 (2).
232-236.
2. Carvalho-Silva LB, do Vale Oliveira M, GontijoVS, Oliveira WF, Priscilla BMC, Derogis
PBMC, Stringheta PC, Nagem TJ, Brigagao MRPL and dos Santos MH. 2012. Antioxidant,
cytotoxic and antimutagenic activities of 7-epi-clusianone obtained from pericarp of Garcinia
brasiliensis. Food Res. Int., 48: 180-186.
98
3. Chin YW and Kinghorn AD. 2008. Structural characterization, biological effects, and
synthetic studies on xanthones from mangosteen (Garcinia mangostana), a popular botanical
dietary supplement. Mini. Rev. Org. Chem., 5(4), 355.
4. de Castro IVF, Negri G, Salatino A and Bandeira MFC. 2011. A new type of Brazilian
propolis: Prenylated benzophenones in propolis from Amazon and effects against cariogenic
bacteria. Food Chem., 125(3), 966-972.
5. de Souza Marques E, Silva S, Niero R, de Andrade SF, Rosa PCP, Perazzo FF and Maistro
EL. 2012. Genotoxicity assessment of Garcinia achachairu Rusby (Clusiaceae) extract in
mammalian cells in vivo. J. Ethnopharmacol., 142(2), 362-366.
6. Díaz-Carballo D, Gustmann S, Acikelli AH, Bardenheuer W, Buehler H., Jastrow H, Ergun S
and Strumberg D. 2012. 7-epi-nemorosone from Clusia rosea induces apoptosis, androgen
receptor down-regulation and dysregulation of PSA levels in LNCaP prostate carcinoma
cells. Phytomedicine, 19(14), 1298-1306.
7. Elfita E, Muharni M, Latief M, Darwati D, Widiyantoro A, Supriyatna S, Bahti HH,
Dachriyanus D, Cos P, Maes L, Foubert K, Apers S and Pieters L. 2009. Antiplasmodial and
other constituents from four Indonesian Garcinia spp. Phytochemistry, 70(7), 907-912.
8. Formacek V and Kubeczka KH. 2002. Essential oil analysis by capillary gas chromatography
and carbon-13 NMR spectroscopy. Second edition. John Wiley & Sons, NewYork.
9. Hemshekhar M, Sunitha K, Santhosh M S, Devaraja S, Kemparaju K, Vishwanath BS,
Niranjana SR and Girish KS. 2011. An overview on genus Garcinia: Phytochemical and
therapeutical aspects. Phytochem. Rev., 10(3), 325-351.
10. Hora RR, Ionescu-Hirsh A, Simon T, Delabie J, Robert J, Fresneau D and Hefetz A. 2008.
Postmating changes in cuticular chemistry and visual appearance in Ectatomma tuberculatum
queens (Formicidae: Ectatomminae). Naturwissenschaften, 95(1), 55-60.
11. Kapadia GJ, Oguntimein B and Shukla YN. 1994. High-speed counter-current
chromatographic separation of biflavanoids from Garcinia kola seeds. J. Chromatogr. A,
673(1), 142-146.
12. Kim HP, Park H, Son KH, Chang HW, Kang SS. 2008. Biochemical pharmacology of
biflavonoids: Implications for anti-inflammatory action. Arch. Pharm. Res., 31, 265-273.
13. Konishi Y, Kiyota T, Draghici C, Gao JM, Yeboah F, Acoca S, Jarussophon S and Purisima
E. 2007. Molecular formula analysis by an MS/MS/MS technique to expedite dereplication of
natural products. Anal. Chem., 79(3), 1187-1197.
14. Kumar S, Chattopadhyay SK, Darokar MP, Garg A and Khanuja SP. 2007. Cytotoxic
activities of xanthochymol and isoxanthochymol substantiated by LC-MS/MS. Planta Med.,
73(14), 1452-1456.
15. Kumar S, Sharma S and Chattopadhyay SK. 2013. Rapid and sensitive HPLC-PDA method
for simultaneous identification and quantification of dietary weight reducing compound
hydroxy citric acid lactone and chemo preventive compounds isoxanthochymol and
xanthochymol in Garcinia indica. Int. Food Res. J., 20(1), 397-402.
16. Majeed M, Rosen R, Mc Carty M, Conte A, Patil D and Butrym E. 1994. Citrin; A
revolutionary, herbal approach to weight management. New Editions Publishing, California.
17. Mohanan N and Sivadasan M. 2002. Flora of Agasthyamala. Bishen Singh MahendraPal
Singh, Dehradun, India.
99
18. Osorio E, Londono J and Bastida J. 2013. Low-Density Lipoprotein (LDL)-Antioxidant

Biflavonoids from Garcinia madruno. Molecules, 18, 6092-6100.
antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs. J. Hematol.
Oncol., 2(1), 1-13.
20. Peres V, Nagem TJ and de Oliveira FF. 2000. Tetraoxygenated naturally occurring
xanthones. Phytochemistry, 55(7), 683-710.
21. Phonde RY and Magdum CS. 2015. Hyphenated techniques: An overview. Int. J. Univers.
Pharm. Life Sci., 4(3), 1-37.
22. Rao AR, Venkatswamy G and Pendse D. 1980. Camboginol and cambogin. Tetrahedron
Lett., 21(20), 1975-1978.
23. Rastogi RP and Mehrotra BN. 1990. Compendium of Indian Medicinal Plants. Central Drug
Research Institute, Lucknow and National Institute of Science Communication, Council of
Scientific and Industrial Research, New Delhi, 1, pp.434-436.
24. Rosenberg E. 2003. The potential of organic (electrospray-and atmospheric pressure chemical
ionisation) mass spectrometric techniques coupled to liquid-phase separation for speciation
analysis. J. Chromatogr. A, 1000(1), 841-889.
25. Sahu A, Das B and Chatterjee A. 1989. Polyisoprenylated benzophenones from Garcinia
pedunculata. Phytochemistry, 28(4), 1233-1235.
26. Sappington TW and Taylor OR. 1990. Developmental and environmental sources of
pheromone variation in Colias eurytheme butterflies. J. Chem. Ecol., 16 (9), 2771-2786.
27. Schiestl FP, Ayasse M, Paulus HF, Löfstedt C, Hansson BS, Ibarra F and Francke W. 2000.
Sex pheromone mimicry in the early spider orchid (Ophrys sphegodes): Patterns of
hydrocarbons as the key mechanism for pollination by sexual deception. J. Comp. Physiol. A,
186(6), 567-574.
28. Shen YF, Zhang R, Moor RJ, Kim J, Metz TO, Hixson KK, Zhao R, Livesay EA, Udseth HR
and Smith RD. 2005. Automated 20 kpsi RPLC-MS and MS/MS with chromatographic peak
capacities of 1000–1500 and capabilities in proteomics and metabolomics. Anal. Chem., 77,
3090-3100.
29. Shu YZ. 1998. Recent natural products based drug development: A pharmaceutical industry
perspective. J. Nat. Prod., 61(8), 1053-1071.
30. Waterman PG and Hussain RA. 1983. Systematic significance of xanthones, benzophenones
and biflavonoids in Garcinia. Biochem. Sys. Ecol., 11(1), 21-28.
31. Williams RB, Hoch J, Glass TE, Evans R, Miller JS, Wisse JH and Kingston DG. 2003. A
novel cytotoxic guttiferone analogue from Garcinia macrophylla from the Suriname
rainforest. Planta Med., 69(9), 864-866.
32. Xu G, Feng C, Zhou Y, Han QB, Qiao CF, Huang SX, Chang DC, Zhao QS, Luo KQ and Xu
HX. 2008. Bioassay and ultraperformance liquid chromatography/mass spectrometry guided
isolation of apoptosis-inducing benzophenones and xanthone from the pericarp of Garcinia
yunnanensis Hu. J. Agric. Food Chem., 56(23), 11144-11150.
33. Yamaguchi F, Ariga T, Yoshimura Y and Nakazawa H. 2000. Antioxidative and anti-
glycation activity of garcinol from Garcinia indica fruit rind. J. Agric. Food Chem., 48(2),
180-185.
100
Chapter 5
Leaf volatile chemical profiles of Garcinia species in the Western Ghats
K. B. Rameshkumar*, A. P. Anu Aravind and Lekshmi N Menon

*
Abstract
The volatile chemical profiles of nine Garcinia species occurring naturally in the Western
Ghats (G. gummi-gutta, G. imberti, G. indica, G. morella, G. pushpangadaniana, G. rubro-
echinata, G. talbotii, G. travancorica and G. wightii) were studied for the first time. The leaf
volatile chemicals were isolated by hydrodistillation and analyzed by GC-FID, GC-MS and
13
C NMR. The oil yield varied from 0.75 %v/w (G. travancorica) to 0.01 %v/w (G.
pushpangadaniana). A total of 99 volatile compounds were identified, of which
sesquiterpenoids derived from the mevalonic acid pathway were the predominant class of
compounds distributed in all the Garcinia species. The sesquiterpene hydrocarbon -
copaene, which is present in all the Garcinia species studied, can be considered as the marker
compound for the genus. In addition, specific marker compounds were also determined for
the Garcinia species studied. The distribution of volatile compounds was analyzed by
statistical methods and differentiation of the species was done by cluster analysis.
Comparison with morphological classification revealed that the volatile chemical profiles
were not related to the taxonomic classification of the genus, but rather to ecological
interactions.
Keywords: Garcinia, Leaf essential oil, GC-MS, Chemotaxonomy, -Copaene
Introduction
Garcinia species are an important component of the forest flora of the Western Ghats and
some of the species are economically important as well. Nine Garcinia species were
distributed wildly in the Western Ghats region, of which 7 species are endemic to the region
(Table 1) (Maheswari, 1964, Sabu et al., 2013). The genus Garcinia is well reputed as a
source of valuable non wood forest products such as fats, oils, resins and colouring materials.
Fruits of some Garcinia species are rich source of red pigments in the plant kingdom.
Camboge, the yellow colouring pigment, is a well known product from Garcinia species.
Recently, Garcinia species have received considerable attention worldwide from the
scientific as well as industrial sectors due to the report of several bioactive structures such as
biflavonoids, xanthones and benzophenones (Hemshekhar et al., 2011). In south India, G.
gummi-gutta and G. indica were cultivated for commercial extraction of a variety of value
added products such as bioactive acids, nutraceuticals, fats and condiments (Parthasarathy et
al., 2013).
101
Although most of the species of the family Clusiaceae are known for their oil glands
and secretary canals, literature review revealed that the reports on essential oils from
Garcinia species are rare (Macleod and Pieris, 1982, Onayade, et al., 1998, Rameshkumar et
al., 2005, Martins et al., 2008). Essential oils are complex mixtures of steam volatile
chemical compounds, isolated generally by hydrodistillation of crude plant material. Essential
oils occur in specialized secretary structures such as resin canals, lysigenous cavities,
epidemic cells, glandular hairs, schizogenous passages, modified parenchymal cells or in oil
tubes called vittae, in different plant parts such as buds, flowers, leaves, stems, twigs, seeds,
fruits, roots, wood and bark (Handa, 2008). Majority of the volatile chemical constituents
belong to the structural types terpenoids and phenylpropanoids, synthesized through the
mevalonic acid pathway and shikimic acid pathway respectively. Different secondary
metabolites present in these complex mixtures play diverse role in plants as antimicrobial,
insecticidal and also as attractors of pollinating agents.
The present chapter discusses the volatile chemical profiles of Garcinia species of the
Western Ghats and explores the possibility of evaluating species relationships through
chemotaxonomy and to identify marker compounds for Garcinia species. Possible chemical
ecological interactions were also discussed in the chapter.
1. Essential oil yield of Garcinia species

Fresh leaves of 9 Garcinia species, collected from different parts of the Western Ghats, were
hydrodistilled using Clevenger type apparatus for 3h each. Comparison of essential oil yield
(Table 1) revealed that G. travancorica possess maximum oil content (0.75%v/w), while G.
pushpangadaniana possess the least oil content (0.01%v/w). G. imberti can also be
considered as a rich source of essential oil (0.70%v/w). It is interesting to note that the three
endemic Garcinia trees to Agasthyamala forests viz; G. travancorica G. imberti and G.
rubro-echinata that occur at high altitudes possess high oil yield. However, the altitude is not
a detrimental factor in essential oil yield, as evident from Table 1.
Table 1. Essential oil yield of fresh leaves of Garcinia species from the Western Ghats
Sl. Garcinia species Herbariu Location, District Altitude Essential oil
No. m No. yield (%v/w)
1 G. gummi-gutta 66446 Vaikom, Kottayam 50 m 0.07
2 G. imberti 66416 Agastyamala forests, 994 m 0.70
Thiruvananthapuram
3 G. indica 66423 Thaliparampa, Kannur 75 m 
4 G. morella 66418 Agastyamala forests, 650 m 0.45
Thiruvananthapuram
5 G. pushpangadaniana 66421 Kadalar, Munnar, Idukki 1401 m 0.01
6 G. rubro-echinata 66419 Agastyamala forests, 1074 m 
Thiruvananthapuram
7 G. talbotii 72622 Pampa, Pathanamthitta 224 m 0.50
8 G. travancorica 66417 Agastyamala forests, 1168 m 0.75
Thiruvananthapuram
9 G. wightii 50987 Athirapally Vazhachal, 149 m 0.03
Thrissur
102
The present observation on oil yield warrants detailed study on the distribution and nature of
the secretary structures of Garcinia species in the Western Ghats (Esau 1965 and Schofield
1968). In a previous study, among the 10 Sri Lankan Garcinia species, G. morella and G.
spicata stand out from the rest of the Sri Lankan Garcinia taxa on the basis that secretary
spaces were observed in the palisade tissue rather than in the spongy tissue of lamina
(Pathirana, 2004).
2. Analysis of essential oils

The essential oils were analyzed by GC-FID, GC-MS and 13C NMR. GC-FID analyses were
carried on a Shimadzu GC-2010 Plus Gas Chromatograph (Shimadzu, Japan), fitted with an
Rxi-5 Sil MS capillary column (5% phenyl and 95% dimethyl polysiloxane, 30 m x 0.25 mm,
0.25 µm film thickness, Restek USA). 1 µL of the diluted oil in diethyl ether (1:50 dilution)
were injected in both GC-FID and GC-MS under splitless condition. GC operation
conditions: injector temperature, 270oC; oven temperature programme, 60-250oC (3oC/min);
hold time 2 min. at 250oC; carrier gas, N2 at 3 mL/min; detector temperature 270oC. Relative
percentages of cinnamaldehyde were obtained from the peak area percent report of volatiles
from GC-FID data.
GC-MS analysis was done on a Hewlett Packard 6890 Gas Chromatograph fitted with
an HP-5 (5% phenyl 95% dimethyl polysiloxane, 30 m x 0.32 mm, 0.25 µm film thickness)
capillary column, coupled with a Model 5973 mass detector. GC-MS operation conditions:
injector temperature, 220oC; transfer line, 240oC; oven temperature programme, 60-250oC
(3oC/min); carrier gas, He at 1.4 mL/min. Mass spectra: Electron Impact (EI+) mode, 70 eV
with a mass range of 40 to 450 m/z; ion source temperature, 240oC. Relative retention indices
(RRIs) of the constituents in HP-5 column were determined using standard C6-C30
hydrocarbons (Aldrich Chemical Company, USA) (Dool and Kratz, 1963). Individual
components were identified by Wiley 275.L and NIST 05.L database matching, Co-GC with
authentic standards, comparison of retention indices and comparison of mass spectra of
constituents with published data (Adams, 2007). 13C NMR was also used for confirmation of
structures. A total of 99 compounds were identified from the essential oils of 9 Garcinia
species (Table 2).
Table 2. Composition of the essential oils of the leaves of 9 Garcinia species in the Western Ghats
Compound RIlit G. gg G. im G. in G. mr G. ps G. re G. tl G. tr G. wg
Myrcene 988 0.1
Z--Ocimene 1032 0.2
E--Ocimene 1044 1.1
Terpinolene 1086 0.2
Linalool 1095 1.8
n-Undecane 1100 40.1
Terpineol 1186 0.4
Ascaridiole 1234 0.1
Geraniol 1249 0.4
-Elemene 1338 0.1 1.1 0.3 0.4 2.4
-Cubebene 1348 0.4 0.3 1.2 0.7 0.7
Cyclosativene 1371 1.3
-Ylangene 1373 0.3 0.8 1.0
103
-ourbonene 1374 4.1

-Copaene 1376 30.2 0.4 1.2 1.3 3.1 0.2 27.0 15.8 1.7
β-Panasinsene 1381 1.3
-Bourbonene 1387 6.8 0.1
-Cubebene 1387 0.3 0.4
-Elemene 1390 0.9
-Gurjunene 1409 0.3 3.1
β-Funebrene 1414 3.3
-Caryophyllene 1419 5.7 38.1 18.6 0.1 11.4 37.9 30.4 4.0 19.0
-Copaene 1430 1.3 0.4 1.6 49.4 0.1
α-trans Bergamotene 1434 0.8 1.8
β-Gurjunene 1433 0.1 2.2 1.2
-Elemene 1434 2.1 0.4
-Guaiene 1437 0.3 0.1
Aromadendrene 1439 0.5 2.8 1.1 1.6 6.8
cis- Muurola- 3,5- 1448 0.8
diene
α-Himachalene 1451 3.1
Amorpha 4, 11- diene 1451 0.4 2.2
-Humulene 1452 1.8 30.5 17.6 18.5 3.2 40.6 10.7 0.1 4.6
Allo aromadendrene 1458 5.5 0.1 2.9
cis Cadina-1(6)-4- 1461 0.9 1.4 0.1 2.4
diene
α-Acoradiene 1464 0.3 0.1
9 epi E- 1466 0.5
Caryophyllene
β-Acoradiene 1469 4.5
4,5-di epi- 1471 0.6
Aristalochene
-Gurjunene 1475 3.1
trans Cadina-1 (6), 4- 1476 0.9 1.0
diene 
-Muurolene 1478 4.3 5.9 11.7 7.2 3.8
Amorpha- 4,7(11) – 1480 0.5
diene
γ- Himachalene 1482 2.3 1.1
α-Amorphene 1483 1.3
-Selinene 1489 1.1 12.3 0.6

cis β-Guaiene 1492 0.1
-Selinene 1492 0.9
-Amorphene 1495 2.6
-Selinene 1498 1.5 18.2
β-Alaskene 1498 2.5 3.8
Bicyclogermacrene 1500 3.6 22.6
-Muurolene 1500 1.5 3.7
-Bisabolene 1505 0.5
E-γ-Bisabolene 1507 0.1
Germacrene A 1508 0.6
104
-Bulnesene 1509 0.2

-Amorphene 1511 0.4 0.5 1.2 0.3 7.0
-Cadinene 1513 3.4 4.6 12.4 0.5
epiα-Selinene 1520 1.9
-Cadinene 1522 32.4 5.3 13.1 4.5
trans Cadina 1,4- 1533 0.7 0.8 1.0 0.1
diene
Cadina-1(2),4-diene 1535 0.9
-Cadinene 1537 0.5 0.7 1.4 0.1
Cadala-1(10),3,8- 1540 0.3
triene
-Calacorene 1544 0.5 0.5 1.2
Selina-3,7(11) diene 1545 0.2
Elemol 1548 0.3
Germacrene B 1559 0.3 0.3 0.8 0.4
E-Nerolidol 1561 0.4
Maaliol 1566 0.2 2.0
Caryophyllenyl 1570 0.9
alcohol
Epiglobulol 1576 0.2
Spathulenol 1577 0.1 1.9
Caryophyllene oxide 1582 0.3 6.7 0.8 2.6
Globulol 1590 1.9 0.7 0.1 6.0
Viridiflorol 1592 0.1 5.5
3,7-Cyclo 1584 1.4
undecadiene 1-ol,
1,5,5,8-tetramethyl
Cubeban-11-ol 1595 0.1 0.1
Widdrol 1599 0.1
Rosifoliol 1600 1.2 0.5
Humulene epoxide II 1608 0.7 0.5
Junenol 1618 0.2
1,10-di epi Cubenol 1618 0.1 1.2
-Corocalene 1622 0.2
1-epi-Cubenol 1627 1.5 0.1 0.1
Muurola-4,10 (14)- 1630 1.0
diene-1-β-ol
γ-Eudesmol 1630 0.3
cis-Cadina-4-en-7-ol 1635 0.9
Caryophylla- 1639 0.1
4(12),8(13) diene
epi-α-Muurolol 1640 0.3 0.4
-Muurolol 1644 0.4 0.5 0.2
Cubenol 1645 0.2 0.1 0.8
-Cadinol 1652 0.9 0.3 0.1
Selin-11-en-4-ol 1659 0.5
14- Hydroxy (Z)- 1666 0.5
caryophyllene
14- Hydroxy 9-epi-E- 1668 0.1
caryophyllene
105
Germacra-4(15),5,10 1685 0.7

(14) trien-1-α-ol
δ-Cedren-13-ol 1688 0.7
Amorpha 4,9-dien-2- 1700 0.2
ol
Total % 96.9 84.6 96.9 86.0 87.8 94.2 89.2 92.4 87.7
Total No (99) 30 19 21 21 34 18 30 15 23
Monoterpenoids 1.3 Nil Nil 0.2 2.8 Nil Nil Nil Nil
Sesquiterpene- 95.0 84.1 93.7 75.0 79.8 91.7 82.6 52.3 69.2
hydrocarbons
Sesquiterpene- 0.6 0.5 3.2 10.8 5.2 2.5 6.6 Nil 18.5
oxygenated
Total 95.6 84.6 96.9 85.8 85.0 94.2 89.2 52.3 87.7
sesquiterpenoids
Aliphatic compounds Nil Nil Nil Nil Nil Nil 40.1 Nil
G.gg-G. gummi-gutta; G.im-G. imberti, G.in-G. indica; G.mr-G. morella; G.ps-G.
pushpangadaniana; G.re-G. rubro-echinata; G.tl-G. talbotii; G.wg-G.wightii; G.tr-G.travancorica;
RRI: Relative retention index calculated on HP-5 column.
The ubiquitous sesquiterpene hydrocarbons -caryophyllene and the isomeric compound -

humulene were present in all the Garcinia species. The maximum content of -caryophyllene
was in G. imberti (38.1%), followed by G. rubro-echinata (37.9%), G. talbotii (30.4%), G.
wightii (19.0%), G. indica (18.6%) and G. pushpangadaniana (11.4%). Except in G. rubro-
echinata and G. morella, -caryophyllene was in higher amount compared to -humulene. -
Humulene was present in significant quantity in G. rubro-echinata (40.6%), G. imberti
(30.5%), G. indica (17.6%), G. morella (18.5%) and G. talbotii (10.7%).
-Copaene was the major compound in G. gummi-gutta (30.2%), G. talbotii (27.0%)
and G. travancorica (15.8%). -Copaene was the major compound in G. morella (49.4%). -
Selinene and -selinene were present in significant quantity in G. indica (18.2 and 12.3%
respectively).-Cadinene (13.1%), -cadinene (12.4%) and -muurolene (11.7%) were
predominant in G. pushpangadaniana. Bicyclogermacrene (22.6%) was characteristically
present in significant quantity in G. wightii.
Though petrochemicals are the raw materials for synthetic perfumery chemicals,
natural isolates from plant sources are preferred over synthetics in many aspects and
discovery of novel sources of natural aroma chemicals has a detrimental role in flavor and
fragrance industries. Garcinia species of the Western Ghats can be considered as a rich
source of volatile chemicals such as caryophyllene, humulene and undecane.
3. Biosynthetic pathways of volatile chemicals in Garcinia species

Three distinct chemical groups viz; monoterpenoids, sesquiterpenoids and aliphatic
hydrocarbons could be characterized in the volatile chemicals of Garcinia species. An
evaluation of the biosynthetic pathways of the volatile chemicals revealed that
sesquiterpenoids derived from mevalonic acid pathway were the predominant volatile
chemicals (Figure 1) (David, 1999).
106
Figure 1. General biosynthetic pathways of different classes of volatile chemicals in Garcinia species
-Copaene- The volatile chemical marker compound for the genus Garcinia
Biosynthesis of essential oil and volatile chemicals is a genetically determined attribution and
it is possible to trace common progenies for volatile chemicals in related taxa. The volatile
chemical profile analysis suggested that the sesquiterpene hydrocarbon -copaene, can be
considered as chemotaxonomic marker compound for the Garcinia species in the Western
Ghats. Though -caryophyllene and -humulene were present in all the Garcinia species
studied, the compounds are ubiquitous in most of the aromatic plants. The characteristic
compound -copaene with an unusual tricyclic decane ring system, that is present in all the
Garcinia species studied, has been selected as the marker compound for the genus. The
structure of -copaene was unambiguously identified through 13C NMR spectroscopic
studies. 13C NMR has now been evolved as a reliable tool for identification of volatile
constituents in crude essential oils, where the Identification by 13C NMR was carried out by
comparison of the 13C NMR signals of the total oil to the 13C NMR signals for pure
compounds compiled in our laboratory and available in the literature (Kubeczka and
Formacek, 2002). The major compounds can unambiguously be identified by 13C NMR
taking into account the number of identified carbons, the number of overlapped signals and
the difference of chemical shift of each resonance in the mixture and in the reference
spectra.Further-copaene was isolated from the plants and the structure was confirmed
through 13C NMR studies of the isolated compound (Figure 2). -Copaene exists as 2
isomeric forms, -copaene and -ylangene with different properties (Figure 3). α-Copaene,
has been reported to be attractive to the Mediterranean fruit fly Ceratitis capitata, a highly
destructive pest to several crops, while the attractive property of its isomeric form α-ylangene
has not been confirmed in the fields. Through GC-MS it is quite difficult to differentiate the
isomeric forms due to their close similarity in mass fragmentation pattern as well as close
RRI values and -copaene reported from various sources through GC-MS analysis might be a
107
mixture of -copaene and -ylangene. The structure of -copaene was unambiguously

differentiated from its stereoisomeric form -ylangene by 13C NMR. The 13C chemical shifts
of C-2 and C-6 of -copaene showed striking differences of nearly 11 ppm from that of -
ylangene, enabling their differentiation through 13C NMR (Buyck et al., 1989).
Figure 2. 13C NMR of α-copaene (A) and Garcinia talbotii leaf essential oil (B).
9 14 9 14
8 8
10 13 10 13
7 15 7 15
2 6 6 2
1 1
3 11 11 3
5 5
12 12
4 4
-Copaene -Ylangene
Figure 3. Structures of α-copaene and α-ylangene
5. Chemotaxonomic marker compounds for Garcinia species

Among the different volatile chemicals detected from Garcinia species, chemotaxonomic
marker compounds were identified based on their uniqueness in the species. The marker
compound may not be the major compound present in the species, but the uniqueness in
chemical structure and biosynthetic pathway along with their presence in the species make
the compound marker for the species. The consistency of the compound has been confirmed
by analyzing at least 4 different accessions from different bio-geographical locations. The
aliphatic compound n-undecane was exclusively present in G. travancorica and was also the
major compound in the species. Other marker compounds identified were -Cadinene (G.
gummi-gutta), -caryophylleneG. imberti-selinene (G. indica), -copaene (G. morella),
-bourbonene (G. pushpangadaniana), -copaene (G. talbotii) and bicyclogermcrene (G.
wightii).
6. Chemotaxonomy of Garcinia species based on volatile chemical profile

The systematics of Garcinia species primarily depends on analysis of reproductive
morphological features and the genus is often considered as a taxonomically difficult group
due to the dioceous nature of plants and strict seasonality in flowering and fruiting
108
(Nimanthika and Kaththriarachchi, 2010). Combined multidisciplinary analysis of various tools

such as vegetative and reproductive morphology, anatomy, molecular as well as
chemotaxonomy will yield more robust phylogeny of this group. A comprehensive study on
the vegetative anatomy has been carried out to assess the phylogenetic relationships of the
genus Garcinia (Pathirana, 2004). Molecular analysis has also been reported as effective in
such phylogenetic studies (Sweeney, 2008). The use of distribution patterns of secondary
metabolites is well established as a major tool for characterize, classify and describe taxa.
The vast information of secondary metabolites can also be utilized for investigating
population structures, species and phyletic relationships and evolutionary status. The genus
Garcinia is characterized by the presence of a large number of secondary metabolites with
diverse structural features such as xanthones, benzophenones, biflavonoids and terpenoids.
Several attempts have been made to evaluate the phylogeny among Clusiaceae members
through secondary metabolite profiling (Waterman and Hussain, 1983, Nogueira et al., 2001).
Volatile chemicals can efficiently be utilized for chemotaxonomic purposes. Though
environmental factors affect the chemical composition of the essential oils, these changes
particularly influence the accumulation of essential oil, as terpenoids and phenyl propanoids
are generally under strict genetic control (Hiltunen and Holm 1999).
The relative percentages of all the 99 components of the essential oils were taken as
variables and submitted to cluster analysis to sub group Garcinia species using SPSS 16.0
software (SPSS Inc, USA). The derived dendrogram depicts the grouping based on their
chemical compositions.
Similarity and cladistic analyses performed statistically based on the distribution of
volatile chemicals delimited the Western Ghats Garcinia species in the dendrogram (Figure
4, Table 3). Among the 9 Garcinia species, G. travancorica was isolated from other species.
The aliphatic hydrocarbon n-undecane derived from polyketide pathway was the major
constituent of the leaf oil of G. travancorica, while in all other species, the major constituents
were sesquiterpenoids derived from mevalonic acid pathway. G. morella was also distinct
from other species by the high content of β-copaene. G. rubro-echinata and G. imberti were
close to each other by the presence of β-caryophyllene and α-humulene as the major
compounds in both the species.
Figure 4. Dendrogram showing subgrouping of Garcinia species based on volatile chemical profile
using between groups linkage (SPSS version 16.0)
109
Table 3. Similarity matrix between nine Garcinia species of the Western Ghats
Case Correlation between vectors of values
1:1 2:2 3:3 4:4 5:5 6:6 7:7 8:8 9:9
1:1 1.0000 0.0959 0.9664 0.7287 0.2322 0.4093 0.6665 0.0311 0.5284
2:2 0.0959 1.0000 0.0943 0.2244 0.0233 0.5505 0.5101 0.2897 0.0620
3:3 0.9664 0.0943 1.0000 0.7041 0.2024 0.3792 0.7017 0.0451 0.5316
4:4 0.7287 0.2244 0.7041 1.0000 0.1822 0.4642 0.5117 0.0197 0.3368
5:5 0.2322 0.0233 0.2024 0.1822 1.0000 -0.0011 0.0853 -0.0230 0.0289
6:6 0.4093 0.5505 0.3792 0.4642 -0.0011 1.0000 0.4203 0.0781 0.2236
7:7 0.6665 0.5101 0.7017 0.5117 0.0853 0.4203 1.0000 0.2565 0.4688
8:8 0.0311 0.2897 0.0451 0.0197 -0.0230 0.0781 0.2565 1.0000 0.0181
9:9 0.5284 0.0620 0.5316 0.3368 0.0289 0.2236 0.4688 0.0181 1.0000
Comparison with morphological classification (Chapter 1) revealed that the

composition of the leaf volatiles was not related to the taxonomic position of different
Garcinia species. G. pushpangadaniana and G. talbotii are morphologically very similar with
stamens in 5 phalanges and 5 set of sepals and petals and are placed as a separate clad in
morphological classification. However, the volatile chemical composition was quite different
in both the species, placing them in distant clads (Figure 4). Dendrograms based on end use
related traits, such as oil composition, may be of practical interest related to ecological
interactions, but do not necessarily correlate with taxonomy. Chemometric studies of the
chemical composition of the floral volatiles of 16 species of the genus Clusia (family:
Clusiaceae) revealed the composition was in part, but not always related to the taxonomic
position of the genus, but to a minor extent to the type of pollinators visiting the flower
(Nogueira et al., 2001). In the present study, it would be interesting to correlate the
environmental and ecological factors to the leaf volatile profile, rather than the taxonomic
positions based on morphological classifications.
7. Chemical ecology of the volatile chemicals of Garcinia species

Chemical ecology is an active, interdisciplinary field between chemistry and biology, dealing
with the role of chemical compounds in interactions between organisms. Volatile organic
compounds (VOCs) are important in chemical ecology and in plants, VOCs have important
role in reproduction, by attracting and orienting pollinators and also as defense against
feeding by ants, beetles and other insects (Huang et al., 2012). The present study of volatile
organic compounds of Garcinia species revealed some interesting observations that can be
related to chemical ecology.
High quantity of n-undecane with gasoline type odour may play a key role in
pollination of G. travancorica, as the compound was reported to possess pheromone type
character which attracts the flies, moths and ants (Schiestl, 2000). n-Undecane is the major
pheromone found in Dufour's gland of the ant Camponotus obscuripes (Formicinae), while
formic acid was the major component in the poison gland. When the ants sensed formic acid,
they eluded the source of the odor; however, they aggressively approached odor of n-
undecane. The mutualism in any possible ant-plant interaction need to be studied on a
chemical ecological basis.
The sesquiterpene E-caryophyllene, a major volatile compound in several Garcinia
species has been reported as a defence compound against herbivores and pathogens (Huang et
110
al., 2012). E-Caryophyllene is an important volatile sesquiterpene of plants that may serve as
allelochemical to influence the neighboring plant growth or as an indirect defence to attract
natural herbivore enemies (Wang et al., 2009). E-Caryophyllene is the major volatile organic
compound in G. imberti and it is interesting to note that the diversity of other species in and
around populations of G. imberti is much less, indicating possible allelopathic effect of the
compound. E-caryophyllene has been reported as emitted from plants in response to
herbivore attack. The compound has been reported as a semiochemical that attracts Asian
lady beetle, Harmonia axyridis Pallas, a natural predator to aphids, the sap sucking plant lice.
Conclusions
The genus Garcinia is an important component of the forest flora of the Western Ghats and
also an economically important group of plants. Even though 9 Garcinia species were
distributed in the Western Ghats, none of them were previously investigated for their leaf
volatile chemical constituents. Present study reports Garcinia species as a rich depository of
essential oils. The chemotaxonomic relationships found in this study were not related to the
taxonomic position of the genus based on morphological features. The volatile chemicals
were rather evolved based on environmental and ecological interactions and the information
may be useful in unraveling ecological interactions of Garcinia species.
References
1. Adams RP. 2007. Identification of Essential Oil Components by Gas
Chromatography/Mass Spectrometry. Fourth edition. Allured Pub. Co., Carol Stream, IL.
2. De Buyck LF, De Pooter HL, Schamp NM, De Bruyn R, Zhang W, Budesinsky M and
Motl O. 1989. Terpenes from Otacanthus coeruleus Lindl.: Identification of β-copaen-
4α-ol and a new criterion for discriminating between isomeric copaene and ylangene
structures. Flavour Fragr. J., 4, 53-57.
3. David EC. 1999. Sesquiterpene Biosynthesis: Cyclisation Mechanisms. In:
Comprehensive Natural Product Chemistry (Ed.). Derek Barton and Koji Nakanishi.
Elsevier, Amsterdam, Vol.II, p.167.
4. Dool VH and Kratz PD. 1963. A generalization of the retention index system including
linear temperature programmed gas liquid partition chromatography. J. Chromatogr., 11,
463-471.
5. Esau, K. 1965. Plant Anatomy. 2nd ed. Wiley Eastern Limited, New Delhi.
6. Handa SS. 2008. An overview of extraction techniques for medicinal and aromatic
plants. In: Extraction Technologies for Medicinal and Aromatic Plants. (Eds.) Handa SS,
Singh SP, Longo KG and Rakesh DD. International Centre for Science and High
Technology, ICS-UNIDO, Trieste. pp. 21-52.
7. Hemshekhar M, Sunitha K, Santhosh MS, Devaraja S, Kemparaju K, Vishwanath BS,
Niranjana SR and Girish KS. 2011. An overview on genus Garcinia: Phytochemical and
8. Hiltunen R and Holm Y. 1999. Basil: The Genus Ocimum. Harwood Academic
Publishers, Amsterdam.
9. Huang M, Sanchez-Moreiras A M, Abel C, Sohrabi R, Lee S, Gershenzon J and Tholl D.
2012. The major volatile organic compound emitted from Arabidopsis thaliana flowers,
111
the sesquiterpene (E)-b-caryophyllene, is a defense against a bacterial pathogen. New

Phytologist 193: 997-1008.
10. Kubeczka KH and Formacek V. 2002. Essential Oils Analysis by Capillary Gas
Chromatography and Carbon-13 NMR Spectroscopy. John Wiley and Sons, Chichester.
11. Macleod JA and Pieris NM. 1982. Volatile flavour components of Mangosteen, Garcinia
12. Maheswari JK. 1964. Taxonomic studies on Indian Guttiferae III. The genus Garcinia
Linn. Bull. Bot. Surv. India, 6, 107-135.
13. Martins FT, Doriguetto AC, de Souza TC, de Souza KR, dos Santos MH, Moreira ME
and Barbosa LC. 2008. Composition and anti‐inflammatory and antioxidant activities of
the volatile oil from the fruit peel of G.brasiliensis. Chem. Biodivers., 5(2), 251-258.
14. Nimanthika WJ, Kaththriarachchi HS. 2010. Systematics of genus Garcinia L.
(Clusiaceae) in Sri Lanka. New insights from vegetative morphology. Journal of
National Science Foundation, 38, 29-44.
15. Nogueira PC, Bittrich V, Shepherd GJ, Lopes AV and Marsaioli AJ. 2001. The
ecological and taxonomic importance of flower volatiles of Clusia species (Guttiferae).
16. Onayade OA, Looman AMG, Scheffer JJC and Gbile ZO. 1998. Lavender lactone and
other volatile constituents of the oleoresin from seeds of Garcinia kola Heckel. Flavor
and Fragrance Journal, 13(6), 409-412.
17. Parthasarathy U, Nirmal Babu K, Senthil Kumar R, Ashis GR, Mohan S and
Parthasarathy VA. 2013. Diversity of Indian Garcinia - A medicinally important spice
crop in India. Acta Hortic., 979, 467-476.
18. Pathirana PSK and Herat TR. 2004. Comparative vegetative anatomical study of the
genus Garcinia L. (Clusiaceae/ Guttiferae) in Sri Lanka. Ceylon Journal of Science, 32,
39-66.
19. Rameshkumar KB, Shiburaj S and George V. 2005. Constituents and antibacterial
activity of the stem bark oil of Garcinia imberti. J. Trop. Med. Plants, 6, 271-273.
20. Sabu T, Mohanan N, Krishnaraj MV, Shareef SM, Shameer PS and Roy PE 2013.
Garcinia pushpangadaniana, (Clusiaceae) a new species from southern Western Ghats,
India. Phytotaxa, 116 (2), 51-56.
21. Schiestl FP, Ayasse M, Paulus HF, Löfstedt C, Hansson BS, Ibarra F and Francke W.
2000. Sex pheromone mimicry in the early spider orchid (Ophrys sphegodes): Patterns of
hydrocarbons as the key mechanism for pollination by sexual deception. J. Comp.
Physiol. A, 186(6), 567-574.
22. Schofield EK 1968. Petiole anatomy of the Guttiferae and related families. Mem. New
York Bot. Gard. 18,1-55.
23. Sweeney PW. 2008. Phylogeny and floral diversity in the genus Garcinia (Clusiaceae)
and relatives. Int. J. Plant Sci., 169(9), 1288-1303.
24. Wang R, Peng S, Zeng R, Ding LW and Xu Z. 2009. Cloning, expression and wounding
induction of β-caryophyllene synthase gene from Mikania micrantha H.B.K. and
allelopathic potential of β-caryophyllene. Allelopathy Journal, 24 (1), 35-44.
112
Chapter 6
Rapid estimation of bioactive constituents of Garcinia species in the

Western Ghats using UHPLC-MS/MS Method
Renu Pandey1, Brijesh Kumar1* and K. B. Rameshkumar2
1
Sophisticated Analytical Instrument Facility, CSIR-Central Drug Research Institute,
Lucknow-226031, Uttar Pradesh, India
2 Phytochemistry and Phytopharmacology Division, Jawaharlal Nehru Tropical Botanic Garden and
Research Institute, Palode, Thiruvananthapuram-695562, Kerala, India
*
Abstract
Species of the genus Garcinia (Family: Clusiaceae) are traditionally used in the preparation
of food and as herbal supplements. Organic acids, prenylated xanthones, polyisoprenylated
benzophenones and biflavonoids are the major medicinally active constituents present in
different parts of Garcinia plants. Though the Western Ghats has a rich diversity of Garcinia
species, only a few species have been exploited for their potential utilities. The rich floristic
wealth can be harnessed profitably by exploiting the advances in phytochemical analytical
techniques. Also, the establishment of an efficient analytical methodology for detection and
estimation of the medicinally active constituents is crucial for quality assessment of derived
herbal products from the Garcinia species. The present chapter provides an overview of
different LC-MS analytical techniques used for quality control of Garcinia species. Further,
detection and estimation of multi-class bioactive constituents in the leaf extracts of nine
Garcinia species in the Western Ghats were reported using a validated UHPLC-ESI- QTOF-
MS/MS method. Among the twenty six multi-class bioactive constituents analysed,
biflavonoids and organic acids were the major class of compounds detected in Garcinia
species. Acid content was high in the two economically important and widely distributed
species, G. gummi-gutta and G. indica, while the biflavonoid content was highest in G.
travancorica followed by G. talbotii.
Keywords: Garcinia species, Western Ghats, Quality control, UHPLC-ESI-QTOF-MS/MS
Introduction
The genus Garcinia belonging to the family Clusiaceae comprises more than 250 species of
tropical trees and shrubs, indigenous to Asia, Southern Africa and Polynesia (Ritthiwigrom et
al., 2013). About 37 species of Garcinia are distributed in the evergreen forest of the Western
Ghats, Gujarat, Andaman and Nicobar Islands and the North Eastern region of India
(Hemshekhar et al., 2011, Sarma et al., 2016). The fruits of several species of Garcinia are
edible and used as spice in traditional Indian cuisines. Different plant parts of Garcinia
species, mostly fruit, fruit rind, leaves and bark have been used worldwide as traditional
medicine in the treatment of various ailments such as obesity, inflammation, microbial
infection, abdominal pain, dysentery, diarrhea, infected wound, leucorrhea, chronic ulcer,
gonorrhea, oxidative stress and cancer (Hemshekhar et al., 2011; Ritthiwigrom et al., 2013).
113
Numerous pharmacological activities such as anticancer, antiobesity, diuretic, anti-

inflammatory, antibacterial, antiviral, antifungal, anti-HIV, antidepressant and antioxidant
have been reported for the Garcinia species (Han et al., 2006; Padhye et al., 2009;
Ritthiwigrom et al., 2013; Xu et al., 2010). The antiobesity effect of Garcinia has been
exploited commercially and several herbal supplements are available in the market.
Previous chemical investigations on the leaves, bark and fruits of Garcinia species have
shown that the major constituents included biologically active biflavonoids, xanthones,
benzophenones and organic acids and the minor constituents were terpenoids, steroids,
flavonoids and phenolic acids (Hemshekhar et al., 2011; Ritthiwigrom et al, 2013). As the
genus Garcinia has received much attention from pharmaceutical industries due to its
extensive use in herbal dietary supplements, the quality control of its extracts in terms of
bioactive constituents is essential to guarantee clinical efficacy and safety. Therefore, it is
important to simultaneously monitor the bioactive constituents for their quality control and
also explore the best suited species in terms of active constituents.
In recent years, numerous research groups reported analytical methods, using various
chromatographic conditions and spectophotometric technologies, to develop quick and
accurate analytical approaches for the identification, structural characterization and
determination of chemical constituents of Garcinia species (Acuna et al., 2012; Aisha et al.,
2012; Bharate et al., 2014; Chattopadhyay and Kumar, 2006, 2007; Jayaprakasha and
Sakariah, 2000; Jena et al., 2002; Ji et al., 2007; Kumar et al., 2013, 2009; Li et al., 2008;
Wittenauer et al., 2012; Zhou et al., 2010; Zhou et al., 2009; Zhou et al., 2008a, 2008b;
Zadernowski et al., 2009).
Quantitative analysis of the major bioactive constituents of Garcinia is essential for
quality control. Untill now only a few constituents (camboginol, garcinol, xanthochymol and
isoxanthochymol) have been quantitatively determined by LC-MS/MS methods in G.
combogia and G. indica (Chattopadhyay and Kumar, 2006, 2007; Bharate et al., 2014;
Kumar et al., 2009). However, many species of Garcinia native to the Western Ghats of India
are still unexplored in terms of their active chemical constituents. The main emphasis of the
present chapter is the application of a validated UHPLC-ESI-MS/MS method for the rapid
detection of multi-class bioactive constituents in the leaf extracts of nine Garcinia species
distributed naturally in the Western Ghats of south India.
1. Bioactive chemical constituents from Garcinia species

The genus Garcinia is a rich source of organic acids, prenylated xanthones, polyisoprenylated
benzophenones, biflavonoids, triterpenoids, phenolic acids and flavonoids which are also
biologically active constituents (Xu et al., 2010; Hemshekhar et al., 2011; Ritthiwigrom et al,
2013). Garcinol, a polyisoprenylated benzophenone isolated from Garcinia species is a
potent bioactive compound possessing antioxidant, anti-bacterial, anti-inflammatory,
anticancer, anti-HIV and antiulcer activities (Hemshekhar et al., 2011; Padhye et al., 2009).
The prenylated xanthones, gambogic acid and α-mangostin isolated from Garcinia species
were found to have antioxidant, antibiotic, antitumor, anti-inflammatory and anticarcinogenic
properties (Han et al., 2006; Ritthiwigrom et al, 2013; Xu et al., 2010). Hydroxycitric acid
(HCA), a potential antiobesity and hypocholesterolaemic agent is present in fruits and leaves
of Garcinia species and used as an ingredient in popular dietary supplements for weight loss
114
(Jena et al., 2002; Padhye et al., 2009). Biflavonoids, triterpenoids, flavonoids and phenolic
acids found in Garcinia are also responsible for various pharmacological activities (Baggett
et al., 2005; Hemshekhar et al., 2011; Ritthiwigrom et al, 2013).
2. Analytical methods used for quality control of Garcinia species

Several analytical methods, including high-performance liquid chromatography coupled to
photodiode array detection/diode array detection (HPLC-PDA/DAD) and gas
chromatography coupled to mass spectrometry (GC-MS) were used to evaluate the quality of
Garcinia species (Acuna et al., 2012; Aisha et al., 2012; Jayaprakasha and Sakariah, 2000;
Jena et al., 2002; Ji et al., 2007; Kumar et al., 2013; Li et al., 2008; Zadernowski et al.,
2009). Most of the previous researchers have developed HPLC-PDA/DAD methods focusing
on the simultaneous determination of only few classes of compounds in one or two Garcinia
species except the work by Acuna et al. (2012).
Jena et al., and Jayaprakasha and Sakariah have developed HPLC-UV methods for the
determination of organic acids (HCA, HCA lactone, oxalic acid, citric acid, tartaric acid and
malic acid) in leaves, fruits, and dried rinds of G. cowa and commercial samples of G.
combogia respectively. Kumar et al. have simultaneously determined the organic acid (HCA
lactone) and xanthones (isoxanthochymol and xanthochymol) in leaves, seeds, fruit rinds and
stem bark of G. indica by HPLC-PDA method. The xanthones were also determined by Aisha
et al, Ji et al and Li et al. using HPLC-PDA method in the fruit rinds of G. mangostana and
in the commercial samples of G. hanburyi.
Acuna et al. has developed an HPLC-PDA method for simultaneous detection and
quantification of three benzophenones (guttiferone A, guttiferone E, and xanthochymol) and
four biflavonoids amentoflavone, fukugiside, fukugetin, and volkensiflavone) in eight
Garcinia species including seven edible fruits, G. aristata, G. hombroniana , G. intermedia,
G. livingstonei, G. mangostana, G. spicata, and G. xanthochymus and the wood of G. kola.
These analyses have shown that G. spicata contained all the seven phytoconstituents and the
highest amounts of guttiferone E and xanthochymol was found in fruits of G. spicata and G.
xanthochymus.
A GC-MS method was also applied for the identification of ten phenolic acids in
various parts (peel, aril and rind) of the mangosteen fruit (G. mangostana) by Zadernowski et
al. Quantification of the identified phenolic acids was carried out by GC coupled to flame
ionization detection (FID) which showed protocatechuic acid as the major phenolic acid in
the peel and rind, whereas p-hydroxybenzoic acid was the predominant phenolic acid in the
aril.
The main drawbacks of the reported methods are low sensitivity, low resolution, and
long analysis time with large solvent consumption and the need of derivatization in some
cases. These drawbacks could be surmounted by using a more sensitive, selective and
validated liquid chromatography tandem mass spectrometry (LC-MS/MS) method. Literature
review revealed that there are a few reports on the development of LC-QTOF-MS/MS
methods for the identification and characterization of xanthones and polyprenylated
acylphloroglucinols in Garcinia species (Wittenauer et al., 2012; Zhou et al., 2010, 2009,
2008a, 2008b). The analytical techniques used for detection and estimation of bioactive
constituents in Garcinia species are summarized in Table 1.
115
Table 1. Analytical techniques used for detection and determination of bioactive constituents in Garcinia species
Garcinia species Plant part Sample preparation Analytical Stationary phase Mobile phase, flow rate Class of compound Reference
used method (mL/min) analyzed
used
G. buchananii Leaf, root Methanol extraction UPLC-ESI- Waters BEH C18 column (2 0.1% HCO2H in H2O and Flavonoids, Stark et al.,
and stem TOF MS × 150 mm, 1.7 μm) MeCN (0.1% HCO2H), FR: biflavonoids, 2015
0.4 xanthones,
benzophenones
G. indica Fruit Methanol-water and LC-ESI- Chromolith Performance 1% FA in water and Polyisoprenylated Bharate et al.,
dichloromethane- MS/MS RP18 column (50 mm × 4.6 acetonitrile, FR: 0.7 benzophenones 2014
methanol extraction mm)
G. indica Fruit rind, Methanol extraction HPLC-PDA Waters Sunfire C18 Acetonitrile - water (90:10, Organic acids and Kumar et al.,
stem bark, column (150 mm × 4.6 mm v/v) and methanol - acetic polyisoprenylated 2013
seed and id, 5 µm) acid (99.5:0.5, v/v), FR: 0.5- benzophenones
leaves 0.8
G. mangostana Fruit Methanol, ethanol HPLC- RP Nucleosil C18 column 0.1% H3PO4 in water and Xanthones Aisha et al.,
and toluene DAD (250 mm × 4.6 mm id, 5 acetonitrile, FR: 1.0 2012
extraction µm)
G. aristata, G. hombroniana, G. Fruit and Methanol extraction HPLC-PDA Phenomenex Synergi 10 mM ammonium acetate Benzophenones and Acuna et al.,
intermedia, G. livingstonei, G. wood Hydro RP-18 column buffer and acetonitrile, FR: biflavonoids 2012
Diversity of Garcinia species in the Western Ghats: Phytochemical Perspective
mangostana, G. spicata, G. (250 mm × 2 mm id, 4 µm) 0.2

xanthochymus and G. kola
G. mangostana Fruit Methylene chloride HPLC– Zorbax Eclipse XDB 2% acetic acid in water and Xanthones Wittenauer et
extraction DAD–MSn column (50 mm × 4.6 mm) 0.5% acetic acid in al., 2012
acetonitrile, FR: 0.6
G. xanthochymus, G. Fruit, twig, Methanol extraction UHPLC- Waters Acquity BEH C8 0.1% FA in 80/20 Polycyclic Zhou et al.,
oblongifolia, G. lancilimba, G. bark and leaf ESI-QTOF- column (100 × 2.1 mm id., water/methanol and 0.1% polyprenylated 2010
xipshuangbannaensis, G. cowa, MS/MS 1.7 µm) FA in acetonitrile, FR: 0.6 acylphloroglucinols
G. subelliptica, G. paucinervis,
G. multiflora, G. yunnanensis
and G. esculenta
G. combogia and G. indica Fruit rind, Methanol extraction HPLC-PDA Spheri-5 RP-8, Brownlee, Acetonitrile: water (80:20) Polyisoprenylated Kumar et al.,
seed and and LC-MS Perkin-Elmer C8column and 1% acetic acid- benzophenones 2009
116
JNTBGRI
JNTBGRI
stem bark (100 × 2.1 mm id, 5 µm) methanol, FR: 0.45-0.8

G. xanthochymus, G. Twig Acetonitrile UHPLC- Waters Acquity BEH C18 0.1% FA in water and 0.1% Polycyclic Zhou et al.,
oblongifolia, G. lancilimba, G. extraction ESI-QTOF- column (100 mm × 2.1 mm FA in acetonitrile, FR: 0.6 polyprenylated 2009
xipshuangbannaensis, G. cowa, MS/MS id, 1.7 µm) acylphloroglucinols
G. subelliptica, G. paucinervis,
G. multiflora, G. yunnanensis
and G. esculenta,
G. mangostana Fruit Aqueous 80% (v/v) GC-MS SPB-1 silica-fused capillary Helium, FR: 28 cm3/min Phenolic acids Zadernowski
methanol extraction column (30 m × 0.25 mm et al., 2009
id, 0.25 μm)
G. hanburyi Commercial Acetonitrile HPLC-PDA SunFire C8 column (2.1 mm Acetonitrile–methanol–0.3% Xanthones Li et al.,
samples extraction × 150 mm id, 3.5μm) aqueous TFA (35.5:33.5:31, 2008
v/v/v), FR: 0.22
G. hanburyi Resin Acetonitrile UHPLC- Waters Acquity BEH C8 0.1% FA in water and 0.1% Caged xanthones, Zhou et al.,
extraction ESI-OTOF- column (100 mm × 2.1 mm FA in acetonitrile, FR: 0.3 2008a
MS3 id, 1.7 µm)
G. xipshuangbannaensis Twig Methanol extraction HPLC-ESI- Waters Acquity BEH C18 0.1% FA in water and 0.1% Polyprenylated Zhou et al.,
OTOF-MS3 column (100 × 2.1 mm id., FA in acetonitrile, FR: 0.3 xanthones 2008b
1.7 µm)
G. mangostana Commercial Acetone extraction HPLC-PDA Phenomenex Luna C18 0.1% TFA in water and Xanthones Ji et al., 2007
samples column (150 0.1% TFA in methanol, FR:
(pericarp) mm × 3.00 mm id, 5 μm) 0.5
G. cambogia and G. indica Fruit rind, Methanol extraction LC-ESI- Brownlee RP-18 column Acetonitrile: water (9:1 v/v) Polyisoprenylated Chattopadhya
seed and MS/MS (100 mm × 2.1 mm id, 5 and 0.5% acetic acid in benzophenones y and Kumar,
stem bark µm) methanol, FR: 2006, 2007;
0.4
G. cowa Leaves, Water extraction HPLC-UV Zorbax C18 (Hewlett- Methanol and Organic acids, Jena et al.,
fruits and and ethanol Packard) analytical column 0.01 M phosphoric acid, FR: 2002
dried rinds treatment (25 cm × 4.6 mm id, 5 µm) 0.7
G. cambogia Commercial 8 mM sulfuric acid HPLC-UV Waters µ -BondapackTM C18 6 mM sulfuric acid, FR: 1.0 Organic acids Jayaprakasha
samples treatment and water column (300 mm × 3.9 mm) and Sakariah,
extraction 2000
FA; formic acid, TFA; trifluoroacetic acid, FR; flow rate
117
Diversity of Garcinia species in the Western Ghats: Phytochemical Perspective
3. UHPLC-MS/MS analysis of Garcinia species in the Western Ghats

A sensitive and efficient UHPLC-ESI-MS/MS method has been developed and validated in
the MRM mode for rapid detection and determination of twenty six multi-class bioactive
constituents in the leaf extracts of nine Garcinia species, viz. G. rubro-echinata, G. gummi-
gutta (L.) Robs. (Syn. G. cambogia Desr.), G. imberti, G. indica, G. morella, G.
pushpangadaniana, G. talbotii, G. travancorica and G. wightii. The sample leaves were
collected from various locations of Kerala, India and the sample code, specimen voucher
number and collection location are shown in Table 2.
Table 2. Sample code, specimen voucher number and collection location of Garcinia species from
Western Ghats, Kerala, India
Sl. Garcinia species Sample Voucher specimen Collection location
No. code number
1 G. rubro-echinata G. re 66419 Chemungi, Thiruvananthapuram
2 G. gummi-gutta G. gg 66446 Palode, Thiruvananthapuram
3 G. indica G. in 66423 Talipparamba, Kannur
4 G. morella G. mr 66418 Chemungi, Thiruvananthapuram
5 G. pushpangadaniana G. ps 66421 Kadalar, Idukki
6 G. talbotii G. tl 50985 Palode, Thiruvananthapuram
7 G. wightii G. wg 50987 Athirappilly, Thrissur
8 G. imberti G. im 66416 Chemungi, Thiruvananthapuram
9 G. travancorica G. tr 66417 Chemungi, Thiruvananthapuram
Methanolic extracts of the leaves were quantitatively analyzed by Waters Acquity UPLCTM
system (Waters, Milford, MA, USA) hyphenated with hybrid linear ion trap triple-quadrupole
mass spectrometer (API 4000 QTRAP™ MS/MS system from AB Sciex, Concord, ON,
Canada) using electrospray (Turbo V) ion source. Chromatographic separation of analytes
was carried out on an Aquity UPLC BEH C18 column (50 mm × 2.1 mm id, 1.7 µm) using
gradient elution of 0.1% formic acid in water and acetonitrile within 7.5 min. The targeted
analytes in the samples were unambiguously identified using authentic standards based on
their MS spectral data and diagnostic fragmentations (Pandey et al., 2015). Structures of
targeted analytes are shown in Figure 1. The developed analytical method was validated as
per International Conference on Harmonization (ICH, Q2R1) guidelines (Pandey et al.,
2015).
The UHPLC-ESI-MS/MS analysis showed significant chemical variation among the nine
Garcinia species (Table 3). Among the twenty six multi-class bioactive constituents, organic
acids were the major class of compounds in G. rubro-echinata, G. gummi-gutta and G.
indica. Hydoxycitric acid lactone or garcinia acid was the major constituent in the leaf extract
of G. rubro-echinata, G. gummi-gutta, and G. indica. The acid content was highest in G.
gummi-gutta (308.0 mg/g) while G. talbotii possess the least acid content (7.0 mg/g).
Literature survey indicated that G. gummi-gutta and G. indica are incorporated into many
pharmaceutical preparations and marketed as popular weight loss products due to the higher
amount of hydoxycitric acid and garcinia acid in their fruit extracts (Jena et al., 2002; Padhye
et al., 2009). Our findings suggested that the leaf extracts of G. gummi-gutta and G. indica
might be a suitable source for swapping fruit extract due to the presence of higher level of
organic acids (308 mg/g, 276 mg/g and 265 mg/g, respectively) (Jena et al., 2002).
118
Table 3. Contents (mg/g) of twenty six investigated bioactive constituents in the leaf extracts of nine
Garcinia species distributed in the Western Ghats
Analytes (mg/g) G. gg G. in G. re G. mr G. ps G. tl G. wg G. im G. tr
Organic acids
Hydroxycitric acid 95.0 120.0 1.75 3.55 3.18 1.2 2.32 0.9930 1.6600
Garcinia acid 213.0 156.0 26.4 6.46 9.01 5.83 6.61 7.3800 9.4500
Phenolic acids
Protocatechuic acid 0.427 0.407 0.67 10.7 0.294 0.341 1.00 0.9890 2.1700
Caffeic acid 0.379 0.578 0.622 0.595 0.263 0.34 0.413 0.1420 1.4200
Ferulic acid 0.094 0.123 0.121 0.191 0.1 0.117 0.078 0.5220 0.0403
Vanillic acid 0.0003 0.099 0.0285 0.001 nd 0.107 0.0005 0.0008 0.0222
Flavonoids
Epicatechin 0.132 0.219 2.55 0.218 1.34 0.199 0.191 0.9240 0.1190
Isoorientin 0.441 0.626 0.297 1.32 0.343 1.02 0.409 0.6070 0.4340
Orientin 0.004 0.147 0.065 2.21 0.011 0.614 0.064 0.5340 0.1260
Isovitexin 1.47 3.03 1.81 3.55 1.67 3.38 1.79 1.4100 2.1000
Vitexin 1.19 2.86 1.37 2.16 1.24 1.59 1.57 1.1800 1.6400
Kaempferol-3-O- 0.022 0.033 0.011 0.006 0.006 0.007 0.011 0.0637 0.2657
rutinoside
Luteolin 0.008 0.059 0.478 0.588 0.066 0.042 0.701 0.1053 0.0830
Quercetin 0.148 0.126 0.188 0.238 0.147 0.077 0.276 0.1920 0.6030
Apigenin 0.416 0.614 0.659 0.724 1.11 0.687 0.485 0.7010 1.4600
Kaempferol 0.246 0.253 0.237 0.289 0.287 0.281 0.274 0.2820 0.2320
Biflavonoids
Fukugiside 0.066 0.075 0.020 nd 1.21 52.10 0.141 0.2910 35.3000
GB-2 bdl 0.338 bdl 6.14 2.077 28.3 0.683 0.3850 17.1333
GB-1 0.215 0.231 0.219 399 279 25.8 46.4 22.1000 72.0000
GB-1 a bdl bdl bdl 22.1 13.4 6.24 2.143 2.4700 3.9000
Amentoflavone 0.309 0.309 2.98 2.51 3.06 1.443 0.046 0.0440 0.0467
Xanthones
Mangostin 0.002 0.017 0.002 0.085 0.024 0.002 0.008 0.0056 0.0015
Gambogic acid 2.79 2.86 2.78 1.79 2.80 2.89 2.87 2.8500 2.7800
Benzophenones
Garcinol 0.593 0.383 0.37 0.318 0.284 0.262 0.267 0.3290 0.2900
Triterpenoids
Ursolic acid 0.742 0.73 0.915 1.25 1.35 0.92 0.757 1.4700 2.6200
Betulinic acid 2.44 1.37 1.55 1.83 1.64 3.75 1.19 1.3200 2.6500
G.re-G. rubro-echinata; G.gg-G. gummi-gutta; G.in-G. indica; G.mr-G. morella; G.ps-G. pushpangadaniana; G.tl-G.
talbotii; G.wg-G.wightii; G.im-G.imberti, G.tr-G.travancorica; nd- not detected; bdl- below detection level (Pandey et al.,
2015)
Biflavonoids were the major class of compounds in in G. imberti, G. morella, G.

pushpangadaniana, G. talbotii, G. travancorica and G. wightii. The biflavonoid content was
highest in G. morella, followed by G. pushpangadania. Among the five biflavonoids
screened, GB-1 and GB-1a were the major ones distributed in the Garcinia species. Garcinia
biflavonoid, GB-1 was the major constituent in the leaf extract of G. morella, G.
pushpangadaniana and G. wightii. Fukugiside, GB-2 and GB-1were the major components in
the leaf extracts of G.talbotii.
119
Organic acids Phenolic acids Prenylated xanthones
O O OH OH
OH HO O
O OH O O O HO O HO
O OH
HO OH OH
O
OH OH OH HO O O O
HO O
O OH O OH OH OH
Protocatechuic acid Caffeic acid Ferulic acid Vanillic acid HO O OH
Hydroxycitric acid Garcinia acid
-mangostin HO O O O
Flavonoids O O
OH OH OH OH
HO
OH HO HO
OH Gambogic acid
O
OH HO
O OH HO HO O OH HO HO
O OH HO O
HO HO O HO O HO O HO O
OH OH OH
Epicatechin HO HO OH OH
OH OH
OH O O O
OH O
OH Isoorientin Isovitexin Polyisoprenylated benzophenone
Orientin Vitexin
HO OH
OH OH
O O OH OH HO OH HO
OH
HO O O OH HO O HO O
O
O OH
OH O OH
HO HO HO
O O
OH O O OH OH O O OH OH O
Quercetin Apigenin Kaempferol Garcinol
HO O Luteolin
OH
Kaempferol-3-O-rutinoside Biflavonoids
OH
OH OH O
OH OH
Triterpenoids
HO
O H
HO OH HO O O H
O OH O O
OH OH OH HO HO
HO HO
O OH OH HO
HO H
HO OH O O OH
O H H H O
O O O HO
OH O O OH OH O O OH O OH Ursolic acid
HO O Betulinic acid
OH OH O OH
HO HO
OH O OH
OH HO HO OH
Fukugiside GB-2 GB-1 GB-1a Amentoflavone
Figure 1. Structures of targeted analytes

Among the nine Garcinia species studied, G. rubro-echinata, G. gummi-gutta, and G. indica
were distinct by high content of acids compared to other species. Among the 4 biflavonoids
screened, only amentoflavone possess I(5′)-II(8) biflavonoid linkage, whereas the other 3
biflavonoids were with I(3)-II(8) linkage, the most prevalent interflavonoid linkage reported
in Garcinia biflavonoids. It is interesting to note that the three species G. rubro-echinata, G.
gummi-gutta, and G. indica were also distinct with regard to the biflavonoid distribution,
where amentoflavone was present in higher quantity in the three species compared to the
common I(3)-II(8) biflavonoids.
Conclusions
The developments in the field of analytical technologies improved fingerprinting
authentication and quantitative determination of medicinally active constituents from plants
and their commercial products. The selectivity and specificity in phytochemical analysis have
increased significantly through hyphenation of chromatographic separation and mass
spectrometry detection as in the case of LC-MS. Twenty six multi-class bioactive
constituents in the leaf extracts of nine Garcinia species of the Western Ghats were detected
and estimated through the UHPLC-MS/MS analysis. The UHPLC system combined with
mass spectrometry detection in MRM acquisition mode enables significant reductions in
separation time, solvent consumption and ensures excellent selectivity and sensitivity for
quantitative analyses in shorter duration. In G. rubro-echinata, G. gummi-gutta and G. indica,
organic acids were present in higher level, while in other Garcinia species (G. morella, G.
pushpangadaniana, G. talbotii and G. wightii, G. imberti and G. travancorica) biflavonoids
were the major class of compounds.
120
References
1. Acuna UM, Dastmalchi K, Basile MJ and Kennelly EJ. 2012. Quantitative high-performance
liquid chromatography photo-diode array (HPLC-PDA) analysis of benzophenones and
biflavonoids in eight Garcinia species. J. Food Compst. Anal., 25(2), 215-220.
2. Aisha A, Abu-Salah K, Siddiqui M, Ismail Z and Majid AA. 2012. Quantification of α, β-and
γ mangostin in Garcinia mangostana fruit rind extracts by a reverse phase high performance
liquid chromatography. J. Med. Plant Res., 6(29), 4526-4534.
3. Baggett S, Protiva P, Mazzola EP, Yang H, Ressler ET, Basile MJ, Weinstein IB and
Kennelly EJ. 2005. Bioactive benzophenones from Garcinia xanthochymus Fruits. J. Nat.
Prod., 68(3), 354-360.
4. Bharate JB, Vishwakarma RA, Bharate SB, Kushwaha M and Gupta AP. 2014.
Quantification of the polyisoprenylated benzophenones garcinol and isogarcinol using
multiple reaction monitoring LC/electrospray ionization-MS/MS analysis of ultrasound-
assisted extracts of Garcinia indica fruits. J. AOAC Int., 97(5), 1317-1322.
5. Chattopadhyay SK and Kumar S. 2006. Identification and quantification of two biologically
active polyisoprenylated benzophenones xanthochymol and isoxanthochymol in Garcinia
species using liquid chromatography-tandem mass spectrometry. J. Chromatogr. B, 844(1),
67-83.
6. Chattopadhyay SK and Kumar S. 2007. A rapid liquid chromatography-tandem mass
spectrometry method for quantification of a biologically active molecule camboginol in the
extract of Garcinia cambogia. Biomed. Chromatogr., 21(1), 55-66.
7. Han QB, Yang L, Wang YL, Qiao CF, Song JZ, Sun HD and Xu HX. 2006. A pair of novel
cytotoxic polyprenylated xanthone epimers from Gamboges. Chem. Biodivers., 39(1), 101-
105.
8. Hemshekhar MK, Sunitha M, Sebastin Santhosh S, Devaraja K, Kemparaju BS, Vishwanath
SR, Niranjana and Girish KS. 2011. An overview on genus Garcinia: Phytochemical and
9. Jayaprakasha GK and Sakariah KK. 2000. Determination of (-)-hydroxycitric acid in
commercial samples of Garcinia cambogia extracts by liquid chromatography using
ultraviolet detection. J. Liq. Chromatogr. Relat. Technol., 23, 915-923.
10. Jena BS, Jayaprakasha GK and Sakariah KK. 2002. Organic acids from leaves, fruits, and
rinds of Garcinia cowa. J. Agric. Food Chem., 50(12), 3431-3434.
xanthones in Garcinia mangostana L. by LC-PDA and LC-ESI-MS. J. Pharm. Biomed.
Anal., 43(4), 1270-1276.
12. Kumar S, Sharma S and Chattopadhyay SK. 2009. High-performance liquid chromatography
and LC-ESI-MS method for identification and quantification of two isomeric
polyisoprenylated benzophenones isoxanthochymol and camboginol in different extracts of
Garcinia species. Biomed. Chromatogr., 23(8), 888-907.
13. Kumar S, Sharma S and Chattopadhyay SK. 2013. Rapid and sensitive HPLC-PDA method
for simultaneous identification and quantification of dietary weight reducing compound
hydroxy citric acid lactone and chemo preventive compounds isoxanthochymol and
xanthochymol in Garcinia indica. Int. Food Res. J., 20(1), 397-402.
14. Li SL, Song JZ, Han QB, Qiao CF and Xu HX. 2008. Improved high‐performance liquid
chromatographic method for simultaneous determination of 12 cytotoxic caged xanthones in
121
gamboges, a potential anticancer resin from Garcinia hanburyi. Biomed. Chromatogr., 22,
637-644.
15. Padhye S, Ahmad A, Oswal N and Sarkar FH. 2009. Emerging role of garcinol, the
antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs. J. Hematol.
Oncol., 2(1), 1-13.
16. Pandey R, Chandra P, Kumar B, Srivastva M, Aravind AA, Shameer PS and Rameshkumar,
KB. 2015. Simultaneous determination of multi-class bioactive constituents for quality
assessment of Garcinia species using UHPLC-QqQLIT-MS/MS. Ind. Crops Prod., 77, 861-
872.
17. Ritthiwigrom T, Laphookhieo S and Pyne SG. 2013. Chemical constituents and biological
activities of Garcinia cowa Roxb. Maejo Int. J. Sci. Technol., 7, 212-231.
18. Sarma J, Shameer PS, Mohanan NN. 2016. A new species of Garcinia (Clusiaceae) from
Assam, North East India. Phytotaxa, 252 (1), 73-76.
19. Stark TD, Losch S, Wakamatsu J, Balemba OB, Frank O and Hofmann T. 2015. UPLC-ESI-
TOF MS-Based Metabolite profiling of the antioxidative food supplement Garcinia
buchananii. J. Agric. Food Chem., 63, 7169-7179.
20. Wittenauer J, Falk S, Weisz US and Carle R. 2012. Characterisation and quantification of
xanthones from the aril and pericarp of mangosteens (Garcinia mangostana L.) and a
mangosteen containing functional beverage by HPLC-DAD-MSn. Food Chem., 134(1), 445-
452.
21. Xu G, Kan WLT, Zhou Y, Song JZ, Han QB, Qiao CF, Cho CH, Rudd JA, Lin G and Xu
HX. 2010. Cytotoxic acylphloroglucinol derivatives from the twigs of Garcinia cowa. J. Nat.
Prod., 73(2), 104-108.
22. Zadernowski R, Czaplicki S and Naczk M. 2009. Phenolic acid profiles of mangosteen fruits
(Garcinia mangostana). Food Chem.,112(3), 685-689.
23. Zhou Y, Lee S, Choi FFK, Xu G, Liu X, Song JZ, Li SL, Qiao, CF and Xu HX. 2010.
Qualitative and quantitative analysis of polycyclic polyprenylated acylphloroglucinols from
Garcinia species using ultra performance liquid chromatography coupled with electrospray
ionization quadrupole time-of-flight tandem mass spectrometry. Anal. Chim. Acta., 678(1),
96-107.
24. Zhou Y, Huang SX, Song JZ, Qiao CF, Li SL, Han QB and Xu HX. 2009. Screening of
polycyclic polyprenylated acylphloroglucinols from Garcinia species using precursor ion
discovery (PID) scan and ultra performance liquid chromatography electrospray ionization Q-
TOF tandem mass spectrometry. J. Am. Soc. Mass. Spectrom., 20(10), 1846-1850.
25. Zhou Y, Liu X, Yang J, Han QB, Song JZ, Li L, Qiao CF, Ding LS and Xu HX. 2008a.
Analysis of caged xanthones from the resin of Garcinia hanburyi using ultra-performance
liquid chromatography/electrospray ionization quadrupole time-of-flight tandem mass
spectrometry. Anal. Chim. Acta., 629(1), 104-118.
26. Zhou Y, Han QB, Song JZ, Qiao CF and Xu HX. 2008b. Characterization of polyprenylated
xanthones in Garcinia xipshuanbannaensis using liquid chromatography coupled with
electrospray ionization quadrupole time-of-flight tandem mass spectrometry. J. Chromatogr.
A, 1206(2), 131-139.
122
Chapter 7
Morphological, chemical and molecular taxonomy of a new Garcinia

species- Garcinia pushpangadaniana Sabu et al.
P.S. Shameer1, K. B. Rameshkumar2, A. R. Sivu3, T. Sabu1, N. S. Pradeep4 and N. Mohanan1*
1
2
4
Microbiology Division
3
Department of Botany, NSS College Nilamel, Kollam- 691535, Kerala, India
*
Abstract
The genus Garcinia is an important component of the forest flora of the Western Ghats, and
the region hosts a wide diversity with several taxa, including ones yet to be described. The
genus is considered as a taxonomically difficult one due to the complexity and diversity in
floral characteristics. The present chapter describes the biosystematics of a new Garcinia
species, G. pushpangadaniana, described from the Western Ghats, using chemosystematics
and molecular systematics. The HPTLC profile and volatile chemical profiles of the leaves
supported the species status and allied nature to G. xanthochymus and G. talbotii. Molecular
taxonomy using the chloroplast coding region matK could demarcate the new taxon as a
distinct species, closely allied to the species G. xanthochymus and G. talbotii.
Keywords: Garcinia pushpangadaniana, Garcinia xanthochymus, Garcinia talbotii,

Chemotaxonomy, Molecular taxonomy
Introduction
The forests of the Western Ghats, with nearly 7500 flowering plants, is a rich repository of
plant wealth with several new species having been discovered from the region (Nayar et al.,
2014). The region hosts wild relatives of many important spice crops and food crops and also
is the centre of origin and diversity of several such plant groups. The genus Garcinia is an
economically important group of plants distributed in the tropical regions of the world. The
Western Ghats is a centre of diversity of Garcinia species in India. Out of the 37 Garcinia
species distributed in India, 7 are endemic to the Western Ghats.
The genus Garcinia is considered as a taxonomically difficult one due to the
complexity and diversity in floral characteristics with many unresolved phylogenic issues
surrounding the genus. Characteristic differences in the floral architecture were observed
even among closely related taxa of Garcinia (Gustafsson et al., 2002, Sweeney, 2008).
Morphological characters are known to be affected by developmental and environmental
factors and in the case of Garcinia species, an unusual evolutionary plasticity has been
generally observed and the classification of Garcinia species and its phylogeny solely
depending on morphological characters proved to be more uncertain. The incorporation of
biosystematics in such taxonomically difficult groups will allow classifications using new
descriptors and methods that yield more robust inter relations.
123
Biosystematics based on secondary metabolite profile has proven as an efficient

supportive tool for plant systematics. The genus Garcinia is characterized by the presence of
a large number of secondary metabolites such as xanthones, benzophenones and biflavonoids,
in addition to volatile secondary metabolites (Hemsekhar et al., 2011). Several attempts have
been made to evaluate the phylogeny among Clusiaceae members through secondary
metabolite profiling (Waterman and Hussain, 1983). Among the secondary metabolites,
volatile chemicals can efficiently be utilized for chemotaxonomic purposes (Labra et al.,
2004). Though the volatile chemical profile reflects the evolutionary history, it is more
indicative of the ecological conditions (Nogueira et al., 2001).
In the last decade, new valuable tools based on DNA analysis were made available for
taxonomic studies (Winfield, 2003; Labra et al., 2004). The use of DNA genotyping has been
instrumental in solving controversial taxon attributions by comparing genotypes
independently from phenotypes. DNA genotyping offers the unique capacity to classify
accessions regardless of environmental condition and plant growth stage.
A new taxon of the genus Garcinia has been collected from the forests of the Western
Ghats. In the present chapter, the efficiency of chemotaxonomy and molecular taxonomy to
support the species status of the new Garcinia taxon has been evaluated.
1. Morphological studies
The new taxon Garcinia pushpangadaniana T. Sabu, N. Mohanan, Krishnaraj, & Shareef
(Holotype TBGT 72601) was collected from Kadalar forests, Idukki district, Kerala (Figure
1). Detailed evaluation of the vegetative and reproductive morphological features revealed
the new taxon has distant relation to G. xanthochymus and G. talbotii with pentamerous
flowers and the absence of rudimentary pistils in male flowers (Table 1). G. xanthochymus
Hook. f. ex T. Anderson is an indigenous tree in Indo-Malay region, and its distribution in
India is extended to the evergreen to semi-evergreen forests (100-1000m) of North East India
and Andaman Nicobar Islands. G. talbotii Raizada ex. Santapau is an endemic species to the
evergreen to semi-evergreen forests (100-350 m) of the Western Ghats. However, the
prominent morphological differences in shape of leaf, pedicel length of male and female
flowers, nature of staminodes, number of stigma, ovary and seeds, features in fruits and seeds
qualify the new taxa to be a distinct species. The demarcating feature of the new taxon is the
large fruits that weigh upto 750 g, with irregular ridges on the fruit surface.
Table 1. Characteristic morphological features of the new taxon in comparison with G. talbotii and G.
xanthochymus
Plant part G. talbotii G. xanthochymus G. pushpangadaniana
Leaf Ovate, elliptic-oblong or Linear- oblong or oblong- Elliptic- oblong.
lanceolate. lanceolate. Acute or obtuse at apex
Emarginate or acute at apex Acute or acuminate at apex 14-20 x 6-8 cm.
9-22 x 4-8 cm. 12-35 x 4-10 cm.
Flower Fascicled or pseudo spikes Fascicled Fascicled
Stamens 8-10 in each of 5 long Stamens 15-20 in 5 phalanges Stamens 12-15 in
clawed, spathulate bundles. bundles of 3-5 each. phalanges
Stigma 3-4 lobed, peltate Stigma 5 lobed, oblong Stigma 6-8 lobed, oblong
Ovary 3-4 locular. Ovary 5 locular Ovary 6-8 locular.
Fruit Broadly oblong, smooth Subglobose, smooth. Irregular ridges on the
Up to 4 cm diam. ca. 6.5 cm diam surface, ca. 12 x 11 cm
Weight: Upto 45g Weight: Upto 55 g diam. Weight: Upto 750g
Seeds Oblong Oblong Plano convex
1-3, up to 2.5 cm 1-4, up to 3.5 x 1.8 cm 2-6, ca. 2 x 1 cm
Latex White or yellowish white Milky white or pale green turning Milky white
yellow
124
Figure 1. G. pushpangadaniana A. Habit, B. Stem bark, C. Leaf, D. Male flower, E. Female flower,
F. Seed and G. Fruit
Dichotomous key prepared for G. pushpangadaniana and related species

Stamens in 5 phalanges; sepals and petals 5 rarely 4
Leaves more than thrice as long as abroad, over 30 cm long; berry with distinct mamilla or
beak………………………………...................................................G. xanthochymus
Leaves less than twice as long as broad, less than 20 cm long; berry without distinct mamilla or beak
Fruit large, without any pulp, irregularly ridged on the surface, seeds
planoconvex……………………………………………..................G. pushpangadaniana
Male flowers fascicled or pseudo spikes stigmatic lobes 3- 4…… G. talbotii
2. Chemotaxonomy of the new species

The use of distribution patterns of secondary metabolites is well established as a major tool
for characterize, classify and describe taxa. The vast information of secondary metabolites
can also be utilized for investigating population structures, species and phyletic relationships
and evolutionary status. The genus Garcinia is characterized by the presence of a large
number of secondary metabolites with diverse structural features such as xanthones,
125
benzophenones, flavonoids, biflavonoids and terpenoids and the vast data on secondary
metabolites has been utilised successfully to demarcate species (Waterman and Hussain,
1983).
2.1. Chemotaxonomy based on HPTLC profiles

The versatile and cost effective analytical tool HPTLC allows us to analyze up to 20 plants in
a single analytical run and the phytochemical profile can yield valuable information on plant
identity. The HPTLC profile can be utilized as very detailed differentiating fingerprints of
different species, often closely related species that would otherwise be impossible to
distinguish from each other physically (Reich and Schibli, 2007).
In the present study, the leaf methanol extracts were analysed using Camag HPTLC
system, using silica gel HPTLC plates (Kieselgel 60 F 254, 20 cm × 20 cm, 0.2 mm
thickness, Merck, Germany). The extracts were spotted by means of Camag Linomat V fitted
with a Hamilton microlitre syringe. The plates were developed using chloroform: methanol
(17:3) in the CAMAG twin-trough glass chamber, previously saturated with the solvent for
30 minutes. The mobile phase compositions were chosen after testing different solvent
systems of varying polarity. The flavonoid profile was obtained on exposure of the plate to
NH3 vapour.
Figure 2. HPTLC profile of the leaf methanol extract along with 11 other Garcinia species A. 366 nm
after exposure to NH3. B. 366 nm after derivatisation (1. G. gummi-gutta; 2. G. cowa, 3. G. rubro-
echinata, 4. G. imberti, 5. G. indica, 6. G. mangostana, 7. G. morella, 8. G. pushpangadaniana (Ist
acc.), 9. G. pushpangadaniana (IInd acc.), 10. G. talbotii, 11. G. xanthochymus, 12. G. travancrica,
13. G. wightii)
Biflavonoids, xanthones and benzophenones are the major phenolic compounds present in
Garcinia species and the HPTLC of the methanol extracts represents the phenolic profile,
especially the biflavonoids that shows intense fluorescence under exposure to NH3 vapour.
The secondary metabolite profile revealed that G. xanthochymus, G. talbotii and the new
taxon comes under the same group and the presence of characteristic spots to the new taxon
supports its species status (Figure 2).
2.2. Chemotaxonomy based on leaf volatile chemical profiles

Standardized descriptors based on volatile oil constituents have been proposed as an efficient
tool for differentiation of plants. However, the use of volatile oil constituents for species
differentiation is limited by the fact that several environmental factors may influence the
plant chemical composition (Labra et al., 2004 and Grayer et al., 1996).
126
Volatile chemical profiles of the leaves were studied using GC-MS analysis of the
essential oils. The essential oils were isolated from fresh leaves by hydrodistillation for 3h
using Clevenger type apparatus. The oils were analyzed by gas chromatography methods.
The GC-FID analysis was carried out on a Varian CP-3800 gas chromatograph equipped with
a flame ionization detector (FID) and a CP Sil 8CB fused silica capillary column (30m ×
0.32mm, film thickness- 0.25m). The GC/MS analysis was done on a Hewlett Packard 6890
gas chromatograph fitted with a cross-linked 5% phenyl methyl siloxane HP-5 MS capillary
column (30m × 0.32mm, film thickness- 0.25m) coupled with a 5973 series selective mass
detector. The constituents were identified by retention indices calculated using homologues
of n-alkanes (C8-C22) (Dool and Kratz 1963), comparing mass spectra with published data
(Adams, 2007) and by mass spectra library search (Wiley 275 and NIST).
Gas chromatography- mass spectrometry (GC-MS) studies of the leaf essential oils
resulted in the identification of 58 volatile compounds in all the three species (Table 2). The
major volatile constituents of all the three species, the sesquiterpenoids, were derived from
trans, trans farnesyl pyrophosphate (FPP), through mevalonic acid pathway, pointing to the
allied nature of the species. However, in the new taxon compared to other species,
monoterpenoids (2.8%) biosynthesized through trans geranyl pyrophosphate (GPP) were also
present, while in G. xanthochymus, diterpenoids (4.4%) biosynthesized through trans geranyl
geranyl pyrophosphate (GGPP) were exclusively present. The presence of monoterpenoids
formed from a distinct biosynthetic pathway support the species status for the new taxon, as
elucidated through morphological studies. The presence of more complicated diterpenoids
(C20H32) in G. xanthochymus compared to the simple monoterpenoids (C10H16) and
sesquiterpenoids (C15H24) suggests that G. xanthochymus is more evolved in the group.
Table 2. Essential oil composition of the leaves of Garcinia pushpangadaniana, Garcinia

xanthochymus and Garcinia talbotii
Compound RRI G. xan (%) G. pus (%) G. tal (%)
Z-β-Ocimene 1032 -- 0.2 --
Linalool 1095 -- 1.8 --
Terpineol 1186 -- 0.4 --
Geraniol 1249 -- 0.4 --
δ-Elemene 1338 0.3 0.3 --
α-Cubebene 1348 0.9 0.7 0.7
Cyclosativene 1371 0.4 -- --
α-Ylangene 1373 -- 0.8 --
α-Copaene 1376 13.0 3.1 27.0
β-Bourbonene 1387 3.2 6.8 0.1
β-Cubebene 1387 -- 0.4 --
β-Elemene 1390 4.6 -- --
β-Caryophyllene 1419 17.0 11.4 30.4
β-Copaene 1430 1.6 -- 0.1
β-Gurjunene 1433 -- -- 2.2
-Elemene 1434 0.1 0.4 --
Aromadendrene 1439 0.3 1.1 1.6
α-Humulene 1452 6.6 3.2 10.7
cis-Cadina-1(6)-4-diene 1461 -- 1.4 0.1
α-Acoradiene 1464 -- -- 0.1
-Gurjunene 1475 1.2 -- 3.1
-Muurolene 1478 12.5 11.7 3.8
127
Amorpha-4,7 (11)-diene 1479 0.1 -- --

α-Amorphene 1483 -- -- 1.3
β-Selinene 1489 0.1 0.6 --
δ-Selinene 1492 3.2 0.9 --
trans-Muurola-4(14)-5-diene 1493 9.0 -- --
-Amorphene 1495 -- 2.6 --
α-Muurolene 1500 1.2 3.7 --
δ-Amorphene 1511 -- 1.2 --
-Cadinene 1513 2.7 12.4 --
δ-Cadinene 1522 4.6 13.1 --
trans Cadina 1,4-diene 1533 0.1 1.0 0.1
Cadina-1(2),4-diene 1535 -- -- 0.9
α-Cadinene 1537 0.4 1.4 0.1
Cadala-1(10),3,8-triene 1540 -- -- 0.3
α-Calacorene 1544 0.3 1.2 --
Germacrene B 1559 0.5 0.4 --
Nerolidol 1561 -- 0.4 --
Epiglobulol 1576 -- -- 0.2
Spathulenol 1577 0.1 -- --
Caryophyllene oxide 1582 2.3 0.8 2.6
Globulol 1590 -- -- 0.1
Cubeban-11-ol 1595 -- -- 0.1
Humulene epoxide II 1608 0.4 -- 0.5
1,10-di epi Cubenol 1618 -- -- 1.2
α-Corocalane 1622 -- 0.2 --
1-epi-Cubenol 1627 0.1 1.5 0.1
cis-Cadina-4-en-7-ol 1635 0.9 --
allo Aromadendrene epoxide 1639 0.4 -- --
Caryophylla-4(12),8(13)-diene 1639 -- -- 0.1
α-Muurolol 1644 -- 0.5 0.2
Cubenol 1645 0.1 -- 0.8
α-Cadinol 1652 0.5 0.9 0.1
Cis-calamenen-10-ol 1660 0.1 -- --
14-Hydroxy 9-epi-Z- 1666 -- -- 0.5
caryophyllene
14-Hydroxy 9-epi-E- 1668 -- -- 0.1
caryophyllene
3E-Cembrene A 1947 4.4 -- --
Total (%) 92.3 87.8 89.2
Monoterpenoids Nil 2.8 Nil
Sesquiterpene- Hydrocarbons 83.9 79.8 82.6
Sesquiterpene-Oxygenated 4 5.2 6.6
Diterpenoids 4.4 Nil Nil
RRI: Relative retention index calculated on HP-5 column
Similarity and cladistic analyses performed statistically based on the distribution of 58

volatile chemicals using SPSS software (ver.16.0) showed G. pushpangadaniana distinct
from other two species (Figure 3, Table 3). The species is more related to G. xanthochymus
62%), compared to G. talbotii (39%).
128
Figure 3. Dendrogram based on essential oil constituents of the leaves of Garcinia

pushpangadaniana, Garcinia xanthochyma and Garcinia talbotii.
Table 3. Similarity matrix between three Garcinia species of the Western Ghats based on volatile
chemical profile.
Case Correlation between vectors of values
1:1 2:2 3:3
1:1 1.000 .391 .622
2:2 .391 1.000 .794
3:3 .622 .794 1.000
3. Molecular taxonomy
Molecular taxonomic approaches may be defined as DNA based methods that permit an exact
and rapid method of distinguishing specimens based on their variation in genetic
composition. Molecular markers are a direct assay of hereditary material and unlike
morphological markers, molecular markers are not prone to environmental influences and can
complement data from descriptors such as morphological characters (Mba and Tohme, 2005).
Molecular systematics has become a major tool used in conservation biology for describing
biodiversity, discriminating among taxa and establishing likely paths of evolution through
phylogenetic analysis (Avise, 1989; Soltis et al., 1999).
In the present study, Genomic DNA was isolated from young leaves using DNeasy
plant DNA isolation kit (Qiagen). The PCR amplification was carried out in a PCR thermal
cycler (GeneAmp PCR System 9700, Applied Biosystems). The sequence quality was
checked using Sequence Scanner Software v1 (Applied Biosystems). Sequence alignment
and required editing of the obtained sequences were carried out using Geneious Pro v 5.6.
The phylogenetic analyses of 28 accessions of 10 Garcinia species were done using matK
with Clusia criuva of Clusiaceae family as the out group member (ncbi-TNS:SK08071206).
The analysis involved 28 nucleotide sequences. In the present study, G. pushpangadaniana,
G. talbotii and G. xanthochymus comes under separate clad, in congruence with the
morphological and chemical classifications. The dendrogram clearly delimits the species
status of G. pushpangadaniana and is more allied to G. talbotii (Figure 3).
129
Figure 4. Phylogram based on matK loci of 28 accessions of 10 Garcinia species and the out group
Clusia criuva
Conclusions
The HPTLC profile as well as the biosynthetic evaluation of the volatile terpenoids supported
the species status for the new taxon. The molecular phylogeny also points to its proximity to
G. talbotii and G. xanthochymus as elucidated through morphological evaluation. The present
study highlights the importance of combined analysis of morphological traits, chemical
profiles and genetic diversity that represents the optimal approach to assign species status to a
new taxon.
References
1. Adams RP. 2007. Identification of Essential Oil Components by Gas
Chromatography/Mass Spectrometry. Fourth edition. Allured Pub. Co., Carol Stream, IL.
2. Avise JC. 1989. A role for molecular genetics in the recognition and conservation of
endangered species. Trends Ecol. Evol. 4, 279-281.
463-471.
4. Grayer RJ, Kite GC, Goldstone FJ, Bryan SE, Paton A and Putievsky E. 1996.
Infraspecific taxonomy and essential oil chemotype in sweet basil, Ocimum basilicum.
Phytochemistry, 43, 1033-1039.
130
5. Gustafsson MHG, Bittrich V and Stevens PF. 2002. Phylogeny of Clusiaceae based on
rbcL sequences. Internat. J. Plant Sci. 163, 1045- 1054.
6. Hemshekhar M, Sunitha K, Santhosh MS, Devaraja S, Kemparaju K, Vishwanath BS and
Girish KS. 2011. An overview on genus Garcinia: phytochemical and therapeutical
aspects. Phytochem. Rev., 10(3), 325-351.
7. Labra M, Miele M, Ledda B, Grassi F and Mazzei M. 2004. Morphological
characterization, essential oil composition and DNA genotyping of Ocimum basilicum L.
cultivars. Plant Sci., 167, 725-731.
8. Mba C and Tohme J. 2005. Use of AFLP markers in surveys of plant diversity. Meth.
Enzymol., 395, 177-201.
9. Nayar TS, Beegam AR and Sibi M. 2014. Flowering plants of the Western Ghats, India.
JNTBGRI, Thiruvananthapuram.
10. Nogueira PC, Bittrich V, Shepherd GJ, Lopes AV and Marsaioli AJ. 2001. The ecological
and taxonomic importance of flower volatiles of Clusia species (Guttiferae).
11. Reich E and Schibli A. 2007. High-Performance Thin-Layer Chromatography for the
Analysis of Medicinal Plants. Thieme, New York.
12. Soltis PS, Soltis DE and Chase MW. 1999. Angiosperm phylogeny inferred from multiple
genes as a tool for comparative biology. Nature, 402, 402-404.
15. Winfield MO, Wilson PJ, Labra M and Parker JS. 2003. A molecular analysis of
Gentianella ssp. in Britain. Plant Syst. Evol., 267, 137-151.
131
Chapter 8
Diversity of Malabar Tamarind (Garcinia gummi-gutta (L.) N. Robson) in

the Western Ghats- Morphological and phytochemical evaluation
P. S. Shameer1, K. B. Rameshkumar2, T. Sabu1 and N. Mohanan1*
1
2
Palode, Thiruvananthapuram- 695 562, Kerala, India
*
Abstract
Garcinia gummi-gutta (L.) Robs. (Clusiaceae) is an economically important fruit crop and the
most widely distributed species in the Western Ghats of Kerala. The diversity of G. gummi-
gutta in terms of morphological and chemical characters is discussed in this chapter. Three
varieties of the species viz; G. gummi-gutta (L.) Robs. var. gummi-gutta, G. gummi-gutta var.
papilla (Wight) N. P. Sing., and G. gummi-gutta var. conicarpa (Wight) N. P. Sing., are
reported in India. The variety conicarpa is morphologically distinct by the absence of leaf
ligules and by the arrangement of stamens in a convex torus head, in addition to the conical
nature of fruits. The difference in morphological variation has been manifested in chemical
constitution as well. Dendrogram based on leaf volatile chemical distribution of the three
varieties revealed nearly 75% correlation between var. gummi-gutta and var. papilla, while
variety conicarpa showed less than 20% similarity with the other two varieties. HPTLC
analysis also showed distinct chemical profile for the variety conicarpa. The morphological
and chemical variation of G. gummigutta var. conicarpa suggests species status for the
variety. The diversity among cultivated accessions of var. gummi-gutta is also discussed in
detail.
Keywords: G. gummi-gutta var. gummi-gutta, G. gummi-gutta var. papilla, G. gummi-gutta

var. conicarpa, Leaf essential oils
Introduction
Garcinia species are an important component of the forest flora of the Western Ghats, with 9
species and 2 varieties, of which 7 species and 2 varieties are endemic to the region. Garcinia
gummi-gutta (L.) Robs. the most widely distributed species among these, is also an
economically important fruit crop of Kerala. The fruits are popularly known as Malabar
tamarind or Kudampuli whose dried pericarp is used as a condiment and is used as an
alternative of tamarind to impart a special flavour and taste to curries in Kerala (Anonymous,
1950). Also the fruits are commercially important as a rich source of the much valued anti-
obesity phytochemical hydroxycitric acid and several industrial units are located in central
Kerala for extracting the value added product from the fruits (Hemesekhar et al., 2011).
Though three varieties are reported, literature review and herbarium specimen
analysis revealed ambiguity in proper demarcation of the varieties. In this background, male
132
and female accessions of the varieties were collected from different parts of the Western
Ghats and the present chapter elaborates the morphological features of the varieties along
with comparison of chemical profile. Moreover, the diversity among the cultivated variety
has also been evaluated critically.
1. Taxonomical history of the Garcinia gummi-gutta

Carl Linnaeus described the species Cambogia gummi-gutta L., in Gen. Pl., ed. 5: (1754)
with a short description and Van Rheede referred the material as ‘Coddam-pulli’ in Hortus
Malabaricus (Van Rheede, 1678). A combination nova was proposed for Cambogia gummi-
gutta L. and G. cambogia (Gaertn.) Desr. (Desrous, 1792) by Robson as G. gummi-gutta (L.)
N. Robson (Robson, 1968). Though Robert Wight proposed Garcinia conicarpa Wight
[Wight, Icon. (Pl. Ind. Orient. t. 121. 1839 & Ill. Ind. Bot. 1.126. 1840, TYPE: Madras,
Shevagherry hills, 1836, ex. Herb, Wight 142 (CAL)], the taxon was further treated by T.
Anderson as a variety of G. cambogia (Gaertn.) Desr. var. conicarpa (Wight) T. Anderson
(1874). Wight also collected another specimen from the evergreen forests of the Western
Ghats and described the variety papilla (Wight, 1840) under G. cambogia (Desrous, 1792).
Later N. P. Singh (Singh, 1993) proposed combination nova for these varieties as G. gummi-
gutta var. conicarpa (Wight) N.P. Singh, and G. gummi-gutta var. papilla (Wight) N. P.
Singh respectively.
2. Distribution and conservation status of the varieties of Garcinia gummi-gutta

The variety gummi-gutta is distributed wildly in the evergreen forests of Western Ghats
ranging, from 400 m to 900 m. It is fairly common and abundant in the forests of western Sri
Lanka from sea level to 600 m and in Malaysia also. In Kerala, it is very popular in the
Central Travancore areas, where maximum diversity is seen. Field studies revealed that the
var. gummi-gutta is cultivated all over the low lands and mid lands of Kerala ranging from
sea shore to the high lands up to 600 m. The other two varieties are restrictedly endemic to
the Western Ghats. Variety conicarpa is a high altitude species (1350- 1950 m) distributed
rarely in evergreen forests of South Western Ghats (Table 1). var. papilla is also very rare in
the evergreen forests of Southern Western Ghats and found in an altitude of 800-1850 m.
Samples of G. gummi-gutta var. papilla were collected from Silent Valley, Palakkad district
and G. gummi-gutta var. conicarpa were collected from from Kadalar, Rajamala, Kottamala
forest regions of Idukki district and Vellarimala, Chembra hills of Wayanad district. Though
varieties papilla and conicarpa were not included in IUCN categories, we suggest both to be
included in ‘endangered’ category, based on their restricted distribution within small
scattered populations.
3. Morphological features of the varieties of Garcinia gummi-gutta

Critical evaluation of morphological characters through detailed qualitative and quantitative
characters of male and female accessions of the varieties were carried out (Table 1, Figure
1). The demarcating morphological features noted for the varieties are lamina shape, presence
of leaf ligule, pedicel length, stamen arrangement, fruit shape and number of fruit grooves in
fruits. Based on the distinguishing morphological features of var. conicarpa such as absence
of leaf ligules, lamina shape, arrangement of stamens in convex torus head, pedicel length,
conical nature of fruits and the fibrous nature of arils, the variety conicarpa need to be
reinstated as species G. conicarpa, early proposed by Wight.
133
Figure 1. G. gummi-gutta varieties (A-C. Leaves, D-F. Male flowers, G-H. Female flowers, J-K.
Fruits)
3.1. Key to Garcinia gummi-gutta varieties

1 Stamens 12-20, ovary 4-12 locular, stigmatic ray 6-10; berries 6-10
grooves……………………………...var. gummi-gutta
1 Stamens more than 20; ovary 3 – or 6- 8 locular, stigmatic rays 3 or 6-8; berries 3
or 6-8 grooves…………………………………………….2
2 2.a Leaf ligule present; ovary 6-8 locular; stigmatic rays 4-8; berries ovoid-oblong,
4-8 grooved, ………………..……….var. papilla
2.b Leaf ligule absent; ovary 3-5 locular; stigmatic rays 3-5; berries ovoid or conical,
3-5 grooved …......................................................................var. conicarpa
134
Table 1. Distinguishing characters of Garcinia gummi-gutta varieties

Sl. Parameter var. gummi-gutta var. papilla var. conicarpa
No.
1 Branches Parallel or pendulous Parallel Parallel
drooping
2 Leaf shape Elliptical-oblong or Elliptical Obovate-ovate rarely
obovate oblong or broader
beyond the middle
3 Length of petiole 1.5- 2 cm 1. 5 cm > 1 cm
4 Leaf ligule Present Present Absent
5 Length of Male flower 1.5-1.7 cm 0. 7 cm >0.5 cm
pedicel
6 Length of Female flower 4-6 mm Ca.5 mm sessile
pedicel
7 Arrangement of Stamen Globose head Globose and Convex torus
androphore
8 Number of stamen / 12- 20 25 or more Ca. 35
flower
9 Rudimentary pistil Present Absent Absent
10 Ovary 4-12 locular 6-8 locular 3-5 locular
11 Female flower position Terminal or axillary Terminal or axillary Terminal or
subterminal
12 No. of Stigmatic lobes 6-10 3- 8 3- 5
13 Staminodes 10-20 9-12 Ca. 20
14 Fruit shape Globose Sub globose Ovoid- conical
15 Number of groove / 6-10 3-8 4-5
Berries
16 Nature of Seed Covered with pulpy aril Covered with thick Covered with thin
mass of fibrous aril fibrous aril
17 Number of seeds 4-8 3-5 2-4
18 Seed shape Ovoid Sub triangular Ovate- oblong
19 Flowering Jan-Mar Jan-Mar Apr-Jun
20 Fruiting Apr-Aug Apr-Jul Jul-Oct
21 Habit Large tree Large tree Large tree
22 Habitat (wild) Semi-evergreen to Endemic to evergreen Endemic to
evergreen forests of forests of Western Evergreen forests of
Western Ghats at Ghats in between Western Ghats in
between
23 Cultivation status Cultivated from sea Wild only Wild only
shore to mid land and
up to high land
24 Altitude (m) 50- 900 m 800-1850 m 1350- 1950 m
25 Distribution status Common Rare Rare
3.2. Morphological diversity of Garcinia gummi-gutta var. gummi-gutta

Kerala seems to be the centre of diversity of cambogia and wide variations in the
morphological characters are observed in the leaves, flowers, fruits and seeds of Garcinia
gummi-gutta (Tharachand et al., 2015, Abraham et al., 2006). The diversity of var. gummi-
gutta is more manifested among the cultivars, compared to the wild accessions.
135
Figure 2. Diversity of Garcinia gummi-gutta var. gummi-gutta fruits

Fruits of 18 accessions of var. gummi-gutta, cultivated in different parts of Kerala
extending from coastal region to middle land, were collected and studied for assessing the
variability in size and shape (Table 2, Figure 2). The large fruit size, pulpy aril and more
number of seeds (4-8) per fruit were the favorable features of var. gummi-gutta supporting its
wide distribution and preference for cultivation over the other two varieties. The processed
pericarp of var. gummi-gutta is of great value for its delicate taste and flavour and the
accessions were evaluated in terms of fruits size, rind thickness, acidity and yield. The
average weight of fruits was 173 g. Previous studies on 13 fruit and five seed characters of 51
accessions of Malabar tamarind by Abraham et al., (2006) reported that the variability was
found to be maximum for nipple length (74.8%) and minimum for fruit girth (12.8%) and the
average fruit weight was 161g.
Usually the branching pattern was horizontal, while pendulous drooping pattern has
also been observed rarely. The average size of leaves was 7-12 x 3.5-5 cm while the leaf
shape varied considerably from the typical elliptic to broad shapes. The apex and base of
leaves were acute and rarely obtuse. The variation was also exhibited in flowers, fruits and
seeds morphology. The fruit shape varied from globose, oblong and rarely to discoid shape.
The thickness of fruit rind is a detrimental factor in food sector and the thickness varies from
6.25 mm to 16.03 mm among the selected accessions. The fresh weight of fruit was in the
range 45.7-173.3 g. The number of grooves over the fruit surface also varied significantly
from 5 to 11.
136
Table 2. Morphological variation in Garcinia gummi-gutta var. gummi-gutta

Sl. Accession Branching Leaf shape Leaf Number Fruit Fruit Fruit No.
No pattern size of fruit rind shape wt. of
Lamina Apex Base (cm) grooves thick seeds
ness
(mm)
1 Kotta Horizontal Elliptic- Acute Acute 6-10 x 6-9 11.21 Globose, 52.16 2-4
spreading Ovate 4-6 grooves
splitted
2 Mezhuveli Horizontal Elliptic Acute Acute 7-13x 7-9 10.31 Oblong 43.52 1-2
spreading 4-6
3 Karanikun Horizontal Elliptic- Acute- Acute 6-10 x 7-8 11.71 Oblong, 89 5-7
nu (i) spreading oblance obtuse 3-4.5 mamillae
olate
4 Karanikku Horizontal Elliptic- Acute Obtus 5-9 x 7-10 7.2 Oblong 45.68 2-4
nu (ii) spreading ovate e 3-4
5 Karanniku Horizontal Elliptic Acute Acute 6-9 x 7-10 6.25 Globose- 54.86 4-6
nnu(iii) spreading 3.5-5 oblong
6 Ullanoor Pyramidal Elliptic- Obtus Acute 7-9 x 8 11.51 Globose, 85.28 7
drooping broad ely 3-6 mammilla
elliptic acute te
7 Arammull Pyramidal Elliptic Acute Acute 6-10 x 8 13.8 Discoid 99.92 4
a drooping 3-4
8 Kurianipp Horizontal Elliptic Acute Acute 5-9 x 8 9.2 Oblong 58.42 5
ally spreading 3.5-4
9 Manipuzh Horizontal Elliptic Acute Acute 6-10 x 8 Globose, 124.8 5
a spreading 3.5-5 grooves 2
splitted
10 Pulikezh Horizontal Elliptic Acute Acute 5.5-9 9 13.41 Globose- 46.98 7
spreading x 3.5- oblong
4.5 with
mamillae
11 Podiyadi Horizontal Elliptic- Acute Acute 6-10 x 6 Globose- 85.48 3
spreading broad 4-5 oblong
elliptic with
depressed
12 TBG. G.g Pyramidal 6-8 16.03 198.8 4-5
–1 drooping
13 TBG. G.g Horizontal 6-9 148.9 4-6
-2 spreading 4
14 Karimbam Horizontal Elliptic Acute Acute 8-11 Globose 58.94 6-9
spreading
15 Calicut Horizontal 8-9 Globose,g 66.24 7-8
spreading rooves
splitted
16 Vaikom 1 Horizontal 6-7 Globose,g 95.53 5-6
spreading rooves
splitted
with
mamillae
17 Vaikom - Horizontal 7-9 Globose,g 6-8
2 spreading rooves
splitted
with
mamillae
18 Wayanad Horizontal Ovate- Acute Acute 6-9 x 5-6 12.7 Oblong 3-4
spreading elliptic 3-5
137
4. Chemotaxonomical studies of the varieties of G. gummi-gutta

The genus Garcinia is considered as a taxonomically difficult one due to the complexity and
diversity in floral characteristics and differences in the floral architecture were observed even
among closely related taxa of Garcinia (Sweeney, 2008, Nimanthika and Kaththriarachchi,
2010). Morphological characters are known to be affected by developmental and
environmental factors and in the case of Garcinia species, an unusual evolutionary plasticity
has been generally observed. Incorporation of biosystematics permits classifications using
new descriptors and methods that yield more robust inter relations. Chemosystematic studies
based on secondary metabolite profile has proven as an efficient supportive tool for plant
systematics. The genus Garcinia is characterized by the presence of a large number of
secondary metabolites such as xanthones, benzophenones and biflavonoids, in addition to
volatile secondary metabolites (Hemshekhar et al., 2011). In the present study, volatile
chemical profile as well as non volatile chemical profile was utilized for differentiating the
three varieties.
4.1. Volatile chemical analysis of the varieties of G. gummi-gutta

Several attempts have been made to evaluate the phylogeny among Clusiaceae members
through secondary metabolite profiling (Waterman and Hussain, 1983). Among the
secondary metabolites, volatile chemicals can efficiently be utilized for chemotaxonomic
purposes (Labra et al., 2004). Most of the Clusiaceae members are known for their oil glands
and secretary canals and volatile chemical profiles of several Garcinia species have been
reported (Rameshkumar et al., 2005, Martins et al., 2008).
In the present work, volatile chemical profiles of the leaves of the female accessions
of the three varieties were studied using GC-MS analysis of the essential oils. The essential
oils were isolated from fresh leaves by hydrodistillation for 3h using Clevenger type
apparatus. The oils were analyzed by gas chromatography methods. GC-FID analysis was
carried out on a Varian CP-3800 gas chromatograph equipped with a flame ionization
detector (FID) and a CP Sil 8CB fused silica capillary column (30 m × 0.32 mm, film
thickness- 0.25 m). The GC-MS analysis was done on a Hewlett Packard 6890 gas
chromatograph fitted with a cross-linked 5% phenyl methyl siloxane HP-5 MS capillary
column (30 m × 0.32 mm, film thickness- 0.25 m) coupled with a 5973 series selective mass
detector. The constituents were identified by retention indices calculated using homologues
of n-alkanes (C8-C22) (Dool and Kratz 1963), comparing mass spectra with published data
(Adams, 2007) and by mass spectra library search (Wiley 275 and NIST). Similarities among
the varieties were studied by hierarchical clustering based on the volatile chemical
distribution, using SPSS (ver.16.0).
Thirty eight compounds were identified in the leaf essential oils of 3 varieties and
sesquiterpenoids were the predominant compounds (Table 3). Comparison of the volatile
chemical profile revealed that the variety conicarpa possess distinct chemical profile. While
α-copaene was the major compound in varieties gummi-gutta (30.2) and papilla (24.3), var.
conicarpa possess only 1.5% α-copaene. The content of β-caryophyllene was higher in var.
conicarpa (18.1) compared to varieties gummi-gutta (5.7%) and papilla (8.4). Major
component of var. conicarpa was γ-cadinene (46.2%), which is present in less quantity in
varieties gummi-gutta (3.4%) and papilla (3.4%).
138
Table 3. Distribution of leaf volatile chemicals in Garcinia gummi-gutta varieties

Compound RI Gg.vg. F1 Gg.vp. F1 Gg.vc. F1
E-β-Ocimene 1044 1.1 _ _
Terpinolene 1086 0.2 _ _
α-Cubebene 1348 0.4 0.3 _
Cyclosativene 1369 1.3 1.1 1.3
α-Copaene 1374 30.2 24.3 1.5
β-Panasinsene 1382 1.3 0.6 0.1
α-Gurjunene 1409 0.3 _ 0.1
β- Caryophyllene 1417 5.7 8.4 18.1
β-Copaene 1430 1.3 1.1 _
γ-Elemene 1434 2.1 1.3 _
α-Guaiene 1437 0.3 _ 2.3
cis- Muurola- 3,5- diene 1448 0.8 _ 0.1
Amorpha- 4,11 – diene 1449 0.4 _ 7.1
α-Humulene 1452 1.8 0.9 3.7
cis- Cadina-1(6),4- diene 1461 0.9 _ 0.7
trans- Cadina- 1(6),4 - diene 1475 0.9 _ _
γ- Muurolene 1478 4.3 6.3 _
Amorpha- 4,7(11) –diene 1480 0.5 0.1 _
β-Selinene 1489 1.1 12.3 _
δ-Selinene 1492 _ 1.5 0.7
trans- Muurola- 4,(14)5 - diene 1493 _ _ 1.2
α- Selinene 1498 1.5 13.9 _
α- Muurolene 1500 1.5 2.5 _
Germarene A 1509 0.6 _ _
γ- Cadinene 1513 3.4 3.4 46.2
7- epi- α- Selinene 1520 _ _ 1.9
δ- Cadinene 1522 32.4 10.6 10.0
Zonarene 1525 _ 0.8 _
trans- Cadina 1,4 diene 1533 0.7 0.5 0.1
α- Cadinene 1537 0.5 0.6 0.5
α- Calacorene 1544 0.5 0.8 1.0
Germarene B 1559 0.3 _ _
Caryophyllenyl alcohol 1570 _ _ 0.9
1-epi-Cubenol 1627 -- _ _
α- Muuralol 0.4 0.2 _
Cubenol 1645 0.2 _ _
n- Hexadecanol 1874 _ _ 0.1
n- Octadecanol 2077 _ _ 0.1
Total identified (%) 96.9 91.5 97.7
Total identified (No.) 30 21 21
Monoterpenoids 1.3 nil nil
Sesquiterpene- hydrocarbons 95.0 91.3 96.8
Sesquiterpene-oxygenated 0.6 0.2 0.9
Total sesquiterpenoids 95.6 91.5 97.7
RRI: Relative retention index calculated on HP-5 column.
Dendrogram based on distribution of volatile compounds (SPSS) in the leaves of the varieties
revealed 75% similarity between var. gummi-gutta and var. papilla, while var. conicarpa
showed only 20% similarity with the other two varieties (Table 4, Figure 3).
139
Figure 3. Dendrogram based on distribution of volatile compounds in the leaves of Garcinia gummi-
gutta varieties
Table 4. Proximity matrix between varieties
Sample Gg. vg Gg. vp Gg. vc
Gg. vg 1.000 .750 .209
Gg. vp .750 1.000 .173
Gg. vc .209 .173 1.000
4.2. HPTLC analysis of the varieties of G. gummi-gutta

The non volatile chemical profiles of the varieties were studied through HPTLC method. 5 g
each of the dried leaf powders were extracted with hexane, followed by methanol in a Soxhlet
apparatus for 4 h each. The HPTLC profile of the hexane and methanol extracts were studied
using CAMAG HPTLC using the solvent system hexane: ethyl acetate (7:3) for hexane
extracts and ethyl acetate: methanol: water (10: 1.7: 1.3) for methanol extract. The developed
plates were visualized under UV light, both in long and short wavelengths. The spray reagent
used for hexane extract was anisaldehyde-sulphuric acid, while 10% ethanolic KOH and 10%
ethanolic phosphomolybdic acid were used as spraying reagents for methanol extracts.
HPTLC profiles of both the hexane and methanol extracts revealed characteristic
differences for var. conicarpa compared to var. gummi-gutta and var. papilla (Figure 4).
Figure 4. HPTLC profiles of Garcinia gummi-gutta varieties.

A. Leaf hexane extract; B. Leaf methanol extract
Conclusions
The chapter provides a comprehensive account on the distribution and diversity of G. gummi-
gutta in the Western Ghats, combining morphological and phytochemical features. Among
the three varieties, var. papilla, and var. conicarpa are rare and distributed only in the
highlands of forests. The diversity of G. gummi-gutta var. gummi-gutta was more manifested
among the cultivars. Evaluation of the morphological and chemical diversity of G. gummi-
gutta varieties revealed distinct morphological and chemical characteristics for G. gummi-
gutta var. conicarpa, which needs reinstating it as the distinct species, G. conicarpa done by
Wight. The study supports the hypothesis that the southern Western Ghats is the centre of
origin and diversity of Garcinia gummi-gutta.
140
References
1. Abraham Z, Malik SK, Rao GE, S Narayanan L, Biju S. 2006. Collection and
Characterization of Malabar Tamarind (Garcinia cambogia (Gaertn.) Desr.). Genet.
Resour. Crop Ev., 53 (2), 401-406.
2. Adams RP. 2007. Identification of Essential Oil Components by Gas Chromatography /
Mass Spectrometry. Fourth edition. Allured Pub. Co., Carol Stream, IL.
3. Anderson T. 1874. Guttiferae. In: Hooker JD. (ed.) Flora of British India. 1. L. Reeve &
Co., London. 259-278.
4. Anonymous. 1950. Wealth of India Raw Materials Vol. IV. CSIR, New Delhi, pp.99-108.
5. Desrousseaux LAJ. 1792. In:Lamarck Encyclopédie Méthodique, Botanique. Paris 3, 701.
463-471.
7. Hemesekhar M, Sunitha K, Santhosh MS, Devaraja S, Kempararaju K, Viswanath B S,
Niranjana SR and Girish KS. 2011. An overview of genus Garcinia: Phytochemical and
therapeutical aspects. Phytochem. Rev., DOI 10.1007/s 11101-011-9207-3.
9. Linnaeus C. 1754. Cambogia. Genera Plantarum, 5, 225.
10. Martins FT, Doriguetto AC, de Souza TC, de Souza KR, dos Santos MH, Moreira ME
and Barbosa LC. 2008. Composition and anti‐inflammatory and antioxidant activities of
the volatile oil from the fruit peel of G.brasiliensis. Chem. Biodivers., 5(2), 251-258.
11. Nimanthika WJ and Kaththriarachchi HS. 2010. Systematics of genus Garcinia L.
(Clusiaceae) in Sri Lanka. New insights from vegetative morphology. Journal of National
Science Foundation, 38, 29-44.
12. Rameshkumar KB, Shiburaj S and George V. 2005. J. Trop. Med. Plants, 6, 271-273.
13. Robson N. 1968. Garcinia gumm-gutta (L.) N. Robson, Comb. nov. In: Brittonia. The
American Society of Plant Taxonomist, 20, 103.
14. Singh NP. 1993. Clusiaceae (Guttiferae nom. alt.) In: Flora of India Vol. 3. (Eds) Sharma
BD and Balakrishnan NP Botanical Survey of India, Kolkatta, 109-111.
16. Tharachand C, Immanuel Selvaraj C and Abraham Z. 2015. Molecular insights into the
genetic diversity of Garcinia cambogia germplasm accessions. Braz. Arch. Biol. Technol,
58(5), 765-772.
17. Van Rheede HA. 1678. Codam-pulli. Horti Indici Malabarici. Amsterdam 1, 41-42, t. 24.
19. Wight R. 1839. Icones Plantarum Indiae Orientalis Part 1(6), Pharoah JB, Madras, tt.
101-121.
20. Wight R. 1840. Icones Plantarum Indiae Orientalis Part 2(1), Pharoah JB, Madras, tt.
319-416.
141
Chapter 9
Phytochemicals and bioactivities of Garcinia indica (Thouars) Choisy-

A review
R. Ananthakrishnan and K. B. Rameshkumar*

Palode, Thiruvananthapuram- 695562, Kerala, India
*
Abstract
Garcinia indica is well known as a fruit tree of culinary, pharmaceutical, nutraceutical and
industrial significance in south India, especially in the Konkan region. The fruit juice is much
appreciated as a health drink while the dried fruit rind is used as a spice and condiment. The
fat extracted from G. indica seeds is known as kokum butter and is used in foods, cosmetics
and medicines. Stearic acid and oleic acid are the major fatty acids in kokum butter, while the
fruit rind contains hydroxy citric acid, the much valued anti-obesity agent. The major class of
secondary metabolites reported from different parts of the species are benzophenones,
biflavonoids, xanthones and anthocyanin pigments. The fruit rind is a rich source of the
benzophenone garcinol, attributed with potential bioactivities, especially antioxidant and
cytotoxic. Cyanidin-3-glucoside and cyanidin-3-sambubioside were identified as the major
red pigments in the fruit rind. The present review gives an overview of the phytochemical and
pharmacological aspects of G. indica.
Keywords: Garcinia indica, Kokum, Anthocyanins, Garcinol, Isogarcinol
Introduction
Garcinia indica (Thouars) Choisy (Family: Clusiaceae) is one of the important indigenous
Garcinia species grown in the Western Ghats of India. Garcinia indica (Kokum) is a slender,
tropical evergreen tree that grows up to 15 m height. The branches are drooping, leaves ovate
or oblong lanceolate, dark green above and pale beneath, stem bark thin lined, with pale
yellow coloured exudates, and fruits globose or round, purple coloured when ripe, about 4 cm
in diameter with 5-8 seeds. Flowering was observed during November-February and fruiting
season was during April-June (Singh, 1993). G. indica is generally known as ‘kokum tree’,
‘wild mangosteen’ or ‘goa butter tree’ (Watt, 1890; Baliga et al., 2011).The species is well
known for its food, medicinal and commercial values. The National Medicinal Plant Board
(NMPB) has identified G. indica as an important plant for promotion and development. The
present chapter gives a review on the distribution, traditional uses, pharmacological activities
and phytochemical constituents of G. indica.
142
Figure 1.Garcinia indica twig and fruits
1. Distribution and conservation status

Garcinia indica is widely distributed along the Western Ghats of India and also found in the
forests of Assam, Meghalaya and West Bengal. In the Western Ghats, the tree is mainly
found along the costal belt of Konkan region of Ratnagiri district of Maharashtra, Goa, Uttara
Kannada, Udupi and Dakshina Kannada Districts of Karnataka and Kasaragod area of Kerala.
It thrives well below an altitude of 800m and at coastal areas (Braganza et al., 2012; Nayak et
al., 2010). A wide diversity has been observed for kokum trees in the Western Ghats due to
the dioecious nature and cross pollination (Swami et al., 2014; Joseph and Murthy, 2015).
The study conducted on 268 accessions of G. indica from different parts of the State of Goa,
showed that the sugar level varied from 1.9 to 22.4oBrix, while the total acid in fresh fruit
rind was in the range 1.2 to 11.2 % (Braganza et al., 2012). G. indica is under vulnerable
status as categorised by IUCN. Western Ghats Kokum Foundation (WGKF) is an
organisation which promotes cultivation and works on conservation of G. indica in India.
2. Traditional uses of Garcinia indica

G. indica has got multifarious uses and finds various applications among the local population.
The dried fruit rind of G. indica impart a sweet-tangy taste to food and is widely used as
flavouring agent in food preparations as substitute for tamarind (Anonymous. 1956;
Jayaprakasha and Sakariah, 2002). The fruits are also used as a substitute for grapes in wine
making (Baliga et al., 2011). The fruit rind has also been utilized as a pink and purple food
colouring agent (Kaur et al., 2012). Kokum drinks, made from the fruits of G. indica, served
as a welcome drink in Goa during summer seasons. Konkani people of Goa and Maharashtra
make bhirindi saar, a soup using kokum juice and also kokum kadi by mixing kokum juice
and coconut milk, both used as after-meal drink to relieve any gastric problems (Menezes,
2001). Dried fruit rinds and syrup can be found as reserve in every house hold of Konkan
region. Kokum butter is another important product obtained from the seeds of G. indica,
143
which is an important ingredient in cosmetic products like lip balms, lotions and soaps
(Baliga et al., 2011).
Traditionally, kokum is used in herbal medicines to treat diarrhoea, inflammatory
ailments, dermatitis, bowel problems, rheumatic pains and to prevent hyper perspiration.
Fruits are used as antihelmintic and cardiotonic. Kokum juice from the rind is used against
piles, colic problems, dysentery and diarrhoea (Baliga et al., 2011; Watt, 1890). Decoction of
fruit rinds are traditionally used against diabetes. Kokum butter is used traditionally to heal
wounds, fissures in hands and is supposed to restore elasticity of skin and used as a
moisturiser (Jeyarani and Reddy, 1999; Padhye et al., 2009). Leaves of G. indica are used to
treat skin ulcers, dyspepsia and hyperplasia.
3. Value added products from Garcinia indica fruits

With an estimated annual production of 10,200 tonnes of fruits (yield is 8.5 t/ha), the species
is important for several industrial sectors such as nutraceutical, food supplementary, beverage
and cosmetics (Braganza et al., 2012; Swami et al., 2014).. Several consumer products such
as Kokum syrup, Kokum Agal (Kokum juice concentrate), Kokum sarbat, Kokum solkdhi,
Kokum amsul (dried salted rind), Kokum butter and Kokum beverages are available in the
market based on kokum fruits, rinds and kokum fat. Rinds are dried and stored, which can be
used to prepare reconstitutable drinks during off season (Baliga et al., 2011). It is also
marketed as a spice in the local markets of Goa. Fresh rinds are added during wine making
process, which gives the wine a pinkish appearance and a tingling taste. Kokum butter,
because of its fatty acid content is used in soap and face creams (Padhye et al., 2009). Kokum
butter can be used as an ingredient in chocolate and due to the relatively high melting point
(mp. 39 to 43°C), kokum butter prevents the chocolate from melting and can be used for
preparing heat resistant chocolates (Maheshwari and Reddy, 2005; Jeyarani and Reddy,
1999). Kokum butter is sold as egg shaped lumps, used as edible fat and as a substitute of
ghee in Goa.
3. Phytochemistry of Garcinia indica

The seed kernels of G. indica contains hard and brittle fat (mp. 39 to 43°C) up to 45 % yield,
which is commercially known as ‘kokum butter’. Kokum butter contains about 30% of fat
content. Extensive studies have been carried out on the fatty acid composition of kokum
butter and kokum fat was found to be rich in stearic acid (C17H35COOH) and oleic acid
(C17H33COOH) (Krishnamurthy et al., 1982, Jeyarani and Reddy, 1999). Quantitative
analysis of kokum butter revealed that in addition to fatty acids, it contains glycerides such as
oleodistearin and stearodiolein (Lipp and Anklam, 1998). Seed oil is a source of palmitic
acid, stearic acid, oleic acid and linoleic acid. Reports show that seed oil of G. indica,
because of high content of fatty acid methyl esters, can be used as biofuel or can be mixed
with other fuels to enhance its efficiency (Hosamani et al., 2009).
Figure 2. Structures of stearic acid and oleic acid
144
The fruit juice of G. indica is very acidic with a pH 1.5 to 2.0 and contains large
amounts of acids. Major portion of organic acids in kokum is hydroxycitric acid (HCA) (1, 2
dihydroxypropane-1, 2, 3-tricarboxylic acid). Rinds contain about 20-30% of (-)-HCA on dry
basis (Swami et al., 2014). HCA is an anti-obesity agent, attributed with reduced food intake,
increased energy expenditure, suppression of fatty acid synthesis and an enhancement of
glycogen synthesis in liver (Jena et al., 2002). Among the different Garcinia fruits, G.
gummi-gutta possesses the highest HCA content, followed by G. indica. However, in a recent
study, Pandey et al (2015) reported that among the 11 Garcinia species leaves analysed,
HCA content was highest in G. indica leaves, 120mg/g leaf methanol extract, while in G.
gummi-gutta, the HCA content was 95 mg/g. The total acid content (HCA and HCA lactone)
was however higher in G. gummi-gutta leaves (308mg/g), compared to G. indica leaves (276
mg/g). Besides HCA, kokum juice contains malic acid, citric acid and tartaric acid
(Parthasarathy et al., 2012).
O OH
O O
HO OH
OH
OH
Figure 3. Structure of hydroxycitric acid
Table 1. Phytochemicals reported from Garcinia indica

Plant part Compound References
Leaves D- Leucine Cotterill and Scheinmann1977
isogarcinol, xanthochymol, isoxanthochymol, Chattopadhyay et al.,2006; Kumar et al.,
2013
HCA and HCA lactone Jayaprakasha and Sakariah2002
Cambogic acid, mangostin, garcinol, Pandey et al.,2015
fukugicide, GB-1, GB- 2 and amentoflavone
Fruits and fruit (-) HCA, HCA lactone Cotterill and Scheinmann1977;
rinds Jayaprakasha and Sakariah 2002; Padhye
et al., 2009
Garcinol, isogarcinol, citric acid, oxalic acid, Yamaguchi et al., 2000; Chattopadhyay
xanthochymol, isoxanthochymol et al.,2006; Padhye et al., 2009; Nayak et
al., 2010; Kaur et al., 2012; Kumar et al.,
2013; Bhagwat et al., 2014
Anthocyanin, glucose, xylose, cyanidin-3- Nayak et al., 2010
glucoside, cyanidin-3-sambubioside and
14-deoxyisogarcinol.
Polyprenylated acylphloroglucinol derivative Kaur et al., 2012
Bark Euxanthone (1,7-dihydroxy xanthone), Cotterill and Scheinmann1977
volkensiflavone and morelloflavone
Xanthochymol, isoxanthochymol and Chattopadhyay et al.,2006; Kumar et al.,
camboginol 2009
Seed pericarps Isoxanthochymol, camboginol, palmitic acid, Kumar et al., 2009; Hosamani et al.,
and Seed oil stearic acid, oleic acid and linoleic acid 2009
The major secondary metabolites reported from G. indica are polyisoprenylated

benzophenones, xanthones and biflavonoids. Garcinol (camboginol), isogarcinol
(xanthochymol) and isoxanthochymol are the major benzophenone derivatives isolated from
G. indica fruits, dry rinds and leaves (Yamaguchi et al., 2000; Kumar et al, 2009; Kumar et
al., 2013; Kaur et al., 2012, Chattopadhyay et al., 2006; Pandey et al.,2015). Garcinol is
145
crystallized out as yellow needles (1.5%) from the hexane extract of the fruit rind, while its
isomeric form isogarcinol is colourless. A simple reverse-phase high-performance liquid
chromatography-electrospray ionization mass spectrometric method (ESI-MS) for the
identification and quantification of the two isomeric benzophenones, isoxanthochymol and
camboginol in the extracts of the stem bark, seeds and seed pericarps of Garcinia indica have
been reported by Kumar et al. (2009). Two new compounds, 14-deoxyisogarcinol and a
polyprenylated acylphloroglucinol derivative were isolated from G. indica fruits by Kaur et
al., (2012). Xanthones and biflavanoids were also detected from G. indica (Cotterill and
Scheinmann, 1977). An extensive LC-MS study on methanol extracts of G. indica leaves led
to the identification of multiclass bioactive constituents belonging to organic acids, phenolic
acids, flavonoids, biflavonoids, xanthones, benzophenones and terpenoids (Pandey et al.,
2015).
The fruit rind of G. indica has been utilized as a pink and purple food coloring agent
and the rind contains 2 to 3 % of water soluble red colour pigments. The major colouring
compounds are the anthocyanin pigments cyanidin-3-glucoside and cyanidin-3-sambubioside
which are usually present in the ratio of 4:1 (Nayak et al., 2010).The variation in colour
shades of kokum fruits can be attributed to the variation in substitution of hydroxyl and
methoxyl groups to the anthocyanin structural skeletons. Anthocyanins are the major
antioxidant constituents in G. indica and the 3’ and 4’-OH in B-ring determine radical
scavenging capacity with a saturated 2, 3- double bond. Major phytochemicals isolated from
G. indica and their structures are given in Table 1 and Figure 1.
OH OH
HO O O
HO O O
O OH
O O
Garcinol Isogarcinol
OH OH
HO O O HO O O
O O OH
O
Isoxanthochymol Polyprenylated acyl phloroglucinol
OH
OH
OH
OH HO O+
OH
HO O+ O
O OH
OH OH O OH
O OH
O OH
HO HO O OH
OH OH
OH
Cyanidin-3-glucoside Cyanidin-3-sambubioside
Figure 1. Characteristic compounds reported from Garcinia indica
146
4. Bioactivites of Garcinia indica

Extracts as well as compounds isolated from G. indica have been studied extensively for
various bioactivities like antioxidant, antibacterial, antifungal, antiobesity, antidiabetic,
gastroprotective and anticancer activities. The pharmacological studies validated the
traditional uses of the plant in various ailments. Benzophenones, anthocyanins and organic
acids are the major bioactive constituents reported in G. indica.
Among the different bioactivities reported, antioxidant properties are perhaps the
most important activity for G. indica (Krishnamurthy and Sampathu 1988; Mishra et al.,
2006). Choloroform extracts of G. indica fruit rinds exhibited excellent antioxidant activities
in β-carotene-linoleate and DPPH assays (Tamilselvi et al., 2003). Aqueous extracts of G.
indica fruits available in markets acts as very good antioxidants as evident from their DPPH
and lipid peroxidation assays. Aqueous extracts of kokum inhibit ascorbate-Fe2+ induced lipid
peroxidation in rat liver mitochondrial fractions (Mishra et al, 2006). Organic acids like citric
acid and malic acid from G. indica also acts as good antioxidants (Swami et al, 2014). A
recent study on G. indica bark exudates showed its total phenol and xanthone content as
53.43 g/100g and 32.42 g/100g respectively, revealing it as a potential source of antioxidants
(Parthasarathy and Nandakishore, 2016).
Kokum rind extracts showed antifungal effects against Candida albicans, Penicillium
sp. and Aspergillus flavus. Also the extract showed inhibitory activity against ‘3T3’ mouse
fibroblasts (Mishra et al, 2006; Varalakshmi et al., 2010; Tamilselvi et al., 2003). Aqueous
and methanol extracts of G. indica leaves and fruit rinds showed antibacterial activity against
Salmonella sp (Pasha et al., 2009). Methanol extracts of kokum fruits acted as an effective
neuroprotective agent for striatal dopaminergic neurons in 6-OHDA lesioned rat model of
Parkinsons disease (Antala et al., 2012). Aqueous fruit rind extract of the kokum exhibited
antidiabetic activity in streptozotocin-induced hyperglycemic rats (Kirana and Srinivasan,
2010). However, lyophilized aqueous-methanol extracts in water of G. indica fruit rinds
showed a dose dependant genotoxicity in mice (Das et al., 2016).
The major anthocyanin in G. indica fruits, cyanidin-3-glucoside decreased the number
of non-malignant and malignant skin tumours in the two staged skin carcinogenesis and also
caused a dose-dependent inhibitory effect on the migration and invasion of metastatic A549
human lung carcinoma cells (Ding et al., 2006, Chen et al., 2006). It was found effective in
blocking accumulation of intracellular ROS and neurofilament protein expression and was
effective against bipolar disorder by reducing ethanol-mediated activation of GSK3β. (Chen
et al., 2009). The biological activities of garcinol, the major polyisoprenylated benzophenone
isolated from G. indica and (-) hydroxy citric acid, the major acid in G. indica fruits were
dealt in detail in Chapter 10.
Conclusions
Recently, Garcinia species have received considerable attention worldwide from scientific as
well as industrial sectors and several novel structures, bioactivities and potential utilities have
been reported. In USA alone, mangosteen containing beverages had a turnover of more than
$200 million in 2008. Kokum can be considered as a functional food that provide in addition
to nutritional components, other physiological benefits as well. The consumption of high
value products of kokum have increased tremendously due to the awareness of the potential
health benefits associated with the diverse bioactive constituents in the plant. The review also
147
highlights the potential for developing G. indica as an economic crop to derive value added
products with scientific validation.
References
1. Anonymous. 1956. The Wealth of India Raw Materials. Vol. IV, NISCAIR, India.
2. Antala BV, Patel MS, Bhuva SV, Gupta S, Rabadiya S, and Lahkar M. 2012. Protective
effect of methanolic extract of Garcinia indica fruits in 6-OHDA rat model of
Parkinson’s disease. Indian J. Pharmacol., 6, 683-687.
3. Baliga MS, Bhat HP, Pai RJ, Boloor R and Princy LP. 2011. The chemistry and medicinal
uses of the underutilized Indian fruit tree Garcinia indica Choisy (kokum): A review.
Food Res. Int., 44, 1790-1799.
4. Bhagwat M and Datar A. 2014. Isolation and identification of antibacterial compounds
from the extracts of Garcinia indica and Curcuma aromatica, using bioautography and
mass spectrometric techniques. J. Biol. Active Prod. Nat., 4, 295-302.
5. Braganza M, Shirodkar A, Bhat J D and Krishnan S, (Eds). 2012. Resource Book on
Kokum, Western Ghats Kokum Foundation, Panaji, Goa. India.
6. Chattopadhyay SK and Kumar S. 2006. Identification and quantification of two
biologically active polyisoprenylated benzophenones xanthochymol and isoxanthochymol
in Garcinia species using liquid chromatography-tandem mass spectrometry. J.
Chromatogr. B, 844(1), 67-83.
7. Chen G, Bower KA, Xu M, Ding M, Shi X and Ke ZJ. 2009. Cyanidin-3- glucoside
reverses ethanol-induced inhibition of neurite outgrowth: Role of glycogen synthase
kinase 3 Beta. Neurotox. Res., 15, 321-331.
8. Chen PN, Chu SC, Chiou HL, Kuo WH, Chiang CL and Hsieh YS. 2006. Mulberry
anthocyanins, cyanidin 3-rutinoside and cyanidin 3-glucoside, exhibited an inhibitory
effect on the migration and invasion of a human lung cancer cell line. Cancer Lett., 235,
248-259.
9. Cotterill P J and Scheinmann F. 1977. Phenolic Compounds from the Heartwood of
Garcinia indica. Phytochemistry, 16, 148-149.
10. Das A, Ghosh I, Mukherjee A. 2016. Garcinia indica fruit extract induces genotoxicity in
mice. The Nucleus, 59, 1-6.
11. Ding M, Feng R, Wang SY, Bowman L, Lu Y, Qian, Y, Castranova V, Jiang BH and Shi
X. 2006. Cyanidin-3-glucoside, a natural product derived from blackberry, exhibits
chemopreventive and chemotherapeutic activity. J. Biol. Chem, 281, 17359−17368.
12. Hosamani KM, Hiremath VB and Keri RS. 2009. Renewable energy sources from
Michelia champaca and Garcinia indica seed oils: A rich source of oil. Biomass
Bioenergy, 33, 267-270.
13. Jayaprakasha GK and Sakariah KK. 2002. Determination of organic acids in leaves and
rinds of Garcinia indica (Desr.) by LC. J. Pharm. Biomed. Anal., 28, 379-384.
14. Jena BS, Jayaprakasha GK, Singh RP and Sakariah KK. 2002. Chemistry and
biochemistry of (-)-hydroxycitric acid from Garcinia. J. Agric. Food Chem., 50, 10-22.
15. Jeyarani T and Yella Reddy, S 1999. Heat-resistant cocoa butter extenders from mahua
(Madhuca latifolia) and kokum (Garcinia indica) fats. J. American Oil Chem. Soc., 76
(12), 1431-1436.
148
16. Joseph KS and Murthy HN. 2015. Sexual system of Garcinia indica Choisy: geographic
variation in trioecy and sexual dimorphism in floral traits. Plant Syst. Evol., 301, 1065-
1071.
17. Kaur R, Chattopadhyay SK, Tandon S and Sharma S. 2012. Large scale extraction of the
fruits of Garcinia indica for the isolation of new and known polyisoprenylated
benzophenone derivatives. Ind. Crop. Prod., 37, 420-426.
18. Kirana H and Srinivasan B. 2010. Aqueous extract of Garcinia indica Choisy restores
glutathione in type 2 diabetic rats. J. Young Pharm., 2, 265-268.
19. Krishnamurthy N and Sampathu SR. 1988. Antioxidant principles of kokum rind. J. Food
Sci. Tech. 25(1), 44-45.
20. Krishnamurthy N, Lewis YS and Ravindranath B. 1982. Chemical constitution of Kokum
fruit rind. J. Food Sci. Tech. 19, 97-100.
21. Kumar PSN, Gowda DGB, Mantelingu K and Rangappa KS. 2013. Development and
validation of a reversed-phase HPLC method for the analysis of garcinol and isogarcinol
in Garcinia indica. J Pharm Res, 7, 103-106.
22. Kumar S, Sharma S and Chattopadhyay SK. 2009.High-performance liquid
chromatography and LC-ESI-MS method for identification and quantification of two
isomeric polyisoprenylatedbenzophenonesisoxanthochymol and camboginol in different
extracts of Garcinia species. Biomed. Chromatogr., 23, 888-907.
23. Lipp M and Adam E. 1998. Review of cocoa butter and alternative fats for use in
chocolate-Part A. Compositional data. Food Chem., 62 (1), 73-97.
24. Maheshwari B and Reddy S Y. 2005. Application of kokum (Garcinia indica) fat as
cocoa butter improver in chocolate. J. Sci. Food Agric., 85, 135-140.
25. Menezes MT. 2001. The Essential Goa Cookbook, Penguin Books, India.
26. Mishra A, Bapat MM, Tilak JC and Devasagayam TPA. 2006. Antioxidant activity of
Garcinia indica (kokum) and its syrup. Curr. Sci., 91, 90-93.
27. Nayak CA, Rastogi NK and Raghavarao KSMS. 2010. Bioactive constituents present in
Garcinia indica Choisy and its potential food applications: A review. Int. J. Food Prop.,
13, 441-453.
28. Nayak CA, Srinivas P and Rastogi NK. 2010. Characterisation of anthocyanins from
Garcinia indica Choisy. Food Chem., 118, 719-724.
29. Padhye S, Ahmad A, Oswal N and Sarkar FH. 2009. Emerging role of garcinol, the
antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs. J. Hem.
Onc., 2, 1-13.
30. Pandey R, Chandra C, Brijeshkumar, Srivastva M, AnuAravind AP, Shameer PS and
constituents for quality assessment of Garcinia species using UHPLC-QqQLIT-MS/MS.
Ind. Crop. Prod., 77, 861-872.
31. Parthasarathy U and Nandakishore OP. 2016. Garcinia bark exudates- an important
phytochemical source. Curr. Sci., 110, 1617-1619.
32. Parthasarathy U, Nandakishore OP, Kumar SR, Babu NK, Zachariah TJ and
Parthasarathy VA. 2012. Chromatographic fingerprinting and estimation of organic acids
in selected Garcinia species. Int. J. Innovative Horticulture., 1, 68-73.
33. Pasha C, Sayeed S, Ali MS and Khan MZ. 2009. Anti Salmonella activity of selected
medicinal plants. Turkish J. Biol., 33, 59-64.
149
(eds.), Flora of India Vol. 3. Botanical Survey of India, Kolkatta, pp.86-151.
35. Swami SB, Thakor NJ and Patil SC. 2014.Kokum (Garcinia indica) and its many
functional components as related to the human health: A review. J. Food Res. Tech., 2,
130-142.
36. Tamilselvi A, Joseph GS and Jayaprakasha GK. 2003. Inhibition of growth and aflatoxin
production in Aspergillus flavus by Garcinia indica extract and its antioxidant activity,
Food Microbiol., 20, 455-460.
37. Varalakshmi KN, Sangeetha CG, Shabeena AN, Sunitha SR and Vapika J. 2010.
Antimicrobial and cytotoxic effects of Garcinia indica fruit rind extract. Am. Euras. J.
Agric. Environ. Sci., 7, 652-656.
38. Watt G. 1890. Dictionary of the Economic Products of India, Vol. II, (Second reprint
1972) Periodical Experts, Delhi.
39. Yamaguchi F, Saito M, Ariga T, YoshimuraY and Nakazawa H. 2000. Free radical
scavenging activity and antiulcer Activity of garcinol from Garcinia indica fruit rind. J.
Agric. Food Chem., 48, 2320-2325.
150
Chapter 10
Phytochemicals and bioactivities of Garcinia gummi- gutta (L.) N. Robson-

A review
V. Anju and K. B. Rameshkumar*

*
Abstract
Among the different Garcinia species, G. gummi-gutta is the most widely distributed
Garcinia species in Kerala, south India. The fruit is used as culinary spice, preservatives and
also as a source of several nutraceutical products. The phytochemical analysis of G. gummi-
gutta revealed the presence of several bioactive molecules such as xanthones, benzophenones
and organic acids. The fruit contains 10% to 30% (-) hydroxycitric acid (HCA), a well known
hypo-lipidemic agent and an important constituent of food supplement for weight
management. The species is a rich source of the bioactive benzophenones camboginol
(garcinol) and cambogin (isogarcinol). The present review summarises the traditional uses,
phytochemicals and pharmacological activities of G. gummi-gutta.
Keywords: Garcinia gummi-gutta, Hydroxy citric acid, Benzophenones, Camboginol,

Cambogin
Introduction
Garcinia is the largest genus of the Clusiaceae family comprising nearly 250 species.
Garcinia gummi-gutta (L.) Roxb. (Syn.: Garcinia cambogia (Gaertn.) Desr; Common name:
Malabar tamarind), is one of the most important members of the Clusiaceae family (Figure
1). It is a small or medium sized tree up to 12 m tall with dark green and shining leaves. The
leaves are elliptic obovate, 2-5 inch long and 1-3 inch broad. Fruits are ovoid, 2 inches in
diameter, yellow when ripe, with 6-8 grooves; seeds 6-8 surrounded by succulent aril (Singh,
1993). The aril and the fleshy covering encasing the seed is edible when ripe. The
differentiation between male and female trees is known only at the flowering stage which
takes approximately 7 to 9 years (Kalia et al., 2012). G. gummi-gutta is a common species
found in the Western Ghats, from the Konkan southwards to Travancore eastwards. The
species has now been introduced elsewhere in the subtropical region of Asia including China,
Malaysia and the Philippines (Chuah et al., 2013). The present chapter reviews the traditional
uses, pharmacological activities and phytochemicals of G. gummi-gutta.
151
Figure 1.Garcinia gummi-gutta twig with fruits
1. Traditional uses
G. gummi-gutta is traditionally used as a condiment for flavouring curries and as a fish
preservative. The traditionally smoke dried fruit rind of G. gummi-gutta, known as ‘Malabar
tamarind’ was used for “Colombo curing” of fish, where the pickling was done in brine along
with the smoke dried rinds of G. gummi-gutta (Sreenivasan and Venkataraman 1959; Lewis
and Neelakantan, 1965). The species yield an yellow, adhesive gum resin similar to gamboge
from G. morella, but of inferior quality and insoluble in water. The seeds yield an oil, which
is used in medicine (Watt, 1890). The wood is grey, cross grained, shining, hard and can be
used in furniture making (Watt, 1890). The dried rind was used for polishing gold and silver
and also used as a substitute for acetic and formic acids in the coagulation of rubber latex
(Anonymous, 1956).
Though the tree has been mentioned in the 17th century treatise of medicinal plants,
Hortus Malabaricus, the species is not part of the Ayurvedic medicine of ancient India
(Manilal, 2003). However, it was widely reputed in the folk herbal healing practices and has
been used traditionally for the treatment of edema, delayed menstruation, ulcers, open sores,
hemorrhoids, fever, rheumatism, and also against intestinal parasites (Majeed et al., 1994,
Semwal, et al., 2015). The astringent properties of the rind make it an indispensible ingredient
in gargles for weak gums, bowel complaints, constipation, diarrhoea and dysentery. The plant
is used in veterinary medicine, for mouth diseases in livestock.
2. Phytochemicals reported from G. gummi-gutta

Though G. gummi-gutta is an economically important species, widely cultivated in south
India, only a few reports are available in literature on the phytochemistry of the plant (Table
1). The fruit is well known for the acidic nature and the chemistry and analytical techniques
of hydroxycitric acid, the major organic acid in G. gummi-gutta, has been dealt with detail in
literature (Jena et al., 2002). Benzophenones are the major secondary metabolites in G.
gummi-gutta, followed by xanthones and biflavonoids.
152
2.1. Organic Acids

Organic acids are of great significance in plants as intermediates in the metabolic processes
and are directly involved in growth and maturation of fruits. The organic acids play a key role
in fruit flavour and taste. Most of the Garcinia fruits are well known for their sour taste and
high acidity, and of the different acids reported from Garcinia fruits, (−)-hydroxycitric acid
(HCA) is the important one, being an anti-obesity agent and a chiral molecule of wide utility
in chiral synthesis (Jena, et al., 2002). Malic acid, ascorbic acid, tartaric, oxalic acid and citric
acids are also present to a lesser extent in Garcinia fruits.
Hydroxy citric acid: Hydroxycitric acid (HCA) is the major organic acid occurring in the
fruits of G. gummi-gutta. The acid and its lactone were mistakenly identified as citric acid
and tartaric acid, however, the acids failed to give positive result for pentabromacetone test
for citric acid and cream of tartar test for tartaric acid (Sreenivasan and Venkataraman 1959,
Lewis et al., 1964). HCA has been first reported from nature by Lewis and Neelakantan in
1965 from the fruit rinds of G. gummi-gutta (Lewis and Neelakantan, 1965). HCA (1,2
dihydroxypropane-1,2,3- tricarboxylic acid) has four isomeric forms, since it contains two
asymmetric carbons: (-)-HCA, (+)-HCA, (+)-allo-HCA and (-)-allo-HCA (Figure 2). (2S,
3S) Hydroxycitric acid is the major acid from the fruit rinds of G. gummi-gutta. The fruit
contains 10% to 30% (-)HCA which can be isolated in the free form, as a mineral salt or as a
lactone. An HPLC analysis showed 4.1-4.6% (-)-HCA in the leaves while 10.3-12.7% in the
fruits of G. indica (Jayaprakasha and Sakariah, 2002).
The leaves also contain HCA and a recent LC-MS screening revealed that among 13
Garcinia species, G. gummi-gutta contains the highest quantity of acids (308mg/g leaf
methanol extract) and the HCA content was 95mg/g (Pandey et al., 2015). HCA is available
in the market in the form of various salts such as calcium, magnesium and potassium as well
as their mixtures (Yamada et al., 2007). Citrin is the trade name given to the calcium salt of
hydroxy citric acid. HCA lactone or garcinia lactone was also reported from the fruit. Other
organic acids such as tartaric acid, citric acid and malic acid also have been reported as minor
constituents. It also contains 1.5% phosphoric acid as calcium triphosphate.
COOH COOH
COOH COOH
HO C H H C OH
HO C H H C OH
HOOC C OH HO C COOH
HO C COOH HOOC C OH
H C COOH H C COOH
H C COOH H C COOH
H H
H H
(+) allo HCA (-) allo HCA

(-) HCA (+) HCA
Figure 2. Isomeric forms of hydroxycitric acid
Though citric acid is a common acid in plants, hydroxy citric acid is distributed in limited
plant species such as the flowers of Hibiscus subdariffa and H. rosasinensis. However, the
stereochemistry of HCA from Hibiscus species is (+) allo form and is different from that of
153
Garcinia (Lewis et al., 1964). Microbial strains such as Streptomyces sp. U121 and Bacillus
megaterium G45C also produces HCA in trace amounts (Yamada et al., 2007). Hydroxycitric
acid has also been synthesized from citric acid, through dehydration to form aconitic acid,
which forms hydroxycitric acid via oxidation (Chen et al., 2001).
Paper chromatographic method (solvent system: n-butanol: acetic acid:water (BAW)
in the ratio (4:1:5) separates and detects hydroxy citric acid, along with its lactone, on
Whatman No.1 paper using bromophenol blue as spray reagent. The acid content of the fruits
can be estimated by titrating against 0.1 N sodium hydroxide using phenolphthalein as
indicator. However, in this method the concentrations of (-)-HCA and lactone cannot be
estimated separately (Jayaprakasha and Sakariah, 1998). HCA can be estimated
spectrophotometrically by the formation of reddish orange color complex between HCA and
sodium meta vanadate (Antony et al., 1999). Quantification of HCA was also possible
through HPLC analysis of aqueous solution, where (-)-HCA and its lactone can be quantified
separately (Majeed et al., 1994, Jayaprakasha and Sakariah, 1998, 2000, 2002). The acid can
also be detected and estimated using gas chromatography of the trimethyl derivative
(Lowenstein and Brunengraber, 1981). In a recent report, UHPLC-QqQLIT–MS/MS method
has been applied for the validated estimation of HCA and lactone separately in leaf samples
of different Garcinia species (Pandey et al., 2015).
The fatty acid content of G. gummi-gutta seeds were 46.5%, and the major fatty acid
was stearic acid (30.6%), followed by oleic acid (26.2%), linoleic acid (11.4%), elaidic acid
(9.5%), palmitic acid (6.3%) and arachidic acid (5.4%) (See chapter 12 for further details).
The amino acid profile of G. gummi-gutta fruits was also reported. The amount of
total free amino acids was determined to be less than 60 mg in 100 g of G. gummi-gutta fruit.
The amino acids such as arginine, asparagine, glutamine, threonine, glycine, proline, γ-amino
butyric acid, leucine, isoleucine, ornithine and lysine were detected in the fruits (Carratu et
al., 2008).
Volatile chemical profiling of the leaves of G. gummi-gutta revealed sesquiterpenoids
as the major class of volatile compounds and -copaene has been reported as the major
compound (30.2%) (refer chapter 5 for details).
2.2. Benzophenones
Rama Rao et al. in the late 1970’s, isolated the benzophenones camboginol (garcinol) and
cambogin (isogarcinol; xanthochymol) from the latex of G. gummi-gutta in large quantities
(37.0% and 5.5% respectively) (Rao et al., 1973). Camboginol (m.p. 132°C) was obtained in
37% yield from the latex of G. gummi-gutta by a simple crystallisation from pet-ether. Silica
gel column chromatography of the remaining residue using hexane as the eluting solvent
gave cambogin (Rao et al., 1973). Cambogin has identical chemical and spectral properties as
isoxanthochymol but having exactly opposite specific rotation, clearly indicating the
compound as an enantiomer of isoxanthochymol. Later Iinuma, et al has also isolated
garcinol and isogarcinol from the barks of G. gummi-gutta (Iinuma, et al., 1998).
Phytochemical investigation of the fruits of G. gummi-gutta resulted in the isolation and
characterisation of the benzophenones garcinol and guttiferones I, J, K, M, N (Masullo et al.,
2008, 2010). In a recent report, the content of garcinol was highest in G. gummi-gutta
(0.593mg/g) leaf methanol extract among the 13 Garcinia species screened (Pandey et al.,
2015).
154
2.3. Xanthones
The xanthones garbogiol and rheediaxanthone A were isolated from the barks and roots of G.
gummi-gutta (Iinuma, et al., 1998). Oxy-guttiferones M, K2, I and K were isolated from the
fruits of G. gummi-gutta (Masullo et al., 2008, 2010). Oxy-guttiferones are tetracyclic
xanthones derived from the oxidation of the corresponding polyisoprenylated benzophenones.
2.4. Biflavonoids
In a recent report, the biflavonoids fukugicide, GB-1 and amentoflavone were reported from
G. gummi-gutta leaf extracts through a validated LC-MS analysis (Pandey et al., 2015).
However, the biflavonoid content was lowest in G. gummi-gutta among all the screened
Garcinia species. The phenolic acid and flavonoids were also lower compared to other
Garcinia species (Pandey et al., 2015).
The major secondary metabolites benzophenones, xanthones and biflavonoids
reported from the species are listed in Table 1.
Table 1. Phytochemicals reported from Garcinia gummi-gutta

Plant Part Compounds References
Leaf Cambogic acid, mangostin, garcinol, fukugicide, GB-1 Pandey et al.,2015
and amentoflavone
Heart wood Morelloflavone, dihydromorelloflavone, isomorellic Venkataraman, 1973

acid
Bark Rheediaxanthone, guttiferone E and isogarcinol Iinuma et al.,1998

Latex Cambogin (isogarcinol) and camboginol (garcinol) Rao et al.,1973
Root Garbogiol Iinuma et al.,1998
Morelloflavone, dihydromorelloflavone, isomorellic Venkataraman, 1973
acid
Fruit Guttiferones - K, I, J, M and N; oxy-guttiferones M, K, Masullo et al, 2008,2010
K2 and I
OH
O OH
HO O HO O O
O OH O O
Garcinol Isogarcinol
OH OHO OH
HO O O
O O
O O OH
Oxy-guttiferone M Garbogiol
Figure 3. Structures of some secondary metabolites isolated from G. gummi-gutta
155
3. Biological activities reported for Garcinia gummi-gutta
3.1. Bioactivities of G. gummi-gutta crude extracts: The crude extract and isolated
constituents from G. gummi-gutta exerted wide spectra of biological activities such as
anthelmintic, anticholinesterase, diuretic, antifungal, gastroprotective and hepatoprotective
activities in various in vitro and in vivo models (Semwal, et al., 2015). G. gummi-gutta also
showed effect on reproductive system, lipid peroxidation, blood viscosity, haematology and
plasma biochemistry (Semwal et al., 2015). G. gummi-gutta extract has shown significant
antidiabetic property by efficiently improving glucose metabolism and displaying leptin like
activity (Hayamizu et al., 2003). Remarkable antibacterial effect has been observed for
various extracts of G. gummi-gutta (Jacob et al., 2015, Rani and Lawerence, 2015, Maridass
et al., 2010). Different extracts of G. gummi-gutta fruits have shown good antioxidant
property in various in vitro assays such as DPPH, hydroxyl radical, ferric reducing
and lipid peroxidation (Jacob et al., 2015, Ranjani et al., 2014, Shivakumar et al., 2013,
Subhashini et al., 2011). G. gummi-gutta extracts showed significant anti inflammatory
activity in various experimental systems. In TNBS-induced colitis rats, the extract showed
significant anti inflammatory activity and it could be related to a reduction in DNA damage
in isolated colonocytes, observed with the comet assay. The extract also improved the
macroscopic damage and caused substantial reductions in MPO activity, COX-2 and iNOS
expression. It was also observed that treatment using Garcinia extract reduced PGE2 and IL-
1β colonic levels. The leaves of G. gummi-gutta showed significant anti-inflammatory
activity, especially against carrageenan induced paw oedema in rats and also exhibited
moderate in vitro anti-inflammatory action in hRBC membrane stabilization method
(Prasanth et al., 2013). Several compounds such as garcinol, guttiferone K and guttiferone M
isolated from G. gummi-gutta also posses anti-inflammatory activity (Semwal et al., 2015).
G. gummi-gutta decreases the acidity and increase the mucosal defence in the gastric areas,
thereby it can be used as an anti ulcerogenic agent (Mahendran et al., 2002). The oral
administration of a fruit extract of G. gummi-gutta at doses of 1000 mg/kg BW/day for 5, 10
or 15 days exerted protective effects against indomethacin-induced damage of the gastric
mucosa in rats. G. gummi-gutta fruit extract showed anti-tumour activity against the cell
viability in the murine neuroblastoma cell line (Neuro-2A cells) (Mazzio and Soliman, 2009).
Garcinol, the major secondary metabolite in G. gummi-gutta was effectively used against
different cancer types such as breast cancer, Burkitt lymphoma, colon cancer, esophageal
cancer, hepatocellular carcinoma, HeLa cells, kidney cancer, leukemia, lung cancer,
medulloblastoma, multiple myeloma, pancreatic cancer, prostate cancer and tongue cancer
(Saadat and Gupta, 2012).
3.2. Antiobesity property of hydroxyl citric acid (HCA): (−)-HCA is one of the important
supplements for anti-obesity and weight management (Chuah et al., 2013). The inhibition of
faty acid synthesis in vivo by HCA was first reported by Lowenstein et al., in 1971. (-)-HCA
at 1 mmole per kg of body weight inhibited fatty acid synthesis by about 75% (Lowenstein et
al., 1981). Sullivan et al., reoprted that fatty acid and cholesterol synthesis were blocked
significantly by HCA and also that rats fed with HCA tended to eat less compared to the
control animals (Sullivan et al., 1974). They have also reported that HCA lowered body fat
levels with no loss of body protein in test animals (Sullivan et al., 1974). Followed by these
156
observations, there has been a plethora of experiments on different models to test the anti
obesity activity of HCA (Majeed et al., 1994).
HCA exhibited antiobesity activity by inhibiting the ATP-citrate lyase, a catalyst for
the conversion process of citrate to acetyl-coenzyme A, the building block for fatty acid and
cholesterol synthesis (Tharachand et al., 2013, Downs et al., 2005). In human trails HCA
significantly improved blood lipid profiles by reducing total cholesterol, LDL and
triglycerides levels significantly (Preuss et al., 2005). HCA promotes weight loss in humans
without causing any stimulation in the central nervous system and produce only short term
anorexia and does not carry the risk of being addictive (Majeed et al., 1994, Downs et al.,
2005). HCA also regulated the serotonin levels related to satiety and decreased lipogenesis.
Garcinia extracts and HCA have widely been used for obesity and weight control
treatments and the long term continuous consumption demands systematic toxicity evaluation
and a number of reports about the toxicity of G. gummi-gutta fruits and supplements are
available in literature (Majeed et al., 1994). However, the potential contributions of HCA as a
weight loss agent in humans were controversial, especially regarding the long term benefits
and when the randomized, placebo-controlled clinical trials were counted (Heymsfield et al.,
1998; Marquez et al., 2012). Also, some clinical studies reported various toxic effects such as
toxicity towards spermatogenesis and hepatotoxicity (Kim et al., 2013). However, scientific
evidence based on structure, mechanism of action and long history of the use of Garcinia had
shown ‘no observed adverse effect level’ (NOAEL) at levels up to 2800 mg/day and suggests
that HCA is safe for use (Chuah et al., 2012, 2013).
3.3: Biological activities of garcinol: Garcinol, the major polyisoprenylated benzophenone

isolated from G. indica exhibits potential antioxidant activity by scavenging DPPH radicals,
hydroxyl radicals, suppressing superoxide anion, effective against peroxynitrite-induced lipid
peroxidation and inhibiting xanthine oxidase activity. The strong antioxidant activity of
garcinol is attributed to the presence of both the phenolic hydroxy groups and β-diketone
moiety that shows keto enol tautomerism as in the case of curcumin (Padhye et al., 2009).
Garcinol plays an important role in the treatment of gastric ulcers caused by the hydroxyl
radical or by a chronic infection with Helicobacter pylori as evident from its antiulcer activity
in rats induced by indomethacin and acts as a good antioxidant when administered orally
(Yamaguchi et al., 2000; Kolodziejczyk et al., 2009). It shows antibiotic activity against
methicillin-resistant Staphylococcus aureus comparable to that of vancomycin and also
proven to exhibit several anticancer activities. Garcinol is also able to suppress colonic
aberrant crypt foci (ACF) formation in rats and inhibits topoisomerases I and II at
concentrations comparable to that of etoposide. Garcinol decreases the cell viability,
increases cell death and apoptosis in human leukemia HL-60 cells, HT-29 cells, HeLa cells
and colon cancer cells (Pan et al., 2001; Balasubramanyam et al., 2004). 4-NQO induced oral
carcinogenesis in rats and Nic-induced human breast cancer (MDA-MB-231) cell
proliferation were suppressed by garcinol (Yoshida et al., 2005; Chen et al., 2011). Earlier
studies showed that garcinol acts as a neuroprotective agent by inhibiting the expression of
inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) in lipopolysaccharide
activated macrophages (LPS) and blocks activation of eukaryotic transcription factor NF-κB
induced by LPS (Liao et al., 2004). It has been established that the phenolic hydroxyl groups
as well as -diketone moiety, that shows keto-enoltautomerism as in the case of curcumin, is
157
important for the biological activities of garcinol. The isoprenyl chain consists of
hydrophobic sites, is also important for binding to biological targets (Padhye et al., 2009).
In addition, other secondary metabolites isolated from G. gummi-gutta also showed
various biological activities. Xanthones reported from G. gummi-gutta shows activities such
as vasodilatory, antimalarial, antiviral activity, human leukemia, cytotoxic activity, α-
glucosidase activity, CNS activity and platelet activating factor (PAF). Guttiferones and
polyisoprenylated benzophenones reported from G. gummi-gutta have shown interesting
biological properties such as leishmanicidal, anticancer, antifungal, antiproteolytic,
cytotoxicity, apoptotic, cytoprotection against HIV-1 in vitro and inhibited the binding
activity of a-liver X receptor (LXRa) but is less effective against b-receptor (LXRb).
Conclusions
G. gummi-gutta is a common fruit plant of the Western Ghats, attributed with a wide range of
applications ranging from food, medicines and nutraceutics. The fruit rind of G. gummi-gutta
is the major source of (−)-hydroxycitric acid (HCA). In addition, secondary metabolites such
as xanthones, benzophenones, organic and amino acids were also reported from this plant.
The potential beneficial effects include antioxidant, antihelmenthic, antidiabetic,
antimicrobial, antiobesity and hyperlipidaemic properties. Reports on the toxicity and
observations during clinical trials suggest that G. gummi-gutta is safe for human
consumption.
References
1. Anonymous. 1956. The wealth of India: Raw materials, Vol: IV: F-G, NISCAIR, New
Delhi.
2. Antony B, Varghese W and Elias M, 1999. Spectrophotometric determination of
hydroxycitric acid. Indian J. Pharm. Sci., 316-317.
3. Balasubramanyam K, Altaf M, Varier RA, Swaminathan V, Ravindran A, Sadhale PP
and Kundu TK. 2004. Polyisoprenylated benzophenone, garcinol, a natural histone
acetyltransferase inhibitor, represses chromatin transcription and alters global gene
expression. J. Biol. Chem., 279(32), 33716-3326.
4. Carratu B, Boniglia C, Giammarioli S, Mosca M and Sanzini E. 2008. Free amino acids
in botanicals and botanical preparations. J. Food Sci., 73, C323-8.
5. Chen CS, Lee CH, Hsieh CD, Ho CT, Pan MH, Huang CS, Tu SH, Wang YJ, Chen
LC, Chang YJ, Wei PL, Yang YY, Wu CH and Ho YS. 2011. Nicotine-induced human
breast cancer cell proliferation attenuated by garcinol through down-regulation of the
nicotinic receptor and cyclin D3 proteins. Breast Cancer Res Treat, 125(1), 73-87.
6. Chen L, Qing J and He S. 2001. Study on synthesis of hydroxycitric acid. J. Nanjing.
Univ. Sci. Technol., 25, 282-285.
7. Chuah LO, Ho WY, Beh BK and Yeap SK. 2013. Updates on Antiobesity effect of
Garcinia origin (−)-HCA. Evid. Based Complement. Alternat. Med., 2013.
8. Chuah LO, Yeap SK, Ho WY, Beh BK and Alitheen NB. 2012. In vitro and in vivo
toxicity of garcinia or hydroxycitric acid: A review. Evid. Based Complement. Alternat.
Med., 2012.
158
9. Downs BW, Bagchi M, Subbaraju GV, Shara MA, Preuss HG and Bagchi D. 2005.
Bioefficacy of a novel calcium-potassium salt of (−)-hydroxycitric acid. Mutat. Res., 579,
149-162.
10. Hayamizu K , Hirakawa H, Oikawa D, Nakanishi T, Takagi T, Tachibana T and Furuse
M. 2003. Effect of Garcinia cambogia extract on serum leptin and insulin in mice.
Fitoterapia, 74, 267-273.
11. Heymsfield SB, Allison DB, Vasselli JR, Pietrobelli A, Greenfield D and Nunez C. 1998.
Garcinia cambogia (Hydroxycitric acid) as a potential antiobesity agent: a randomized
controlled trial. J. Am. Med. Assoc., 280(18), 1596-1600.
12. Iinuma M, Ito T, Miyake R, Tosa H, Tanaka T and Chelladurai V. 1998. A xanthone from
Garcinia cambogia. Phytochemistry, 47, 1169-1170.
13. Jacob KMP, Ali MA, Vishnu H, Shylaja G, Mythili S and Sathiavelu A. 2015. Evaluation
of antibacterial and antioxidant activity of Garcinia gummigutta. Int. J. Drug Dev. Res.,
7, 57-59.
14. Jayaprakasha GK and Sakariah K K. 2000. Determination of (-)-hydroxycitric acid in
commercial samples of Garcinia cambogia extracts by liquid chromatography using
ultraviolet detection. J. Liq. Chromatogr. Relat. Technol., 23, 915-923.
15. Jayaprakasha GK and Sakariah K K. 2002. Determination of organic acids in leaves and
rinds of Garcinia indica (Desr.) by HPLC. J. Pharm. Biomed. Anal., 28(2), 379-384.
16. Jayaprakasha GK and Sakariah KK. 1998. Determination of organic acids in Garcinia
cambogia (Desr.) by HPLC. J. Chromatogr. A., 806, 337-339.
biochemistry of (−)-hydroxycitric acid from Garcinia. J. Agric. Food Chem., 50, 10–22.
18. Kalia RK, Malik SK and Chaudhury R. 2012. In vitro morphogenetic studies on three
species of Garcinia. J. Plant Biochem. Biotechnol., 21, 279-85.
19. Kim YJ1, Choi MS, Park YB, Kim SR, Lee MK and Jung UJ. 2013. Garcinia Cambogia
attenuates diet-induced adiposity but exacerbates hepatic collagen accumulation and
inflammation. World J. Gastroenterol., 19 (29), 4689-701.
20. Kolodziejczyk J, Masullo M, Olas B, Piacente S and Wachowicz B. 2009. Effects of
garcinol and guttiferone K isolated from Garcinia cambogia on oxidative/nitrative
modifications in blood platelets and plasma. Platelets, 20(7), 487-492.
21. Lewis YS and Neelakantan S. 1965. (−)-Hydroxycitric acid-the principal acid in the fruits
of Garcinia cambogia Desr. Phytochemistry, 4, 619-625.
22. Lewis YS, Neelakantan S and Anjanamurthy C. 1964. Acids in Garcinia cambogia.
Current Sc., 33(3), 82-83.
23. Liao CH, Sang S, Liang YC, Ho CT and Lin JK. 2004. Suppression of inducible nitric
oxide synthase and cyclooxygenase-2 in down regulating nuclear factor-kappa B pathway
by garcinol. Mol. Carcinog., 4, 140-149.
24. Lowenstein JM and Bruneugraber H. 1981. Hydroxycitrate. In Methods in Enzymology;
Lowenstein JM. Ed. Academic Press, New York, 72, pp 486-497.
25. Mahendran P, Vanisree AJ and Shyamala Devi CS. 2002. The antiulcer activity of
Garcinia cambogia extract against indomethacin induced gastric ulcer in rats. Phytother.
Res., 16, 80-83.
159
26. Majeed M, Rosen R, McCarty M, Conte A, Patil D and Butrym E. 1994. Citrin; A
revolutionary, herbal approach to weight management. New editions publishing.
Burlingame, California.
27. Manilal KS. 2003. Van Rheede’s Hortus Malabaricus, Vol. 1, English edition. University
of Kerala, Thiruvananthapuram.
28. Maridass M, Ramesh U and Raju G. 2010. Evaluation of phytochemical,
pharmacognostical and antibacterial activity of Garcinia Gummicutta Leaves.
Pharmacologyonlin., 1, 832-837.
29. Marquez F, Babio N, Bullo M and Salas-Salvado J. 2012. Evaluation of the safety and
efficacy of hydroxycitric acid or Garcinia cambogia extracts in humans. Crit. Rev. Food
Sci. Nutr., 52, 585-594.
30. Masullo M, Bassarello C, Bifulco G and Piacente S. 2010. Polyisoprenylated
benzophenone derivatives from the fruits of Garcinia cambogia and their absolute
configuration by quantum chemical circular dichroism calculations. Tetrahedron., 66,
139-45.
31. Masullo M, Bassarello C, Suzuki H, Pizza C and Piacente S. 2008. Polyisoprenylated
benzophenones and an unusual polyisoprenylated tetracyclic xanthone from the fruits of
Garcinia cambogia. J. Agric. Food Chem., 56, 5205-5210.
32. Mazzio EA and Soliman KFA. 2009. In vitro screening for the tumoricidal properties of
international medicinal herbs. Phytother., 23, 385-398.
antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs. J. Hem.
Onc., 2(38).
34. Pan MH, Chang WL, Lin-Shiau SY, Ho CT and Lin JK. 2001. Induction of apoptosis by
garcinol and curcumin through cytochrome c release and activation of caspases in human
leukemia HL-60 cells. J. Agric. Food Chem. 49(3), 1464-1474.
35. Pandey R, Chandra P, Kumar B, Srivastva M, Aravind AA, Shameer PS and
constituents for quality assessment of Garcinia species using UHPLC-QqQ LIT-MS/MS.
Ind. Crops Prod., 77, 861-872.
36. Prasanth NV, Rasheed SP, Thomas T, Joseph S and Varghese CP. 2013. Evaluation of in
vitro and in vivo anti- inflammatory activity of Garcinia combogia. IJPPS., 5, 263-264.
37. Preuss HG, Garis RI, Bramble JD, Bagchi D, Bagchi M, Rao CV and Satyanarayana S.
2005. Efficacy of a novel calcium/ potassium salt of (−)-hydroxycitric acid in weight
control. Int. J. Clin. Pharmacol. Res., 25(3), 133-144.
38. Rani J and Lawerence B. 2015. Leaf extract of Garcinia gummi-gutta (L.) Robson against
pathogenic microorganisms. Int. J. Pharmaceut. Sci. Health Care., 1, 20-29.
39. Ranjani R, Khadira S A, Priya N and Vijayalakshmi K. 2014. Antioxidant profile of the
fruit rind of Garcinia cambogia and leaves of Bauhinia variegata an in vitro
investigation. Int. J. Pharmaceut. Res. Bio Sci., 3, 528-538.
40. Rao AR, Venkataraman K and Yemul SS. 1973. The structure of bronianone.
41. Saadat N and Gupta S V. 2012. Potential Role of Garcinol as an anticancer Agent. J.
Oncology, 1-8.
160
42. Semwal RB, Semwal D.K, Vermaak I and Viljoen A. 2015. A comprehensive scientific
43. Shivakumar S, Sandhiya S, Subhasree N, Agrawal A and Dubey GP. 2013. In vitro
assessment of antibacterial and antioxidant activities of fruit rind extracts of Garcinia
cambogia. L. Int. J. Phar. Pharmaceut. Sci., 5, 254-257.
(eds.), Flora of India 3. Botanical Survey of India, Kolkatta, 86-151.
45. Sreenivasan A and Venkataraman R. 1959. Chromatographic detection of the organic
constituents of Gorikapuli (Garcinia cambogia Desr.) used in pickling fish. Current Sc.,
28 (04), 51-52.
46. Subhashini N, Nagarajan G and Kavimani S. 2011. In vitro antioxidant and
anticholinesterase activities of G. combogia. Int. J. Phar. Pharmaceut. Sci., 3, 129-132.
47. Sullivan AC, Triscari J, Hamilton JG, Miller ON and Wheatley VR. 1974. Effect of (−) -
hydroxycitrate upon the accumulation of lipid in the rat: I. Lipogenesis. Lipids, 9, 121-
128.
48. Tharachand, Selvaraj I and Avadhani M. 2013. Medicinal properties of Malabar
Tamarind, Garcinia Cambogia (Gaertn.) DESR. Int. J. Pharm. Sci. Rev. Res., 19, 101-
107.
49. Venkataraman K. 1973. Pigments of Garcinia species. Indian National Science Academy,
New Delhi. 39(A) 6, 365-381.
51. Yamada T, Hida H and Yamada Y. 2007. Chemistry, physiological properties, and
microbial production of hydroxycitric acid. Appl. Microbiol. Biotechnol., 75, 977-982.
52. Yamaguchi F, Saito M, Ariga T, Yoshimura Y and Nakazawa H. 2000. Free radical
scavenging activity and antiulcer Activity of garcinol from Garcinia indica fruit rind. J.
Agric. Food Chem., 48, 2320-2325.
53. Yoshida K, Tanaka T, Hirose Y, Yamaguchi F, Kohno H, Toida M, Hara A, Sugie S,
Shibata T and Mori H. 2005. Dietary garcinol inhibits 4-nitroquinoline 1-oxide-induced
tongue carcinogenesis in rats. Cancer Lett., 221, 29-39.
161
Chapter 11
Gamboge- The bark exudate from Garcinia species
Siji Aral and K. B. Rameshkumar*

*
Abstract
Garcinia bark exudates, known as gamboges, has been used as a pigment in Indian murals
and European water colour-paintings. It has also been used for dyeing clothes and for
colouring wood, metal and leather. Gamboge has several uses in traditional medicinal
systems, especially as a purgative and also externally used for treating infected wounds. The
major sources of gamboges are Garcinia hanburyi and Garcinia morella. Gamboge contains
70% to 80% yellow resin and 15% to 25% water soluble gum and the remaining portion is
composed of esters, hydrocarbons, wax and ash. The characteristic bioactive compounds in
gamboges were identified as caged xanthones, such as gambogic acid and morellin, that
possess potential anticancer properties. This chapter provides a detailed account on history,
distribution, chemistry and uses of gamboge.
Keywords: Gamboge, Garcinia hanburyi, Garcinia morella, Caged xanthones, Gambogic

acid, Morellin
Introduction
Recently there has been an increased demand for plant derived natural products, mainly due
to the safety concerns of the synthetic pigments, colouring agents and other additives that are
essential ingredients in several industrial sectors such as cloth dyeing, food and nutraceutical.
Among the different plant products, exudates are in high demand now, due to the low
toxicity, abundant availability, biocompatibility, biodegradability and inertness compared to
synthetic alternatives.
Gamboge, also known as camboge, is the exudate from the bark of Garcinia species.
Garcinia species are perhaps known all over the world in ancient times by this value added
product. The dried exudates are used as a pigment in Indian murals and European water-
paintings and dyeing clothes and also for colouring wood, metal and leather. Though
primarily gamboge was used as a colouring agent, several traditional medicinal uses were
also attributed to the exudate. Recent phytochemical investigations showed the bark exudates
as rich source of bioactive secondary metabolites such as caged xanthones. The present
chapter summarises the history, traditional uses and phytochemistry of gamboge.
1. History of gamboge as a natural colouring agent

Plant exudates were used by ancient civilisations world over for various purposes and the
usage can be traced back to about 3000 BC, where the Egyptian civilization used gum
Arabica, the exudates from Acacia. The word gamboge comes from Gambogia, the Latin
162
word for Cambodia. Gamboge was used from ancient times to dye the clothes and also to
make a transparent yellow varnish for the coloring of wood, metals and leather. The pigment
was made more usable by mixing with other yellow pigments such as lemon yellow or
alumnia. The color of gamboge is a deep tone of saffron, and gamboge is recognised as a
distinct colour (Maerz and Paul, 1930). When used as a water colour, it gives a bright
transparent golden yellow colour and is not a true pigment. In ancient India, gamboge had an
important place among artists, herbalists and spiritual communities. The earliest evidence of
the use of gamboge comes from artefacts of eighth century from East Asia, where the yellow
colour is presumed to be derived from gamboge. Garcinia exudates were used to dye the
robes of Buddhist monks (Lewington et al., 1990). Gamboge was first brought to Europe, in
1603, by Admiral Van Neck, and used as a transparent oil color by Flemish painters
(Chantarasriwong et al., 2010). John Smith in ‘The Art of Painting in Oyl’, published in 1701,
describes a method for preparing the colour. The botanic artist William Hooker created the
pigment ‘Hooker's Green’ that gives a special green to colouring leaves by mixing Green
Malachite or Prussian blue and gamboge (Winter et al., 1997). One can assume that since the
gamboge faded so rapidly relative to iron blue, trees in some old artworks have become blue.
A tradition of mural paintings in Kerala, south India, following the sixteenth century
techniques, uses the exudates of G. morella, locally known as Eravikkara in Malayalam in
combination with the leaves of Indigofera tinctoria to get different shades of green (Nayar et
al., 1999). Jean Baptiste Perrin in his work on Brownian movement used a colloidal
suspension of gamboge particles to investigate the phenomenon and derive a value for the
Avogadro number in 1926 (Chantarasriwong et al., 2010).
2. Traditional medicinal uses of gamboge

The exudates from different Garcinia species were used therapeutically in traditional
medicine, especially as emetics and cathartics (Majeed et al., 1994). Gamboge obtained from
Garcinia hanburyi is used externally for infected wound and for pain and oedema in
traditional Thai medicine. It has cathartic activity and is used in veterinary medicine as a
drastic purgative. Gamboge is a laxative in doses of 10-15 cgm., produces abundant
evacuations with violent colicky pains in doses of 30-50 cgm. It can cause vomiting, nausea
and griping in high doses. It is also used as a vermifuge. It is usually combined with other
purgatives such as aloe or calomel, to strengthen their effect. It is used in traditional medicine
for the treatment of ulcers, skin infection, appetite suppression and to lower blood pressure
(Panda, 2005). The resin of G. morella has purgative action and was mainly applied for
intestinal complaints. The cathartic property of the exudate was made use for expelling
tapeworms from the intestine. However, large doses are toxic, leading to gastro enteritis.
3. Extraction of gamboge
Gamboge is generally extracted by tapping of Garcinia species. The plant tissues of the
Clusiaceae members were characterized by the presence of latex channels and different
shades of yellow were reported for the exudates from Garcinia species (Nogueira et al.,
2001). Generally trees of ten years old are tapped by making spiral incisions in the bark and
traditionally collected in bamboo containers. The hard and brittle lumps of the solidified raw
gamboge are dark yellow in color, which when pulverized, turns into a bright yellow powder.
This powder is mixed with a variety of binders to make paints and varnishes.
163
4. Major sources of gamboge

The major sources of gamboge were G. hanburyi (Cambodia and Thailand), G. morella
(India and Sri Lanka), and G. elliptica and G. heterandra (Myanmar). The chief trade supply
was obtained from Siam in the form of cylindrical pieces or sticks and until recently, the gum
resin of Siam was referred to Garcinia cochin-sinensis and that of Ceylon to Hebradendron
cambogioides, while that of Southern India was supposed to be the produce of Garcinia
pictorial (Watt,1890; Utpala and Nandakishore, 2016).
True gamboge of use in arts and medicine in India derives mainly from the gum resin
of G. morella (Figure 1). The tree is distributed in Indo-Malay and Sri Lanka. All parts of the
plant yield a thick yellow exudate.
Figure 1. Garcinia morella twig, seeds and bark
Table 1. Distribution of gamboge in different Garcinia species

Sl. Garcinia species Remarks
No.
G. anomala Planci. & Trian. Gamboge is inferior in quality.
G. cornea Linn. Gamboge is inferior in quality.
G. cowa Roxb. Gamboges is inferior in quality, with paler colour than that of G.
morella and is insoluble in water. Bark is used to extract a light
yellow colour for colouring of the cloth for the garments of
Buddist monks.
G. eugeniaefolia Wall. The exudate a green varnish
G. gummi-gutta (L.) N. Robson The tree yields a yellow, insoluble, very adhesive gum, which is
valueless as a pigment on account of its insolubility in water
G. hanburyi Hook. f. Exudates is known as Siam gamboge and is used as a purgative
and externally used for infected wounds in Thai traditional
medicine.
G. heterandra Wall. This tree yields a superior kind of gamboge, so similar to the
Gamboge of commerce. It readily forms an emulsion with water.
Burmese priests occasionally use this gamboges to dye their
robes and the Karens to dye their thread. The gum resin is
occasionally employed as a medicine by Burman native
practitioners.
G. indica The exudate is sparingly soluble in water, but it became
164
insoluble when dried.

G. mangostana Linn. This species exudes gamboge of inferior quality
G. morella Desrouss This species produces the true gamboge of medicine and of the
arts.
G. speciosa Wall. It yields an inferior gamboge.
G. stipulata T. And. The tree and fruit yield a yellow gum, but not used as gamboge.
G. succifolia Kurz The species yield inferior quality gamboge at very little yield.
G. travancorica Beddome Every portion of the tree yields an abundance of bright yellow
gamboge.
G. wightii T. Anderson The gamboge of this species is very soluble and yields a good
pigment.
G. xanthochymus Hook. f. This species yields a large quantity of inferior gamboge both
from the stem and the fruit rind which is extensively used as a
cotton dye in Assam. The exudate contains a larger proportion of
gum than that derived from other species. The exudates are
sparingly soluble in water, but it became insoluble when dried.
Figure 2 shows the exudates from 25 Garcinia species distributed in India. The colour of the
exudates varies from white to different shades of yellow.
5. Chemistry of gamboge
Gamboge, being a well known commercial commodity of historical importance, had been a
subject of intensive analytical investigation (Chantarasriwong et al., 2010; Utpala and
Nandakishore 2016). Venkataraman (1973) has reviewed the chemistry of pigments from
Garcinia species.
Exudates are a complex mixture of organic compounds that ooze out of plants through
pores, or wounds. Gamboge is odorless but slightly acidic (Nayar et al., 1999). Exudates
consist largely of gum, resin or latex, depending on the tree species. The exudates from
Garcinia species are generally yellow translucent and sometimes white to reddish, which get
solidified when exposed to air.
The resin portion of the exudates was separated through partition with ethyl acetate.
The remaining aqueous portion represents gum content of the exudate. Gamboge contains
about 70% to 80% yellow resin, 15% to 25% water soluble gum, and the remaining portion is
composed of esters, hydrocarbons, wax and ash. In a recent report, G. gummi-gutta exudates
contains 68% resin, while G. indica contains 60% resin followed by G. xanthochyma (40%)
(Parthasarathy and Nandakishore, 2016). The brittle resin is deep orange colour in thin layers
and when it is fine powdered, its colour is gamboge yellow. Gamboge resin is insoluble in
water, but soluble in alcohol. It dissolves in a solution of caustic potash, forming a dark red
liquid which gets precipitated by acids and lime water, and some metallic salts like lead,
brown by protosulphate of iron and green by the nitrate of copper. The precipitates formed
with the metallic salts are regarded as gambogiates of the respective metals, as they consist of
the resin and the oxide of the metal.
165
Figure 2. Garcinia bark exudates (A. G. rubro-echinata, B. G. imberti, C. G. wightii, D. G.

travancorica, E. G. morella, F. G. talbotii, G. G. pushpangadaniana, H. G. indica, I. G. gummi-gutta
var. gummi-gutta, J. G. gummi-gutta var. papilla, K. G. gummi-gutta var. conicarpa, L. G.
andamanica, M. G. assamica, N. G. anomala, O. G. cowa, P. G. dhanikariensis, Q. G. dulcis, R. G.
hombroniana, S. G. kydia, T. G. speciosa, U. G. xanthochymus, V. G. cornea, W. G. livingstonei, X.
G. mangostana, Y. G. spicata)
(-) Gambogic acid has been identified as the principal pigment of gamboge derived
from Garcinia hanburyi, while related investigations of the seeds and the resin of Garcinia
morella led to the isolation of (-) morellin (Figure 3) (Rao, 1937; Lang and Katz, 1949;
Yates et al., 1963). Both of the compounds belong to an interesting group of complex
compounds known as caged xanthones, with unique 4-oxatricyclo [4.3.1.0] dec-2-one ring
system. Gambogic acid occurs in nature as a mixture of epimers at the C2 center (C2R and
166
C2S) that can be separated by modern chromatographic and analytical techniques (Han et al.,
2006). C2S Gambogic acid is also known as epigambogiac acid. Garcinia hanburyi has been
reported as a rich source of such cytotoxic caged xanthones (Reutrakul et al., 2007). Many of
such caged xanthones have been shown to possess anticancer and antitumor properties.
COOH CHO
O O
O O
O O O
O
OH O
OH O
Gambogic acid Morellin

Figure 3. Structure of gambogic acid and morellin
6. Pharmacological activities of gamboge

The caged xanthone gambogic acid has been a centre of attraction for the pharmacological
researchers as evident from the ever increasing number of publications over the compound
(Chantarasriwong et al., 2010). The toxicity of gamboge was also noted early onwards and
several accounts warn against licking brushes containing gamboge. Gambogic acid has been
identified as a potent anti-tumor agent that inhibited cancer cell growth in vitro and in vivo
with minimal toxicity to normal cells, in its pre-clinical trials (Kasibhatla et al., 2005). The
unique caged xanthone structure is the basis of gambogic acid induced anti-cancer effects.
Gambogic acid induced apoptosis has been reported in many cancer cell types including
leukemia, cervical cancer, cholangio carcinoma, hepatoma, breast cancer, gastric cancer,
glioblastoma and osteosarcoma (Zhao et al., 2004; Yu et al., 2006; Yang et al., 2007; Wang
and Chen, 2012). Gambogic acid inhibits cell proliferation in multidrug-resistant cancer cells.
It has also prevented cancer metastasis and angiogenesis, and has finished phase II clinical
trials in China (Wang et al., 2011). The potent anticancer activity of gambogic acid is mainly
attributed to its activation of the impaired apoptotic pathways in cancerous cells via down-
regulation of telomerase (Guo et al., 2006). Morellin and gambogic acid have been reported
as potential antibacterial compounds and exhibited high in vitro specific growth inhibitory
effects on Gram-positive bacteria (Rao and Natarajan, 1950; Chantarasriwong et al., 2010).
Conclusions
Gamboge, the dried exudate from several Garcinia species, was used as a pigment in water
paintings, dyeing cloths and also for coloring wood, metals and leather. Alternative products
obtained from renewable sources, are getting prominence and the potential of gamboge as a
natural substitute for colouring material is highly appreciated. Though historically known as
source of coloring pigments, gamboge is now reputed as source of a new family of natural
products, known as caged xanthones. The remarkable chemical structure, biosynthesis,
biology and medicinal potential of the caged xanthones open up a new window to the
potential utility of gamboge.
167
References
1. Chantarasriwong O, Batova A, Chavasiri W and Theodorakis EA. 2010. Chemistry and
biology of the caged Garcinia xanthones. Chem. Eur. J., 16(33), 9944-9962.
2. Guo QL, Lin SS, You QD, Gu HY, Yu J, Zhao L, Qi Q, Liang F, Tan Z and Wang X.
2006. Inhibition of human telomerase reverse transcriptase gene expression by gambogic
acid in human hepatoma SMMC-7721 cells. Life Sci., 78(11), 1238-1245.
3. Han QB, Song JZ, Qiao CF, Wong L and Xu HX. 2006. Preparative separation of
gambogic acid and its C-2 epimer using recycling high-speed counter-current
chromatography. J Chromatogr A, 1127:298-301.
4. Kasibhatla S, Jessen KA, Maliartchouk S, Wang JY, English NM, Drewe J, Qiu L,
Archer SP, Ponce AE, Sirisoma N, Jiang S, Zhang HZ, Gehlsen KR, Cai SX, Green DR
and Tseng B. 2005. A role for transferrin receptor in triggering apoptosis when targeted
with gambogic acid. Proc. Natl. Acad. Sci. U.S.A., 102(34), 12095-12100.
5. Lang M and Katz A. 1949. Chemistry of gamboge. Pharm. Acta Helv., 24(11), 387-401.
6. Lewington A. 1990. Recreation- Plants that Entertain Us, Plants for people, Natural
History Museum Publications, London.
7. Maerz A and Paul MR. 1930. A Dictionary of Color. McGraw-Hill, New York.
8. Majeed M, Rosen R, McCarty M, Conte A, Patil D and Butrym E. 1994. Citrin; A
revolutionary, herbal approach to weight management. New Editions Publishing.
California.
9. Nayar TS, Binu S and Pushpangadan P. 1999. Uses of plants and plant products in
traditional Indian mural paintings. Econ. Bot., 53(1), 41-50.
10. Nogueira PC, Bittrich V, Shepherd GJ, Lopes AV and Marsaioli AJ. 2001. The ecological
and taxonomic importance of flower volatiles of Clusia species (Guttiferae).
11. Panda H. 2005. Herbs Cultivation and Medicinal Uses. National Institute of Industrial
Research, New Delhi.
12. Parthasarathy U and Nandakishore OP. 2016. Garcinia bark exudates- an important
phytochemical source. Curr. Sci., 110, 1617-1619.
13. Rao BS. 1937. Morellin, a constituent of the seeds of Garcinia morella. J. Chem. Soc.,
853-855.
14. Rao RR and Natarajan S. 1950. On morellin, the antibacterial principle of the seeds
of Garcinia morella Desrous. Curr. Sci.19 (02) 59-60.
15. Reutrakul V, Anantachoke N, Pohmakotr M, Jaipetch T, Sophasan S, Yoosook C, Kasisit
J, Napaswat C, Santisuk T and Tuchinda P. 2007. Cytotoxic and anti-HIV-1 caged
xanthones from the resin and fruits of Garcinia hanburyi. Planta Med., 73(01), 33-40.
16. Utpala P and Nandakishore OP 2016. Garcinia bark exudates– an important
phytochemical source. Cur. Sc., 110 (9), 1617-1619.
17. Venkataraman K. 1973. Pigments of Garcinia species. Indian National Science Academy,
New Delhi. 39(A)6, 365-381.
18. Wang X and Chen W. 2012. Gambogic acid is a novel anti-cancer agent that inhibits cell
proliferation, angiogenesis and metastasis. Anti-Cancer Agents Med. Chem., 12(8), 994-
1000.
19. Wang X, Lu N, Yang Q, Gong D, Lin C, Zhang S, Xi M, Gao Y, Wei L, Guo Q and You
Q. 2011. Studies on chemical modification and biology of a natural product, gambogic
168
acid (III): determination of the essential pharmacophore for biological activity. Eur. J.
Med. Chem., 46(4), 1280-1290.
21. Winter J. 1997. Gamboge In. Fitzhugh EW (Ed.) Artists pigments a handbook of their
history and charecteristics. Vol. 3. Oxford University Press, Washington.
22. Yang Y, Yang L, You QD, Nie FF, Gu HY, Zhao L, Wang XT and Guo QL. 2007.
Differential apoptotic induction of gambogic acid, a novel anticancer natural product, on
hepatoma cells and normal hepatocytes. Cancer Lett., 256(2), 259-266.
23. Yates P, Karmarkar SS, Rosenthal D, Stout GH and Stout VF. 1963. Acetyl-α-gambogic
acid. Tetrahedron Lett., 4(24), 1623-1629.
24. Yu J, Guo QL, You QD, Zhao L, Gu HY, Yang Y, Zhang HW, Tan Z and Wang X. 2006.
Gambogic acid-induced G2/M phase cell-cycle arrest via disturbing CDK7-mediated
phosphorylation of CDC2/p34 in human gastric carcinoma BGC-823
cells. Carcinogenesis, 28(3), 632-638.
25. Zhao L, Guo QL, You QD, Wu ZQ and Gu HY. 2004. Gambogic acid induces apoptosis
and regulates expressions of Bax and Bcl-2 protein in human gastric carcinoma MGC-803
cells. Biol. Pharm. Bull., 27(7), 998-1003.
169
Chapter 12
Nutrient properties of important Garcinia fruits of India
Utpala Parthasarathy* and O. P. Nandakishore
ICAR- Indian Institute of Spices Research

Kozhikode- 673012, Kerala, India
*
Abstract
The importance of natural products is increasing day by day as the safety of synthetic
alternatives has generated lots of controversial questions. Garcinia species are an important
group of plants, being used for different purposes, especially as fruit crops, source of edible
oils and fats, and nutraceuticals in different parts of the world. The nutraceutical property of a
fruit is determined by the metabolites like carbohydrates, proteins, vitamins and minerals and
also the secondary metabolites such as phenols and flavonoids. The food and nutritive values
of Garcinia species have attracted significant scientific attention and the present chapter is an
attempt to review the nutrient properties of important Garcinia fruits in India.
Keywords: Garcinia fruits, Nutrient properties, Minerals, Vitamins, Phenolics
Introduction
Plants and fruits are nature’s wonderful gift to mankind; indeed, the edible fruits are life
enhancing medicines packed with vitamins, minerals, antioxidants and many phyto-nutrients.
They are an absolute feast to our sight, not just because of their color and flavor but for their
unique nutrition profile that help to keep human body healthy. There are plenty of
underutilized fruit crops which possess immense nutraceutical value. The underutilized
species are restricted to the geographical place of their availability but not explored properly
for their constitution or utility (Gruere et al., 2006). Majority of them produce fruits which
are rich sources of carbohydrates, proteins, fats, vitamins and minerals than the conventional
fruits (Krishnamurthy and Sarala, 2011). Garcinia is one such underutilized group of fruit
bearing plants.
Many species of Garcinia have fruits with edible arils and are eaten locally. Fresh and
dry Garcinia fruit rinds (exocarp) are used as spice, condiment and garnish in several
cuisines to impart an acidic flavour to the food and to enhance shelf life (Utpala et al., 2010).
Garcinia species such as G. cowa, G. kydia, G. cowa, G. lanceaefolia, G. mangostana, G.
atroviridis and G. prainiana were cultivated for their fruits world over. The best known
species is the mangosteen (G. mangostana), also known as the ‘queen of tropical fruits’,
which is now cultivated throughout Southeast Asia and other tropical countries. In
Travancore, Malabar and Konkan region of south India, the fruits of G. cambogia and G.
indica are used in garnishing curries and also as a substitute for tamarind. Fruit and syrup of
G. indica is very popular in ‘Konkan’ region as a refreshing and rejuvenating drink. Garcinia
pedunculata, G. kydia, G. cowa and G. lanceaefolia are the most important species in North
Eastern parts of India, where the sundried slices of the fruits were used for culinary purposes
and as folk medicine.
170
The seeds of Garcinia species yield oil that can be used as edible oil as well as
illuminating fuels. Garcinia butter is obtained from the seeds and used mainly as an edible
fat. The seed of G. indica fruits yield valuable edible fat known as ‘kokum butter’ and is
popular in south India. Refined and deodorized fat from Garcinia seeds are generally white
or creamy in colour and compares favorably with high class hydrogenated fat. Garcinia fats
are rich in stearic acid and are considered nutritive, demulcent, astringent and emollient. The
use and preparation of Garcinia butter is still under exploited. Garcinia species have been
considered recently to have ample medicinal importance as well (Korikanthimath and Desai,
2005; Utpala and Nandakishore, 2014).
Garcinia species are abundant in the Western Ghats and in the North Eastern
Himalayas. G. indica and G. gummi-gutta are the most common fruit species of the Western
Ghats while G. pedunculata, G. lanceaefolia and G. kydia are the common fruit species of
North Eastern foot hills of Himalayas. G. xanthochymus and G. mangostana are available in
both the ecosystems. The nutraceutical property of a fruit is determined by the metabolites
like carbohydrates, proteins, vitamins and minerals present in it and their relative amount.
The secondary metabolites such as phenols and flavonoids also contribute significantly to the
medicinal utility. The present chapter elaborates the nutritional constituents of important
Garcinia species in India.
1. Primary metabolites of Garcinia fruits

Primary metabolites are directly involved in the growth and development of the plant and
also serve as source of energy. The concentration of primary metabolites such as sugars,
proteins and crude fats of the Garcinia fruits are given in Table 1. Carbohydrates were the
major metabolites present in Garcinia fruits followed by proteins. Carbohydrates are the
major nutrients in fruits. They are the primary energy source of the cell and the simplest
biomolecules that are synthesized naturally. Reducing sugars are the simplest carbohydrate
molecules having free aldehyde or ketone group and can reduce metal ions to lower oxidation
state. Reducing sugars like glucose and fructose are the sweetness principles of a fruit.
Carbohydrate content showed a great variation among various Garcinia species; from 3.75 %
to 15.12 %. Total proteins ranged from 1.82 % to 4.93 %. The percentage of reducing sugars
is less in comparison to the other organic acids present. This may be the reason of very sour
taste of the fruits even when they are ripened. The palatability of G. mongostana was due to
the high content of reducing sugars (1.28 %). G. indica showed a higher amount of total
proteins (4.78 %), while total carbohydrates and crude fats were higher in G. mangostana.
This indicates that G. mangostana provides more calories than other Garcinia species. Crude
fats were very nominal in all the Garcinia fruits, showing only very small variation among
them.
2. Mineral composition of Garcinia fruits

Minerals do not provide energy, but play a major role in metabolism and functioning of cells
and are required in small amounts for human health. The mineral composition of the fruit
rinds of Garcinia species is given in Table 2.
171
Table 1. Primary metabolite composition of Garcinia fruits (Utpala and Nandakishore, 2014)
Garcinia species Total Reducing Total Crude fats
carbohydrates sugars proteins (g/100g)
(g/100g) (g/100g) (g/100g)
G. gummi-gutta 7.11 0.51 3.25 0.34
G. indica 6.24 0.63 4.78 0.12
G. mangostana 15.72 1.28 1.82 0.49
G. xanthochymus 4.12 0.98 4.01 0.41
G. subelliptica 4.82 0.71 3.76 0.15
G. kydia 9.07 0.6 4.33 0.42
G. lanceaefolia 5.85 0.65 3.45 0.13
G. pedunculata 7.93 0.95 4.93 0.20
G. mangostana (163.6 mg/100g) was richer in total minerals followed by G. indica (109.3
mg/100g). Potassium, calcium and magnesium showed a great variation (CV% being 27.5,
40.6 and 20.87 respectively) among the species while amount of sodium, iron and phosphorus
were almost similar.
Table 2. Mineral compositions of Garcinia fruits (Utpala and Nandakishore, 2014)

Garcinia species Sodium Potassium Calcium Magnesium Iron Phosphorus
(mg/100g) (mg/100g) (mg/100g) (mg/100g) (mg/100g) (mg/kg)
G. gummi-gutta 2.88 26.6 12.67 14.35 9.00 5.34
G. indica 1.55 44.5 13.21 33.45 12.06 4.51
G. mangostana 2.58 78.3 5.82 60.43 9.02 7.45
G. xanthochymus 2.06 28.4 13.07 30.62 10.82 3.48
G. subelliptica 1.52 43.3 12.33 34.45 9.00 5.43
G. kydia 2.54 38.7 12.54 25.25 10.00 4.32
G. lanceaefolia 1.35 52.3 12.54 30.23 9.00 3.64
G. pedunculata 2.48 27.3 13.21 35.43 10.12 4.32
Magnesium and potassium were found to be the predominant minerals in Garcinia fruits. G.
mangostana is richer in potassium (78.3 mg), magnesium (60.43 mg) and phosphorus (7.45
mg/kg) (Utpala and Nandakishore, 2014). Potassium, calcium and magnesium are present in
good percentage in fruit rind tissues, and make Garcinia an important medicinal fruit.
Calcium is the major component of bones and teeth and is essential for muscular function and
blood clotting (Decupyre, 2014). Other than potassium, Garcinia has a mineral content
similar to major fruits like apple, grapes, peaches or banana (Decupyre, 2014). Magnesium,
phosphorus and iron contents were also higher in Garcinia than the commonly consumed
fruits.
3. Vitamin composition of Garcinia fruits

Vitamins are organic compounds that play a major role in regulation of enzymes, cell signals
and metabolic pathways. The vitamins present in the detectable range were vitamins B1, B2,
B3, B12 and C. Vitamin A, E and D could not be detected in Garcinia fruit extracts. The
composition of vitamins in the fruits of Garcinia species are given in Table 3. Ascorbic acid
was found to be the major vitamin in Garcinia fruits. The total vitamin content was highest in
172
G. mangostana (61 mg/100 g), followed by G. pedunculata (36 mg/100 g). Except ascorbic
acid, other vitamins showed only small variation (<10%) among the species studied. Ascorbic
acid was in a range of 14.0% to 60.0%. Ascorbic acid, known as vitamin C, is a water soluble
vitamin, not synthesized in the body, but must get through foods or supplements. It is an
important antioxidant and its deficiency causes delayed healing and scurvy. Ascorbic acid
works as a preservative to prevent rancidity, acts as a dough conditioner in baking and
prevents enzymatic browning. Riboflavin (vitamin B2) is another water soluble vitamin. As it
is also not synthesized in the body or being stored, it is essential to eat foods rich in riboflavin
every day. Riboflavin helps body cells use fat, protein and carbohydrates from foods to
produce energy.
Table 3. Vitamin composition of Garcinia fruits (Utpala and Nandakishore, 2014)

Garcinia species Thiamine Riboflavin Niacin (B3) Ascorbic Vitamin Total vitamin
(B1) (B2) (µg/100g) acid (C) B12 (mg/100g)
(µg/100g) (µg/100g) (mg/100g) (µg/100g)
G. gummi-gutta 48 275 45 14.35 8.75 14.75

G. indica 52 320 63 33.45 12.06 34.00
G. mangostana 50 300 60 60.43 9.52 61.05
G. xanthochymus 37 250 50 30.62 10.76 30.97
G. subelliptica 50 281 45 34.45 9.03 34.94
G. kydia 47 267 50 25.25 10.15 25.82
G. lanceaefolia 52 283 45 30.23 8.02 30.62
G. pedunculata 49 276 47 35.43 8.12 35.81
4. Organic acids composition of Garcinia fruits

Organic acids are of great significance in plants. As intermediates in the metabolic processes
of the fruit, acids are directly involved in growth and maturation. Fruit juices have a low pH,
because they contain high levels of organic acids (James, 1985, Jena et al., 2002). The
organic acids detected in the Garcinia fruits studied were (-) hydroxycitric acid (HCA), malic
acid, citric acid, tartaric acid and acetic acid. The retention factor (Rf) values of standard
acids were found to be oxalic acid (0.14), tartaric acid (0.21), malic acid (0.45), citric acid
(0.38), hydroxycitric acid (0.24) and acetic acid (0.60) (Utpala and Nandakishore, 2014). The
total acid content of Garcinia fruits and the percentage compositions of various organic acids
present in the Garcinia acid extracts are given in Table 4. The total acidity of the fruits
varied significantly from 4.39 % (G. mangostana) to 27.3 % (G. kydia). A very high
variability in concentration was observed for HCA and malic acid.
G. kydia was the most acidic (27.3 %) followed by G. gummi-gutta (23.81 %). The
anti-obesity compound HCA was highest in G. gummi-gutta (15.48 %), followed by G. kydia
(8.97 %). Garcinia species and Hibiscus sabdariffa are the only abundant natural sources of
HCA (Yamada et al., 2007). HCA was found to be the major organic acid in the Western
Ghats species namely G. gummi-gutta and G. indica whereas in other species, malic acid was
the predominant organic acid. During extensive animal studies, HCA has been proven to
effectively curb appetite, suppress food intake, increase the rates of hepatic glycogen
synthesis, reduce fatty acid synthesis and lipogenesis and decrease body-weight gain. Other
organic acids were detected as minor compounds. G. xanthochymus had a total acid content
173
of 10.95 % of which citric acid was the major acid component (8.0 %). HCA was absent in G.
xanthochymus. In case of G. mangostana, the percentages of organic acids were very low and
HCA could not be detected.
Table 4. Total acidity and major organic acids present in Garcinia fruits (Utpala and Nandakishore,
2014)
Garcinia species Total acidity HCA Malic Oxalic Citric Tartaric Acetic
(%) (%) acid (%) acid (%) acid (%) acid (%) acid (%)
G. gummi-gutta 23.81 15.48 4.62 0.18 0.62 0.11 0.07
G. indica 14.11 7.43 2.67 0.63 0.79 0.51 0.31
G. mangostana 4.39 0.26 0.54 0.73 1.42 1.66 0.26
G. xanthochymus 10.95 0.10 0.73 0.37 8.00 0.20 0.04
G. subelliptica 9.76 1.16 4.87 0.92 0.81 1.18 1.32
G. kydia 27.30 8.97 13.42 0.60 1.35 1.80 0.23
G. lanceaefolia 15.17 1.93 10.02 1.70 1.45 0.23 0.14
G. pedunculata 12.92 1.33 8.95 0.51 1.30 0.12 trace
The organic acids play a key role in food products because of their influence on
organoleptic properties. Besides, they also provide the sour flavour to the product and also act
as antimicrobial agent for enhancing shelf life (Lillian et al., 2013). The total content of
organic acids in a food affects the product’s acidity, whereas the levels of a specific organic
acid can directly influence the flavor and taste of the drink. Malic acid and citric acids are α-
hydroxy acids reported to have functions like enhancing salivation, gastric secretion and
exfoliation and are therefore important constituents of food and cosmetic formulations
(Fiume, 2001). Citric acid also acts as food preservative and acidifying agent. The higher
carbohydrate content and low acid content explains the sweeter taste of G. mangostana
compared to other Garcinia fruits.
5. Phenolic compounds and antioxidant activities of Garcinia fruits

Phenolic compounds are a class of secondary metabolites attributed with several bioactivities,
especially antioxidant properties. Antioxidant activity of a substance is the ability of a
molecule to eliminate or to neutralize a free radical. Several phytochemicals such as
curcumin, tocopherol, catechin, xanthones and anthocyanins were attributed with antioxidant
properties (Harborne, 2005). Phenolic compounds also facilitate pollination through colour
and fragrance, defense against pathogens and prevent fruits consumed by herbivores
(Harborne, 2005). In Garcinia, xanthones, biflavonoids and benzophenones were reported to
be the major phenolic compounds (Aisha et al., 2012).
The total phenolic contents (Table 5) were recorded to be highest in G. indica
(5.01%), followed by G. xanthochymus (4.43%) and G. kydia (4.32%). The xanthone content
was highest in G. xanthochymus (2.66 %) and was least in G. indica (0.9 %). The relative
percentage of xanthones to the total phenolics was highest in G. gummi-gutta, G.
xanthochymus and G. subelliptica (60.0%) and lowest in G. indica (20.0%).
174
Table 5. Total phenol, xanthone content and antioxidant activity of Garcinia fruits (Utpala and
Nandakishore, 2014)
Garcinia species Total phenolics Total xanthones DPPH activity IC50
(g/100g) (g/100g) (µg/ml)
G. gummi-gutta 3.26 1.96 38.39
G. indica 5.01 0.91 42.66
G. mangostana 2.33 1.30 39.42
G. xanthochymus 4.43 2.66 35.75
G. subelliptica 3.14 1.88 48.12
G. kydia 4.32 2.19 40.50
G. lanceaefolia 3.03 1.22 43.16
G. pedunculata 2.43 1.36 47.84
Ascorbic acid - - 10.25
As most of the Garcinia fruits are sour, they are consumed only as processed food or through
formulations. The most commonly used forms are syrups, juices and dried rinds boiled along
with other food ingredients. Hence the antioxidant activity of aqueous extract of fruits were
also determined (Table 5). Piyawan et al. (2005) reported that antioxidant activity of G.
mangostana is of moderate, close to that of orange, grapes, and papaya, while other tropical
fruits such as mango, litchi and guava have higher antioxidant activities (IC50 ranging from
1.10 to 9.60), compared to Garcinia fruits.
6. Biochemistry of Garcinia seed butter

Lipids or fats are hydrocarbon molecules, but are hydrophobic. In plants, fats are the storage
form of energy and found much abundant in seeds. Fats are the second largest energy source
for living cells (Jain et al., 2005). Garcinia seed kernel contains (30-40%) fixed oil, in
comparison to other vegetable seed fats like castor seed (50%), ground nut kernel (42%),
mustard (35%), palm kernel (36%), sunflower (32%), sesame (50%) and coconut (60%).
High yield of fixed oil indicates that Garcinia seeds can be utilized as a rich source of fatty
acids. The physical properties of the seed fats of four Garcinia species showed that the yield
of fatty oil is high in G. gummi-gutta (47%) while in G. indica and in G. xanthochymus it was
around 30% and in case of G. mangostana it was less, around 24% (Table 6).
Table 6. Physical properties of Garcinia seed butter (Utpala and Nandakishore, 2014)
Parameters G. gummi-gutta G. indica G. xanthochymus G. mangostana
Total fat content (%) 46.54 29.33 25.71 24.20
Colour of fat Light brown Pale white Creamy-yellow Creamy-yellow
State at room temperature Solid Solid Solid Solid

Melting point (ºC) 39.4 40.3 38.2 37.9
Garcinia butter is solid at room temperature and is quite hard, almost as hard as cocoa butter,
and is a good substitute in the recipes for cocoa butter. The melting point of Garcinia seed
butter is high (about 40°C), hence it can be used along with cocoa butter to increase the heat
resistance property and hardness of the chocolate. It is helpful in preventing heat induced
softening and loss of consistency of chocolates, mainly in hot climatic regions (Utpala et al.,
175
2012). Acid value and percentage free fatty acids represent the freshness and storage quality
of an oil or fat. It is the measure of susceptibility and the extent of decomposition. The acid
value of the four species of Garcinia varies from 3.7 to 4.5; which shows the butter is good
for the consumption. Free fatty acid content is commonly called the free acidity percent and
lesser the free fatty acid content, better is the fat. Other than G. indica oil, all are having very
low acid value (Table 7). Saponification number gives the information concerning the
character of the fatty acid present in the fat. Fats with the high saponification number yield
quite soluble soaps. The saponification value of olive oil is 187-196, for sunflower oil, it is
188-194, for ground nut it is 188-195, for mustard oil it is 169-176 and for sesame oil it is
188-195, while it is very high in coconut oil and ghee (251-263 and 220 respectively). For
Garcinia fats, the value ranged from 140 to 200. Iodine value is a measure of the unsaturated
nature of the fat. The iodine value preferably should be 25-50. In different Garcinia seed
butters, iodine value varies from 37-51(Table 7). Iodine value allows predicting the tendency
of fat to become rancid. In coconut oil, the iodine value is very low (7.5- 10.5) and hence
shows a high tendency to get rancid easily.
Table 7. Chemical properties of Garcinia seed butter (Utpala and Nandakishore, 2014)
Chemical properties G. gummi-gutta G. indica G. xanthochymus G. mangostana
Acid value 3.7 4.9 4.8 4.5

(mg NaOH/g of oil)
Saponification number 187.9 200.2 190.3 140.5
(mg KOH/g of oil)
Iodine value 50.2 39.4 37.4 51.8
Free acids (%) 1.42 5.64 2.82 2.21
The fatty acid profile presented in the Table 8 shows that Garcinia butter has 7 important
fatty acids with various percentages in different species. The major fatty acids present were
palmitic acid, stearic acid, elaidic acid, oleic acid, linoleic acid, arachidic acid and eicosenoic
acid. Palmitic acid is present in very high yield (47%) in G. mangostana, while it is moderate
in other species. Palmitic acid is an ionic surfactant, which has a pleasing sensation to the
body. It is thus mainly used to produce soaps, cosmetics and releasing agents. Palmitic acid is
the commonest saturated fatty acid in the plants and animal lipids. Kokum butter from G.
indica is popular in skin care products because of its ability to soften skin and heal
ulcerations and fissures of the lips, hands and soles of feet. Palmitic acid helps to control
obesity and also helps to recover some reproductive abnormalities (Scott et al., 1988). It is
reported that the diet enriched with palmitic acid is good for diabetes (Utpala et al., 2012).
Stearic acid is present in very high concentration (30-40%) in G. gummi-gutta, G. indica and
G. xanthochymus; while its percentage is less in G. mangostana (2.3%) Stearic acid is
commonly used in the manufacture of soaps, detergents, shampoo, shaving creams and other
cosmetic products. It is one of the most common saturated fatty acids found in the nature
following palmitic acid (Utpala and Nandakishore, 2014). Butter rich in stearic acid is solid at
room temperature. It is also used in many food products because it remains stable at high
temperatures. It is commonly used in margarine and other spreads. Garcinia fats could be
taken as good source of stearic acid as well. A few plants which have stearic acid more than
30% in its seed oil are Butyrospermum paradoxum (shea), Shorea robusta (sal) and Vateria
176
indica (dhupa). It is reported that the total plasma cholesterol is decreased by an average of
14% during the consumption of high stearic acid diet (Andrea and Scott, 1988). Oleic acid
also present in a good percentage in all the four species of Garcinia (26-35%). High oleic
acid makes the butter less susceptible to spoilage, so could be useful in food preservation.
Oleic acid may hinder the progression of adrenoleuko dystrophy, a fatal disease that affects
the brain and adrenal glands and also may be responsible for the hypotensive effects of olive
oil (Teres et al., 2008). Linoleic acid is another important acid which is present in a moderate
percentage (5-11%) in different Garcinia species. The use may include, helping to lose body
fat and possibly preventing colon or breast cancer (Nirvair et al., 2007). It is a strong
antioxidant with benefits such as lowering high cholesterol and controlling weight. Arachidic
acid (1-8%) is a saturated fatty acid and a minor constituent of peanut oil (1.1-1.7%) and corn
oil (3%). Arachidic acid is used for the production of detergents, photographic materials and
lubricants. The food rich with arachidonic acid is attributed with anti-inflammatory properties
(Adama et al., 2003).
Table 8. Fatty acid profile of Garcinia species (Utpala and Nandakishore, 2014)
Fatty acid Saturated/ G. gummi-gutta G. indica G. xanthochymus G. mangostana
unsaturated (%) (%) (%) (%)
Palmitic acid saturated 6.31 3.25 3.05 47.20
Stearic acid saturated 30.61 45.33 44.53 2.31
Elaidic acid unsaturated 9.54 3.00 1.51 --
Oleic acid unsaturated 26.23 34.42 35.33 34.02
Linoleic acid unsaturated 11.38 5.25 4.82 1.32
Arachidic acid saturated 5.41 1.20 1.00 8.04
Eicosenoic acid unsaturated -- 2.25 1.01 0.51
Other fatty acids 10.52 5.30 8.75 6.61
Conclusions
The awareness towards natural options in every walk of life created a new thrust for the plant
based products that involve food additives, nutracueticals, cosmetic ingredients and herbal
medicines. Herbal Technology (HT) is emerging as a promising field of modern science for
India. The rich floristic wealth of our region offers several underutilized plants that can be
used as source of gum, resins, fats, oils, condiments and nutraceutics. Garcinia is one among
such underutilized tropical forest tree that accounts to the economy of the ethnic community
associated. Pharmacological works are in progress in different parts of the world to use the
products from Garcinia fruits as anti obesity, anti cancer and to solve other digestive
problems The vitamins, minerals, micro-nutrients, pigments and phenolic compounds of
major Garcinia fruits in India were reviewed in the chapter and the fruits are having very
high nutraceutical values.
References
1. Adama O, Wolframb G and Zöllnerb N. 2003. Influence of dietary linoleic acid intake
with different fat intakes on arachidonic acid concentrations in plasma and platelet lipids
and eicosanoid biosynthesis in female volunteers. Ann. Nutr. Metab. 47, 31-36.
2. Aisha AFA, Abu-Salah MK, Ismail Z and Amin MSAM. 2012. Determination of total
xanthones in Garcinia mangostana fruit rind extracts by ultraviolet (UV)
spectrophotometry. J. Med. Plants Res., 7(1), 29-35.
177
3. Andrea B and Scott M. 1988. Effect of dietary stearic acid on plasma cholesterol and
lipoprotein levels. New England J. Med., 318(19), 1244-1248.
4. Decupyre JD. Nutrient Charts- Fruit Chart, http://www.healthalternatives.com/fruit-
nutrition-chart.html (accessed on 11-4-2014).
5. Fiume Z. 2001. Final report on the safety assessment of malic acid and sodium malate.
Int. J. Toxicol., 20 (1), 47-55.
6. Gruere GP, Giuliani A and Smale M. 2006. In: Marketing Underutilized Plant Species for
the Benefit of the Poor: A Conceptual Framework; EPT Discussion Paper 154.
International Food Policy Research Institute, Washington DC, pp.2-6.
7. Harborne JB. 2005. Phenolic Compounds. In: Phytochemical Methods: A Guide to
Modern Techniques of Plant Analysis, Springer, Edn.3, pp.40-43.
8. Jain JL, Sunjay J and Nitin J. 2005. In: Fundamentals of Biochemistry. S Chand and Co.
Ltd, New Delhi, Edn.1, pp.11-13.
9. James G. 1985. The Science Workbook: Student Research Projects in Food-Agriculture-
Natural Resources. College of Agriculture, Ohio State University.
Biochemistry of (-)-Hydroxycitric Acid from Garcinia. J. Agri.Food Chem. 50, 10-22.
11. Krishnamurthy SR and Sarala P. 2011. Determination of nutritive value of Ziziphus
rugosa Lamk.: A famine edible fruit and medicinal plant of Western Ghats. Ind. J. Nat.
Prod. Resour., 3(1), 20-27.
12. Korikanthimath VS and Desai AR. 2005. Status of Kokum (Garcinia indica Choisy) in
Goa. In: Proc. 2nd National Seminar on Kokum (Garcinia indica Choisy). University of
Goa, India, pp.75-78.
13. Lillian C, Brian De B and Jeffrey R. 2013. Determination of Organic Acids in Fruit Juices
and Wines by High-Pressure IC. Application Note 1068, Thermo Fisher Scientific Inc.
14. Nirvair SK, Neil EH and Kent LE. 2007. Conjugated linoleic acid isomers and cancer. J.
Nutri., 137(12), 2599-2607.
15. Piyawan S, Supannee K and Ranee S. 2005. Radical scavenging activity in fruit extracts.
Acta Hort., 679, 201-203.
16. Scott G, Florentin L, Nix D and Whelan MF. 1988. Comparison of monounsaturated fatty
acids and carbohydrates for reducing the raised levels of plasma cholesterol in man. Am.
J. Clin. Nutr., 47, 965-969.
17. Teres S, Barcelo-Coblijn G, Benet M, Alvarez R, Bressani R, Halver JE and Escriba PV.
2008. Oleic acid content is responsible for the reduction in blood pressure induced by
olive oil. Proc. National Acad. Sci., 105(37), 13811-13816.
18. Utpala P, Asish GR, Jayarajan K, Aravind R, Krishnamoorthy B and Mathew PA. 2010.
Isozyme diversity of Garcinia gummigutta (L.) N. Robson in Western Ghats region,
South India. J. Spices and Aromatic Crops, 19(1), 29-33.
19. Utpala P, Nandakishore OP, Senthil KR, Nirmal BK, Zachariah TJ and Parthasarathy VA.
2012. Chromatographic fingerprinting and estimation of organic acids in selected
Garcinia species. Int. J. Innovative Hort., 1(1), 68-73.
20. Utpala P and Nandakishore OP. 2014. A study on nutrient and medicinal compositions of
selected Indian Garcinia species. Curr. Bioact. Compd., 10(1), 55-61.
21. Yamada T, Hida H and Yamada Y. 2007. Chemistry, physiological properties and
microbial production of hydroxycitric acid. Appl. Microbiol. Biotechnol., 75(5), 977-982.
178
Chapter 13
Antioxidant and antibacterial activities of Garcinia species in the Western

Ghats
A. P. Anu Aravind1, T. G. Nandu2, S. Shiburaj2 and K. B. Rameshkumar1,*
1
2
*
Abstract
Garcinia species are reputed for the diversity of phenolic compounds such as biflavonoids,
xanthones and benzophenones that can act as antioxidants. In the present study, various in
vitro methods were used to investigate the antioxidant properties of nine Garcinia species in
the Western Ghats. DPPH radical scavenging activity of G. talbotii was higher (IC50: 2.8±0.6
µg/mL) compared to standard compound ascorbic acid (IC50: 3.2±0.5 µg/mL), while G.
pushpangadaniana showed the highest superoxide radical scavenging activity
(IC50:16.75±0.99µg/mL) and reducing activity. The potential antioxidant activities of the
Garcinia species were in corroboration with the high phenolic and flavonoid contents present
in these species. The antibacterial activities of the leaf methanol extracts were however
negligible or nil, except against the Gram positive strain, Bacillus subtilis.
Keywords: Antioxidant, Antibacterial, Garcinia species, DPPH, Superoxide radical,

Reducing power, Bacillus subtilis
Introduction
Oxygen is an indispensable element for life and is necessary for aerobic respiration in
animals. However, reactive oxygen species (ROS) such as superoxide anion radicals (O2-),
hydroxyl radicals (OH.) and non-free radical species such as hydrogen peroxide (H2O2) and
singlet oxygen, that are continuously produced during the normal metabolism of oxygen, are
harmful to biological systems. Healthy humans can detoxify or eliminate these free radicals
by enzymes such as superoxide dismutase, catalase, and peroxidase (Gulcin, 2006; Terashima
et al., 2010). If the oxidative damage is beyond the capacity of the natural repair mechanisms
of the cells, it may trigger several chronic diseases (Franco, 2008).
The consumption of diets which are rich in antioxidants can protect the human body
from oxidative stress and associated diseases induced by endogenous and exogenous factors
(Morganti, 2009). These health effects have been partially attributed to the presence of
phenolic compounds in plants (Guo et al., 2011). Garcinia species are known to be rich in
phenolic compounds such as flavonoids, phenolic acids, xanthones, biflavonoids and
benzophenones. There are many compounds reported from the genus Garcinia with higher
free radical scavenging activities compared to known standards. Griffipavixanthone, a
prenylated xanthone isolated from Garcinia virgata was reported to possess promising
antioxidant activity with lower EC50 value compared to the references BHA and α-tocopherol
179
(Merza et al., 2004). The phloroglucinol parvifoliol E from Garcinia parvifolia showed
remarkable antioxidant acivity compared to standard BHT (Rukachaisirikul et al., 2006).
1,3,5,7-Tetrahydroxyxanthone exhibited strong antioxidant activity comparable to the
reference molecule probucol (Jantan et al., 2012). α-Mangostin is a common xanthone
reported from different Garcinia species, that exhibited stronger antioxidant activity than α-
tocopherol in ferric thiocyanate (FTC) assay (Taher et al., 2012). Biflavonoids are dimers of
two flavonoids, limited in distribution to some genus. This interesting group of compounds
was reported from different Garcinia species and many of them exhibited remarkable
antioxidant activities. The flavanone-(3-8'')-flavone biflavonoid morelloflavone displayed
considerable antioxidant activity and was more potent than quercetin (Osorio et al., 2013).
1,3,6-trihydroxy-7-methoxy-2,8-(3-methyl-2-butenyl) xanthone isolated from Garcinia
hombroniana exhibited stronger antioxidant activity than the standard compounds trolox,
gallic acid and ascorbic acid (Jamila et al, 2014). Garcina species were reported to possess
remarkable level of activities against different diseases and the antioxidant activities of
phenolic compounds from the genus have a major role in the mechanism of bioactivities.
Recently, a wide range of plants have been screened for antimicrobial property,
because of the increased microbial resistance and harmful side effects of existing
antimicrobial agents (Djeussi et al., 2013). Garcinia species have also been a subject of
antimicrobial screening and potential activities have been reported for extracts and isolated
compounds from several Garcinia species (Negi et al., 2008; Policegoudra, 2012; Fouotsa et
al., 2013; Semwal et al., 2015).
Although the Garcinia species are gaining much attention worldwide due to their
potential bioactivities, the Garcinia species in the Western Ghats are least investigated for
their bioactivities. The present chapter elaborates the antioxidant and antibacterial activities
of the leaf methanol extracts of nine Garcinia species (G. gummi-gutta, G. imberti, G. indica,
G. Morella, G. pushpangadaniana, G. rubro-echinata, G. talbotii, G. travancorica and G.
wightii) from the Western Ghats.
1. In vitro antioxidant activity of Garcinia species in the Western Ghats

Antioxidants act by several mechanisms and it is difficult to predict the full spectrum of
activity in a single assay. In the present study, in vitro methods such as DPPH scavenging
assay, superoxide radical scavenging assay and reducing power assay were used to evaluate
the antioxidant property of Garcinia leaf methanol extracts.
DPPH scavenging activity: Among free radical scavenging methods, DPPH method is more
rapid, simple and inexpensive in comparison to other test models. DPPH (2, 2-diphenyl-1-
picrylhydrazyl (α,α-diphenyl-β-picrylhydrazyl) is a stable free radical that has an absorbance
maximum in the visible region (517 nm). On accepting hydrogen from a donor, DPPH
solutions lose the characteristic deep purple colour (Villano et al., 2007). The free radical
scavenging activities of tested compounds are expressed as IC50 value, the concentration of
the compound required to decrease the absorbance of DPPH solution by 50%.
Reducing power assay: In this method, antioxidant compound forms a coloured complex
withpotassium ferricyanide, trichloro acetic acid and ferric chloride, which is measured at
700 nm. Increase in absorbance ofthe reaction mixture indicates the reducing power of the
samples (Jayaprakash et al., 2008).
180
Superoxide radical scavenging assay: Superoxide anion radical is a weak oxidant that
generates powerful and dangerous hydroxyl radicals as well as singlet oxygen, both of which
contribute significantly to oxidative stress. In the PMS/NADH-NBT system, the superoxide
anion derived from dissolved oxygen and PMS/NADH coupling reaction reduces NBT. The
decrease of absorbance at 560 nm thus indicates the consumption of superoxide anion in the
reaction mixture. The superoxide anion scavenging activity was measured as described by
Robak and Gryglewski (1988).
Total phenolic and flavonoid contents: Phenolic compounds consist of diverse group of
secondary metabolites such as flavonoids, anthocyanins, coumarins, xanthones,
benzophenones and phenolic acids, and possess ideal structural features for free radical
scavenging activity. Antioxidative properties of phenolic compounds are due to different
mechanisms such as scavenging of free radicals, chelation of metal ions like iron and copper,
and inhibition of enzymes responsible for free radical generation (Benavente-Garcia, 1997;
Rice-Evans et al., 1997). The phenol content was determined by Folin-Ciocateu reagent
method (McDonald et al., 2001). The content of flavonoids was determined by aluminum
chloride colourimetric method (Chang et al., 2002).
Leaf methanolic extrcacts of9 Garcinia species from the Western Ghats (G. gummi-
gutta, G. imberti, G. indica, G. morella, G. pushpangadaniana, G. rubro-echinata, G.
talbotii, G. travancorica and G. wightii) were subjected to antioxidant evaluation using
different in vitro methods. Most of the species showed remarkable levels of antioxidant
activities using in vitro models like DPPH radical scavenging assay, reducing power assay
and super oxide radical scavenging assay (Table 1). Among the species studied G. talbotii
(IC502.8±0.6 µg/mL), G. rubro-echinata (IC506.5±0.8 µg/mL), G. imberti (IC509.0±1.2
µg/mL), and G. wighti (IC5016.0±2.0 µg/mL) showed a promising level of DPPH radical
scavenging activity compared to standard ascorbic acid with IC50 value of 3.2±0.5 µg/mL.
IC50 of G. talbotii leaf methanol extract against DPPH radical was higher than that of
standard ascorbic acid.
Superoxide radical scavenging activity revealed a moderate level of activity compared
to the standard ascorbic acid (IC50 value of 5.8±0.25 µg/mL). Among the species studied, G.
pushpangadaniana showed highest activity with IC50 value of 16.75±0.99 µg/mL and G.
indica showed the minimal level of activity with IC50 value of 196.96±14.16 µg/mL.
Superoxide radical scavenging activity of the extracts were not correlated to the phenolic or
flavonoid contents.
Table 1. Phenolic and flavonoid contents and antioxidant activities of Garcinia leaf extracts
Sl. Garcinia species Total phenolics Total flavonoids DPPH IC50 Superoxide IC50
No. (mg/g) (mg/g) (µg/mL) (µg/mL)
1 G. gummi-gutta 97.45±7.28 17.2±2.83 128±2 86.2±2.62
2 G. imberti 273.6±9.6 108±7.82 9±1.2 40.3±1.12
3 G. indica 46.67±15.08 11.1±1.84 558.3±18.65 196.96±14.16
4 G. morella 177.57±18.86 53.8±5.37 104±3.35 86.5±7.92
5 G. pushpangadaniana 884.6±83.51 197.3±9.47 9.04±0.83 16.75±0.99
6 G. rubro-echinata 392.85±7.28 48.05±2.19 6.5±0.8 27.2±0.42
7 G. talbotii 342.9±5.80 55.56±2.31 2.8±0.6 30.4±1.13
8 G. travancorica 435.53±23.85 143.4±11.60 18.9±1.8 53.2±3.09
9 G. wightii 239.3±24.18 239.0±26.87 16±2 27.6±0.7
10 Ascorbic acid - - 3.2±0.5 5.8±0.25
181
Leaf methanolic extracts of the Garcinia species studied showed varying levels of activity in
reducing power assays (Table 2, Figure 1). The Garcinia species that contain higher amount
of phenolics, especially G. pushpangadaniana, G. rubro-echinata and G. talbotii showed
remarkable activity in reducing power assay, whereas G. gummi-gutta, G. indica and G.
wightii showed only moderate levels of activities.
Table 2. Reducing power assayof Garcinia species leaf extracts at different concentrations-
Absorbance at 700 nm
Garcinia species 20 (g/mL) 40 60 80 100
(g/mL) (g/mL) (g/mL) (g/mL)
G. gummi-gutta 0.026 0.045 0.082 0.103 0.122
G. rubro-echinata 0.026 0.308 0.503 0.669 0.858
G. imberti 0.011 0.172 0.39 0.55 0.678
G. indica 0.034 0.054 0.068 0.08 0.09
G. morella 0.051 0.133 0.196 0.255 0.295
G. pushpangadani 0.231 0.45 0.623 0.833 1.083
G. talbotii 0.185 0.347 0.5 0.681 0.721
G. travancorica 0.094 0.209 0.301 0.408 0.526
G. wightii 0.018 0.034 0.117 0.239 0.303
1.2 1
1
2
OD at 700 nm
0.8
3
0.6
4
0.4
5
0.2
6
0
20 40 60 80 100 7
Concentration (µg/mL) 8
Figure 1. Reducing power assay of Garcinia leaf extracts (1- G. gummi-gutta, 2- G. rubro-echinata,
3- G. imberti, 4- G. indica, 5- G. morella, 6- G. pushpangadaniana, 7- G. talbotii, 8- G. travancorica,
9- G. wightii)
2. Antibacterial activity of Garcinia leaf methanol extracts

The plant extracts were dissolved in DMSO was used for the assay. The Kirby-Bauer method
was used for antimicrobial susceptibility testing (Cappucino and Sherman1999). Briefly, the
Mueller Hinton Broth (MHB) containing specific organisms were incubated at 37C until it
achieved the 0.5 McFarland standards (~1.5 x 108 CFU/ml). The dried surface of the Mueller-
Hinton agar plate is inoculated by streaking the swab over the entire sterile agar surface. The
discs impregnated with the extracts were placed on Mueller Hinton agar and incubated at 370
for 16-18 hours. After incubation, the diameters of the zones of complete inhibition were
measured, including the diameter of the disc.
182
Table 3. Antibacterial activity (zone of inhibition in mm) of Garcinia leaf methanol extracts and
standard kanamycin sulphate
Garcinia Conc. P. E. S. P. S. B. S.
species (µg/disc) vulgaris faecalis marscenes aeruginosa typhi subtilis mutants
G. cowa 100 Nil Nil Nil Nil Nil 9.0 Nil

500 Nil Nil Nil Nil Nil 9.5 Nil
1000 Nil Nil Nil Nil Nil 10 Nil
G. rubro-echinata 100 Nil Nil Nil Nil Nil 6.5 Nil
1000 Nil Nil 7.5 Nil Nil 9.0 7.5
G. gummi-gutta 100 Nil Nil Nil Nil Nil 7.5 Nil
500 Nil Nil Nil Nil Nil 9.5 7.0
G. imberti 100 Nil Nil Nil Nil Nil 7.0 Nil
G. indica 100 Nil Nil Nil Nil Nil Nil Nil
500 Nil Nil Nil Nil Nil Nil Nil
G. morella 100 Nil Nil Nil Nil Nil 6.5 Nil
G. 100 Nil Nil Nil Nil Nil 7.0 6.5
pushpangadaniana 500 Nil Nil Nil Nil Nil 9.5 7.5
G. talbotii 100 Nil Nil Nil Nil Nil 10 9.0
500 Nil Nil Nil Nil Nil 12 10.0
G. travancorica 100 Nil Nil Nil Nil Nil 8.0 Nil
G. wightii 100 Nil Nil Nil Nil Nil 9.0 Nil
Kanamycin 30 20.0 22.0 25.0 20.0 27.0 28.0 25.0
sulphate
183
In most of the cases, the extracts were inactive against the tested strains of bacteria
(Table 3). Remarkable observation was the moderate activity against the gram positive
Bacillus subtilis for all the extracts except G. indica. It is interesting to note that previous
reports also reveal the activity of Garcinia extracts and compounds against Gram positive
strains, especially Bacillus subtilis (Rao and Natarajan, 1950, Negi et al., 2008; Semwal et
al., 2015).
The antimicrobial activities of Garcinia leaf methanol extracts against food pathogens such
as Escherichia coli, Bacillus cereus, Staphylococcus aureus, Salmonella enteric ser.typhi, and
Vibrio cholera were also screened (Table 4). The MIC values were determined by modified
broth microdilution method according to Clinical and Laboratory Standards Institute (CLSI)
(2009). Briefly, 200µl of Mueller Hinton Broth (MHB) was placed into each to wells of 96
well microplate. The plant extracts were dissolved in DMSO, and diluted to the required
concentration. 1% of bacterial cell suspension was inoculated in MHB containing plant
extracts and incubated at 370 C for 16 hours. Garcinia leaf methanol extracts were active
against the Gram positive strains screened; Bacillus cereus and Staphylococcus aureus.
Table 4. Antibacterial activity (MIC in µg/ml) of Garcinia leaf methanol extracts against food
pathogens
Garcinia species Escherichia coli Bacillus Staphylococcus Salmonella Vibrio cholera
MTCC 441 cereus aureus enterica ser. MTCC 3906
MTCC430 MTCC7443 typhi
MTCC733
G. pushpangadhania Nil 100µg/ml Nil Nil Nil
G. rubro-echinata Nil 100µg/ml 100µg/ml Nil Nil
G. imberti Nil Nil Nil Nil Nil
G. travancorica Nil Nil Nil Nil Nil
G. talboti Nil Nil Nil Nil Nil
G. morella Nil 200µg/ml 500µg/ml Nil Nil
G.wightii Nil 100µg/ml 200µg/ml Nil Nil
G. gummi-gutta Nil Nil Nil Nil Nil
Conclusions
Leaf methanol extracts of nine Garcinia species from the Western Ghats exhibited
remarkable in vitro antioxidant activity against various free radicals. The potential
antioxidant activities were in corroboration with the high phenolic and flavonoid contents.
Antioxidant activity is directly correlated to several curing mechanisms and the present study
highlights the potential of Garcinia species as targets for future drug development. However,
the antibacterial activities of the leaf methanol extracts were nil or negligible against the
tested strains, except for Bacillus subtilis.
References
1. Benavente-Garcia O, Castillo J, Marin FR, Ortuño A and Del Río JA. 1997. Uses and
properties of citrus flavonoids. J. Agric. Food Chem., 45(12), 4505-4515.
2. Cappucino JG and Sherman N. 1999. Microbiology: A Laboratory Manual, 5th edition.
p.254, Benjamin Cumming Science Publishing, California.
184
3. Chang CC, Yang MH, Wen HM and Chern JC. 2002. Estimation of total flavonoid
content in propolis by two complementary colorimetric methods. J. Food Drug
Anal., 10(3). 178-182.
4. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial
Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Ninth
Edition. CLSI document M07-A9. 2009. Clinical and Laboratory Standards Institute,
Pennsylvania USA.
5. Djeussi DE, Noumedem JAK, Seukep JA, Fankam AG, Voukeng IK, Tankeo SB, Nkuete
AHL and Kuete V. 2013. Antibacterial activities of selected edible plants extracts against
multidrugresistant gram-negative bacteria. BMC Compl. Alt. Med., 13, 164.
6. Fouotsa H, Mbaveng A T , Mbazoa C D , Nkengfack A E , Farzana S , Iqbal C M , Meyer
JJM, Lall N and Kuete V. 2013. Antibacterial constituents of three Cameroonian
medicinal plants: Garcinia nobilis, Oricia suaveolens and Balsamocitrus camerunensis.
BMC Compl. Alt. Med.,13, 81.
7. Franco R, Schoneveld O, Georgakilas AG and Panayiotidis MI. 2008. Oxidative stress,
DNA methylation and carcinogenesis. Cancer Lett., 266(1), 6-11.
8. Gulcin I. 2006. Antioxidant and antiradical activities of L-carnitine. Life Sci., 78(8), 803-
811.
9. Guo T, Wei L, Sun J, Hou CL and Fan L. 2011. Antioxidant activities of extract and
fractions from Tuber indicum Cooke & Massee. Food Chem., 127(4), 1634-1640.
10. Jamila N, Khairuddean M, Khan SN and Khan N. 2014. Complete NMR assignments of
bioactive rotameric (3→8) biflavonoids from the bark of Garcinia
hombroniana. Magnetic Res. Chem., 52(7), 345-352.
11. Jantan I and Saputri FC. 2012. Benzophenones and xanthones from Garcinia cantleyana
var. cantleyana and their inhibitory activities on human low-density lipoprotein oxidation
and platelet aggregation. Phytochemistry, 80, 58-63.
12. Jayaprakasha GK, Girennavar B and Patil BS. 2008. Radical scavenging activities of Rio
Red grapefruits and Sour orange fruit extracts in different in vitro model
systems. Bioresource Tech., 99(10), 4484-4494.
13. McDonald S, Prenzler PD, Antolovich M and Robards K. 2001. Phenolic content and
antioxidant activity of olive extracts. Food Chem., 73(1), 73-84.
14. Merza J, Aumond MC, Rondeau D, Dumontet V, Le Ray AM, Séraphin D and
Richomme P. 2004. Prenylated xanthones and tocotrienols from Garcinia
virgata. Phytochemistry, 65(21), 2915-2920.
15. Morganti P. 2009. The photoprotective activity of nutraceuticals. Clin. Dermatol., 27(2),
166-174.
16. Negi PS, Jayaprakasha GK and Jena BS. 2008. Antibacterial activity of the extracts from
the fruit rinds ofGarcinia cowa and Garcinia pedunculata against food borne pathogens
and spoilage bacteria. Food Sc. Tech., 41, (10), 1857-1861.
17. Osorio E, Londono J and Bastida, J. 2013. Low-density lipoprotein (LDL)-antioxidant
biflavonoids from Garcinia madruno. Molecules, 18(5), 6092-6100.
18. Policegoudra RS, Saikia S, Das J, Chattopadhyay P, Singh L and Veer V. 2012. Phenolic
content, antioxidant activity, antibacterial activity and phytochemical composition
of Garcinia lancifolia. Indian J. Pharm. Sci., 74(3), 268-271.
185
19. Rao RR and Natarajan S. 1950. On morellin, the antibacterial principle of the seeds
of Garcinia morella Desrous. Curr. Sci.,19 (02) 59-60.
20. Rice-Evans C, Miller N and Paganga G. 1997. Antioxidant properties of phenolic
compounds. Trends Plant Sci., 2(4), 152-159.
21. Robak J and Gryglewski RJ. 1988. Flavonoids are scavengers of superoxide anions.
Biochem. Pharmacol., 37, 837-841.
22. Rukachaisirikul V, Naklue W, Phongpaichit S, Towatana NH and Maneenoon K. 2006.
Phloroglucinols, depsidones and xanthones from the twigs of Garcinia
parvifolia. Tetrahedron, 62(36), 8578-8585.
23. Semwal RB, Semwal DK, Vermaak I and Viljoen A. 2015. A comprehensive scientific
24. Taher M, Susanti D, Rezali MF, Zohri FSA, Ichwan SJA, Alkhamaiseh SI and Ahmad F.
2012. Apoptosis, antimicrobial and antioxidant activities of phytochemicals from
Garcinia malaccensis Hk. f. Asian Pacific J. Trop. Med., 5(2), 136-141.
25. Terashima M, Watanabe R, Ueki M and Matsumura S. 2010. Comprehensive evaluation
of antioxidant activity for various substances with 5-axe cobweb chart. Food
Chem., 120(1), 150-155.
26. Villano D, Fernandez-Pachon MS, Moya ML, Troncoso AM and Garcia-Parrilla MC.
2007. Radical scavenging ability of polyphenolic compounds towards DPPH free
radical. Talanta, 71(1), 230-235.
186
Chapter 14
Antioxidant and cytotoxic activities of Fukugiside- The major biflavonoid

from Garcinia travancorica Bedd.
A. P. Anu Aravind and K. B. Rameshkumar*

*
Abstract
Garcinia species are well known as source of complex molecules with diverse biological
activities, especially antioxidant and anticancer activities. The present chapter elaborates the
in vitro antioxidant activity of Garcinia travancoria extract and isolated compounds. The
biflavonoid fukugiside has been identified as the active compound with significant free
radical scavenging activities in DPPH (IC50: 8.34 µg/mL), superoxide(IC50: 6.95 µg/mL), and
reducing power assays. Cytotoxicity studies of the biflavonoid fukugiside revealed a dose
dependent cancer cell growth inhibition in A431 and HeLa cells. The antiproliferative effect
appears to be due to the ability of fukugiside to induce S-phase arrest and apoptotic cell
death. In HeLa cells, fukugiside reduced the expression of MAPKp38 by 26.1% compared to
untreated control.
Keywords: Garcinia travancoria, Biflavonoid, Fukugiside, Antioxidant, Cytotoxicity
Introduction
Cancer, the uncontrolled division of abnormal cells in the body, still remains a threat to
humankind. Surgery, chemotherapy, and radiation are the widely practised treatment
methods to combat cancer (Tannock, 1998). Besides being expensive, most
chemotherapeutic and radiation treatments suffer from adverse side effects. The situation
warrants effective therapeutic approaches, and encourages researchers to depend more on
medicinal plants that produce new and novel chemotherapeutics (Sheldon et al., 1997;
Reed and Pellecchia, 2005). Over 60% of the clinically used anticancer drugs are of
natural origin and most of them are derived from higher plants. Vinblastine, vincristine,
etoposide, teniposide, taxol, taxotere, topotecan, and irinotecan are examples for plant
derived chemotherapeutics approved for use in cancer therapy (Lee, 1999).
Oxidative stress is perhaps a major cause for several diseases including cancer, and
the chemical components of medicinal plants possessing antioxidant properties can protect
the human body from oxidative stress and associated diseases (Guo et al., 2011, Nema et
al., 2013). Phenolic compounds belonging to xanthones, biflavonoids and phloroglucnols
present in Garcinia species were reported as potential antioxidant compounds (Merza et
al., 2004; Rukachaisirikul et al., 2006; Jantan et al., 2012; Taher et al., 2012; Osorio et al.,
2013; Jamila et al, 2014).
A number of extracts and isolated compounds from Garcinia species were reported
to exhibit remarkable cytotoxic activity against different cancer cell lines.
Polyisoprenylated benzophenones are perhaps the most promising group of secondary
187
metabolites in Garcinia species attributed with anticancer properties. The anticancer

benzophenone garcinol induces apoptosis through the activation of caspases (Pan et al.,
2001). Gambogic acid, the active component in gamboge, has potent cytotoxic activities
against human hepatoma, gastric carcinoma, and lung cancer (Guo et al., 2004; Wang et
al., 2008; Wu et al., 2004). Guttiferones, another group of polyisoprenylated
benzophenones isolated from Garcinia species exhibited strong cytotoxic activity against
different human cancer cell lines (Nguyen et al., 2011). Xanthones are another group of
secondary metabolites from Garcinia species attributed with anticancer properties.
Penangianaxanthone, cudratricusxanthone H, macluraxanthone C, and gerontoxanthone C
from G. penangiana exhibited strong cytotoxic activity against three cell lines, MCF-7,
NCI-H460) and DU-145 (Jabit et al., 2007). The xanthones bannaxanthone D, garcinone E
and γ-mangostin inhibit cancer cell growth and promote cancer cell death in HeLa cells
and the activity was more potent than clinically used anticancer drugs, camptothecin and
etoposide (Han et al., 2008). Yahyaxanthone form G. rigida showed in vitro cytotoxic
activity to L1210 murine leukemia cell lines (Elya et al., 2008). α-Mangostin, γ-
mangostin, and 8-deoxy gartanin exerted strong growth inhibition in human melanoma
SK-MEL-28 cell line (Wang et al., 2011). Gaudichaudione H, a xanthone from G.
oligantha has potent apoptosis-inducing effect and cell growth inhibition effect on HeLa-
C3 cells (Gao et al., 2012). 1,4,5,6-Tetrahydroxy-7,8-di(3-methylbut-2-enyl)xanthone,
globuxanthone and garciniaxanthone E exhibited moderate activities against human
leukaemic HL-60 cell line in vitro (Niu et al., 2012). Cowanin and fuscaxanthone B from
G. schomburgkiana exhibited remarkable cytotoxicity towards HeLa cells (Vo et al.,
2012). Xanthones from G. cantleyana such as 7-hydroxyforbesione, cantleyanone B,
cantleyanone C, and deoxygaudichaudione A exhibited strong activity against the cell-
lines, MDA-MB-231, MCF-7, CaOV-3, and HeLa cells (Shadid et al., 2007).
G. travancorica is a Western Ghats endemic tree species and the phytochemical
studies of the plant showed the biflavonoid glycoside fukugiside as the major constituent
(AnuAravind et al., 2016). The present chapter evaluates the antioxidant and cytotoxic
activity of fukugiside isolated from G. travancorica.
1. Antioxidant activities of G. travancorica leaf methanol extract and isolated compounds

The isolated biflavonoids GB-1a, GB-1, GB-2 and morelloflavone-7’’-O-β-D-glycoside
(Figure 1), and leaf methanol extract (GTL) were studied for their antioxidant activities by
various in vitro free radical scavenging assays. The activities were measured as percentage,
calculated using the formula % scavenging = [(Acontrol-Asample)/Acontrol] x 100 and reported as
IC50 value; the concentration of sample required to scavenge 50% of radicals. Experiments
were done in triplicate and the results were expressed as mean value with standard deviation.
The in vitro antioxidant activities of the extract and isolated biflavonoids against
DPPH and superoxide radicals are shown in Table 1. High quantity of phenolics
(435.53±23.85 mg/g extract) and flavonoids (143.4±11.60 mg/g of extract) present in the
leaves showed a direct correlation with its antioxidant potential. The IC50 value of DPPH
radical scavenging activity of morelloflavone-7’’-O-β-D-glycoside was 8.34±2.12 µg/ml,
comparable to that of standard ascorbic acid (3.2±0.50 µg/ml). In superoxide radical
scavenging assay also, the compound showed comparable activity (IC50 6.95±1.33 µg/ml),
close to standard ascorbic acid (IC50 value of 5.8±0.25 µg/ml). In reducing power assay, the
188
activity of the compound was very close to that of standard ascorbic acid (Figure 3). Though
the antioxidant activity of glycosylated flavonoids is usually weaker than the corresponding
aglycones, bioavailability is generally enhanced by the presence of glucose moiety (Ratty and
Das 1988). The potential antioxidant activity of morelloflavone-7’’-O-β-D-glycoside can be
attributed to 3'', 4''- dihydroxy unit present in the B ring. The B ring hydroxyl configuration is
the most significant determinant of scavenging activity of flavonoids (Bors et al, 1990).
Figure 1. Structures of the biflavonoids GB-1a, GB-1, GB-2, and morelloflavone-7’’-O-β-D-

glycoside
Table 1. In vitro radical scavenging asays (DPPH and superoxide radical) of G. travancorica leaf
methanol extract and isolated compounds
Extract/ compound DPPH IC50 value Superoxide IC50 value

(µg/mL) (µg/mL)
G. trav. Lf MeOH extract 18.9±1.80 53.2±3.09
GB-1a 31.98±1.14 42.13±0.51
GB-1 22.31±2.33 37.52±2.10
GB-2 11.93±0.58 23.31±1.60
Morelloflavone-7’’-O-β-D-glycoside 8.34±2.12 6.95±1.33
Ascorbic acid 3.2±0.50 5.8±0.25
60
50
IC50 (µg/ml)
40
30
DPPH
20
SUPEROXIDE
10
0
Figure 2. IC50 values of DPPH and superoxide radicals scavenging assay (GB-1a, GB-1, GB-2,
Fukugiside, GTL- G. travancorica leaf methanol extract, ASA- standard ascorbic acid)
189
1.4
1.2
1 GTL
OD at 700 nm
0.8 GB-1a
0.6 GB-1a
0.4 GB-2
0.2 Fukugiside
0 ASA
0 50 100 150
Conentration (µg/ml)
Figure 3. Reducing power assay (GB-1a, GB-1, GB-2, Fukugiside, GTL- G. travancorica leaf
methanol extract, ASA- standard ascorbic acid)
2. Growth inhibitory effect of Fukugiside on cancer cell lines A431, HeLa, HT29 and
normal cell line WRL68 cells
MTT assay was performed by seeding ~5000 cells per well in a 96 well plate and treating
them under sub confluent conditions, with different concentrations of fukugiside such as 1
µg/mL, 10 µg/mL, 25 µg/mL, 50 µg/mL, 100 µg/mL and 150 µg/mL respectively. The
experiment was performed in batches with respect to the incubation time as 48 hrs. MTT
assay is widely used in the in vitro evaluation of the biosafety of plant extracts and
compounds. This colorimetric assay is based on the capacity of mitochondrial succinate
dehydrogenase enzymes in living cells to reduce the yellow water soluble substrate 3-(4, 5-
dimethyl thiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) into an insoluble, coloured
formazan product which is measured spectrophotometrically at 570 nm. Reduction of the dye
MTT occurs only in metabolically active cells and the level of activity is a measure of the
viability of the cells.
The study done on A431 and HeLa cells showed that fukugiside exhibited a
concentration dependent cytotoxicity to both the cell lines. The cells were incubated with
varying doses of fukugiside (1μg, 10 μg, 50 μg and 100 μg and 150 μg) and MTT assay was
performed. Fukugiside inhibited the proliferation of human epidermal cancer cell line A431
and cervical cancer cell line HeLa in a dose dependent manner. Fukugiside exhibited
significant cell death in A431 cell line with LD50 value of 150 μg/mL. Severe morphological
changes were observed in HeLa cells treated with fukugiside under phase contrast
microscope. Comparatively higher activity was exhibited by fukugiside against HeLa cells
with LD50 value of 82.80 µg/mL compared with untreated control (Figure 4). The study done
on normal liver cell line WRL68 and colorectal cancer cell line HT-29 cells treated with
varying doses of fukugiside (1μg, 10 μg, 50 μg and 100 μg and 150 μg) did not exhibit any
toxicity to the cells. From the results indicate that the compound exhibited toxicity to cancer
cell lines A431 and HeLa in a dose dependent manner and no toxicity was observed against
normal cell line WRL68.
Acridine orange/ethidium bromide (AO/EB) staining is used to visualize nuclear morphology
and apoptotic body formation that are characteristic of apoptosis. Acridine orange is an
important dye that will stain both live and dead cells, whereas ethidium bromide stain only
those cells that have lost their membrane integrity (Jayadev et al., 2004).
190
Table 2. Cell viability in Fukugiside treated A431 and HeLa cells by MTT assay
Test material % Cell viability
A431 HeLa
Control 100 100
(0.01% DMSO)
Fukugiside 1 110±3.6 85.85±0.19
(µg/mL) 10 125±4.3 64.86±3.79
50 86±3.4 56.50±2.46
100 64±3.6 43.55±0.52
150 49±3.4 39.88±.67
Values are mean±SD of three separate determinations. Cells were incubated at 37o C for 48 hrs in DMEM media
in CO2 incubator
Figure 4. HeLa cells treated with fukugiside under phase contrast microscope: (A) HeLa cells treated
with DMSO (0.01%); (B) DLA cells treated with fukugiside (50 μg/mL); (C) HeLa cells treated with
fukugiside (150 μg/mL)
To corroborate that apoptosis has been induced by fukugiside, HeLa cells were
analysed in the presence of acridine orange and ethidium bromide staining (AO/EB staining).
Five concentrations of fukugiside used in MTT assay (1μg, 10 μg, 50 μg and 100 μg and 150
μg) were chosen for this experiment. HeLa cells cultured in complete media and stained with
AO/EB (Figure 5) were used as control.
Figure 5. HeLa cells stained with acridine orange-ethidium bromide under fluorescent microscope:
(A) HeLa cells treated with DMSO (0.01%) appeared in green color (live), (B) DLA cells treated with
fukugiside (50 μg/mL) appeared in slight yellowish (early apoptotic cells), (C) HeLa cells treated with
fukugiside (150 μg/mL) appeared in yellowish red (dead cells)
Figure 5 shows that the fukugiside at tested doses induced apoptosis after 48 hours
incubation. Cells stained green represent viable cells (Figure 5A), whereas yellow staining
represented early apoptotic cells (Figure 5B) and yellow to reddish orange staining
represents late apoptotic cells (Figure 5C). As shown in Figure 5, HeLa cells treated with
150 μg/mL of fukugiside showed changes in cellular morphology, including chromatin
191
condensation and membrane blebbing. Stronger apoptosis signal was induced in HeLa cells
with higher concentrations of fukugiside.
Effect of fukugiside on cell cycle distribution by flow cytometry

Considering that fukugiside decreased cell proliferation and induced cell death as evident
from MTT assay and apoptotic induction by staining experiments, the effect of this molecule
on cell cycle distribution was analysed by flow cytometry. Flow cytometric analysis was
carried out on HeLa cells treated with 100 µg/mL of fukugiside for 48 hrs. In HeLa cells, 100
µg/mL of fukugiside induced accumulation of cells in S phase concurrently to a significant
decrease in G0/G1 cells (Figure 6).
Figure 6. Comparison of DNA content in control (0.01% DMSO) and fukugiside (100 µg/mL) treated
HeLa cells by flow cytometry
Deregulation of cell cycle is one of the critical events that drive cancer cells into
uncontrolled proliferation (Evan and Vousden, 2001). Molecular changes, including the over
expression of cyclins and CDKs and the loss of CDK inhibitors and tumor suppressor
proteins resulting from gene mutations or epigenetic inactivation, are frequently detected in
tumor cells (Sherr, 1996; Malumbres and Barbacid, 2001). Because of the important roles of
cell cycle deregulation in tumorigenesis and tumor progression, molecules involved in cell
cycle regulation also serve as potential targets for therapeutic intervention in cancers.
Modulation of p21, and MAPK/ERK pathway can have a potent role in inhibiting cells at S
phase. In the present study, addition of the compound fukugiside induced significant change
in cell proliferation and the cells were found to be arrested in S phase compared to untreated
control. The results were comparable with previous reports regarding inhibtion of MCF 7
cells by resveratrol and other flavonoid compounds in S phase (Joe et al., 2002).
Effect of fukugiside on the expression of MAPK p38 in HeLa cells

In continuation with the studies on cell cycle deregulation seen in S phase by fukugiside, the
effects of fukugiside on the level of MAPK p38 in HeLa cells were examined. A series of
time course experiments were conducted to analyse the expression of Erk in HeLa cells
treated with fukugiside, where DMSO served as control. Reverse transcription polymerase
chain reaction (RT-PCR) followed by agarose gel electrophoresis demonstrated that the
expression levels of MAPK was decreased after 48 hrs of treatment with fukugiside. The
intensity of the bands were analysed by ImageJ analyser and the results revealed that,
192
treatment with fukugiside lead to inhibition of MAPK expression by 26.15 % compared to

untreated control (Figure 6).
Figure 6. Intensity of MAPK p38 expression in agarose gel electrophoresis; (i) control, (ii) fukugiside
Conclusions
Garcinia species are well known for the diversity of secondary metabolites and potential
bioactivities. The biflavonoid fukugiside has been identified as the major antioxidant
component in G. travancorica through in vitro free radical scavenging assays and reducing
power assay. Further, the antitumor properties of the molecule in different human cancer cell
lines were also checked. Fukugiside caused a dose dependent cancer cell growth inhibition in
A431 and HeLa cells, and the antiproliferative effect appears to be due to its ability to induce
S-phase arrest and apoptotic cell death. In HeLa cells, fukugiside down regulated the MAPK
p38 expression compared with untreated control. The study highlights fukugiside as a
potential candidate for drug development.
References
1. Anu Aravind AP, Asha KRT and Rameshkumar KB. 2016. Phytochemical analysis and
antioxidant potential of the leaves of Garcinia travancorica Bedd. Nat. Prod. Res. 30 (2),
232-236.
2. Bors W, Heller W, Michel C and Saran M. 1990. Flavonoids as antioxidants:
determination of radical-scavenging efficiencies. Methods Enzymol. 186, 343-355.
3. Elya B, He HP, Kosela S, Hanafi M, Hao XJ. 2008. A new cytotoxic xanthone from
Garcinia rigida. Fitoterapia. 79, 182-184.
4. Evan GI, Vousden KH. 2001. Proliferation, cell cycle and apoptosis in cancer. Nature. 17,
342-348.
5. Gao XM, Yu T, Cui M, Pu JX, Du X, Han Q, Hu Q, Liu TC, Luo KQ, Xu HX. 2012.
Identification and evaluation of apoptotic compounds from Garcinia oligantha. Bioorg.
Med. Chem. Lett. 22, 2350-2353.
6. Guo Q, You Q, Wu Z, Yuan S, Zhao L. 2004. General gambogic acids inhibited growth
of human hepatoma SMMC-7721 cells in vitro and in nude mice. Acta Pharmacol. Sin.
25, 769-774.
7. Guo T, Wei L, Sun J, Hou C, Fan L. 2011. Antioxidant activities of extract and fractions
from Tuber indicum Cooke & Masse. Food Chem. 127, 1634-1640.
8. Han QB, Yang NY, Tian HL, Qiao CF, Song JZ, Chang DC, Chen SL, Luo KQ, Xu HX.
2008. Xanthones with growth inhibition against HeLa cells from Garcinia
xipshuanbannaensis. Phytochemistry. 69, 2187-2192.
9. Jabit ML, Khalid R, Abas F, Shaari K, Hui LS, Stanslas J, Lajis NH. 2007. Cytotoxic
Xanthones from Garcinia penangiana Pierre. Z Naturforsch C. 62, 786-792.
10. Jamila N, Khairuddean M, Khan SN, Khan N. 2014. Complete NMR assignments of
bioactive rotameric (3→8) biflavonoids from the bark of Garcinia hombroniana. Mag.
Reson. Chem. 52, 345-352.
193
11. Jantan I, Saputri FC. 2012. Benzophenones and xanthones from Garcinia cantleyana var.
cantleyana and their inhibitory activities on human low-density lipoprotein oxidation and
platelet aggregation. Phytochemistry. 80, 58-63.
12. Jayadev R, Jagan MRP, Malisetty VS, Chinthapally VR. 2004. Diosgenin, a steroid
saponin of Trigonella foenum graecum (Fenugreek), inhibits Azoxymethane-induced
aberrant crypt foci formation in F344 rats and induces apoptosis in HT-29 human colon
cancer cells. Cancer Epidemiol. Biomarkers Prev. 13, 1392-1398.
13. Joe AK, Liu H, Suzui M, Vural ME, Xiao D, Weinstein IB. 2002. Resveratrol induces
growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in
several human cancer cell lines. Clin, Cancer Res. 8, 893-903.
14. Jones S. 1980. Morphology and major taxonomy of Garcinia (Guttiferae). Ph.D.
dissertation. London, University of Leicester and British Museum, 474.
15. Lee K. 1999. Anticancer drug design based on plant-derived natural products. J. Biomed.
Sci. 6, 236-350.
16. Malumbres M, Barbacid M. 2001. To cycle or not to cycle: a critical decision in cancer.
Nat. Rev. Cancer. 1, 222-231.
17. Merza J, Aumond MC, Rondeau D, Dumontet V, Ray AML, Se´raphin D. 2004. Pascal
Richomme Prenylated xanthones and tocotrienols from Garcinia virgata. Phytochemistry.
65, 2915-2920.
18. Nema R, Khare S, Jain P, Pradhan A, Gupta A, Singh D. 2013. Natural products potential
and scope for modern cancer research. Am. J. Plant Sci. 4, 1270-1277.
19. Nguyen HD, Trinh BTD, Nguyen LHD. 2011. Guttiferones Q-S, cytotoxic
polyisoprenylated benzophenones from the pericarp of Garcinia cochinchinensis.
Phytochem. Lett. 4, 129-133.
20. Niu SL, Li ZL, Ji F, Liu GY, Zhao N, Liu XQ, Jing YK, Hua HM. 2012. Xanthones from
the stem bark of Garcinia bracteata with growth inhibitory effects against HL-60 cells.
Phytochemistry. 77, 280-286.
21. Osorio E, Londono J, Bastida J. 2013. Low-Density Lipoprotein (LDL)-Antioxidant
Biflavonoids from Garcinia madruno. Molecules. 18, 6092-6100.
22. Pan MH, Chang WL, Lin-Shiau SY, Ho CT and Lin JK. 2001. Induction of apoptosis by
garcinol and curcumin through cytochrome c release and activation of caspases in human
leukemia HL- 60 cells. J. Agric. Food Chem. 49, 1464-1474.
23. Ratty AK and Das NP. 1988. Effects of flavonoids on non-enzymic lipid peroxidation:
structure activity relationship. Biochem. Med. Metabol. Biol. 39, 69-79.
24. Reed J and Pellecchia M. 2005. Apoptosis-based therapies for hematologic malignancies.
Blood. 106, 408-418.
25. Rukachaisirikul V, Naklue W, Phongpaichit S, Towatana NH, Maneenoon K. 2006.
Phloroglucinols, depsidones and xanthones from the twigs of Garcinia parvifolia.
Tetrahedron. 62, 8578-8585.
26. Shadid KA, Shaari K, Abas F, Israf DA, Hamzah AS, Syakroni N, Saha K, Lajis NH.
2007. Cytotoxic caged-polyprenylated xanthonoids and a xanthone from Garcinia
cantleyana. Phytochemistry. 68, 2537-2544.
27. Sheldon JW, Balick M, Laird S. 1997. Medicinal Plants: Can Utilization and
Conservation Coexist?. The New York Botanical Garden XII, USA.
28. Sherr CJ. 1996. Cancer Cell Cycles. Science. 274, 1672-1677.
194
29. Taher M, Susanti D, Rezali MF, Zohri FSA, Ichwan SJA, Alkhamaiseh SI, Ahmad F.
2012. Apoptosis, antimicrobial and antioxidant activities of phytochemicals from
Garcinia malaccensis Hk.f. Asian Pacific J. Tropical Med. 5, 136-141.
30. Tannock F. 1998. Conventional cancer therapy: promise broken or promise delayed?.
Lancet. 352, 9-16.
31. Vo HT, Nguyen NTT, Nguyen HT, Do KQ, Connolly JD, Maas G, Heilmann J, Werz
UR, Pham HD, Nguyen LHD. 2012. Cytotoxic tetraoxygenated xanthones from the bark
of Garcinia schomburgkiana. Phytochem. Lett. 5, 553-557.
32. Wang JJ, Sanderson BJS, Zhang W. 2011. Cytotoxic effect of xanthones from pericarp of
the tropical fruit mangosteen (Garcinia mangostana Linn.) on human melanoma cells.
Food Chem. Toxicol. 49, 2385-2391.
33. Wang T, Wei J, Qian X, Ding Y, Yu L, Liu B. 2008. Gambogic acid, a potent inhibitor of
survivin, reverses docetaxel resistance in gastric cancer cells. Cancer Lett. 262, 214-222.
34. Wu ZQ, Guo QL, You QD, Zhao L, Gu HY. 2004. Gambogic acid inhibits proliferation
of human lung carcinoma SPC-A1 cells in vivo and in vitro and represses telomerase
activity and telomerase reverse transcriptase mRNA expression in the cells. Biol. Pharm.
Bull. 27, 1769-1774.
195
Chapter 15
Molecular Characterization of Garcinia species in the Western Ghats
A. R. Sivu1, N. S. Pradeep2,* and K. B. Rameshkumar3
1
Department of Botany, NSS College Nilamel, Kollam- 691535, Kerala, India
2
3
Thiruvananthapuram- 695 562, Kerala, India
*
Abstract
The genus Garcinia L. (Family: Clusiaceae) is an important component of the forest flora of
the Western Ghats with 9 species, of which 7 are endemic to the region. Systematics of the
genus Garcinia is primarily based on morphological data, especially reproductive
morphology and the genus is considered as a taxonomically difficult one due to the
complexity and diversity in floral characteristics. Molecular tools are getting more
acceptances as a convenient tool in the phylogenic studies of such taxonomically difficult
groups. Molecular markers are potential in portraying the genetic relationship between plant
groups and DNA based molecular taxonomic approaches give an exact and rapid method of
distinguishing specimens based on their interspecies variation. In the present study, the
genetic profile of 9 Garcinia species, G. gummi-gutta, G. rubro-echinata, G. imberti, G.
indica, G. morella, G. talbotii, G. pushpangadaniana, G. travancorica and G. wightii
distributed naturally in the Western Ghats of south India, were analyzed for better
understanding of interspecific genetic diversity. Molecular profiling using the chloroplast
coding region matK could successfully demark different species of the genus Garcinia.
Keywords: Garcinia species, Western Ghats, Molecular taxonomy, matK
Introduction
Systematics of the genus Garcinia is primarily based on reproductive morphology. However,
the field identification of Garcinias is challenging due to the presence of unisexual flowers
and strict seasonality in flowering and fruiting. The morphological assessment and variability
studies of Garcinia species demonstrated that the morphological variants are enormous
within the species with characters always overlapped within and between populations and the
genus is often treated as a taxonomically difficult group (Nimanthika and Kaththriarachchi,
2010). Combined approaches based on morphological, molecular and chemical analyses are
getting more acceptances in the phylogenic studies of such taxonomically difficult groups
(Labra et al., 2004). While classical phylogenetic approach relies on morphological
characteristics of an organism, in molecular phylogeny, the relationships among organisms
were studied by comparing nucleotide sequences of RNA and DNA and sequences of amino
acids of a protein. Dissimilarities among the sequences indicate genetic divergence as a result
of molecular evolution during the course of time. Molecular markers are a direct assay of
hereditary material and unlike morphological markers, molecular markers are not prone to
196
environmental influences and can complement data from descriptors such as morphological
characters (Patwardhan, 2014; Mba and Tohme, 2005). Further, by comparing homologous
molecules from different organisms it is possible to establish their degree of similarity,
thereby establishing or revealing a hierarchy of relationship through a phylogenetic tree.
Many plant phylogenetic studies are based on chloroplast DNA (cpDNA). In plants,
cpDNA is smallest as compared to mitochondria or nuclear genome. It is assumed to be
conserved in its evolution in terms of nucleotide substitution with very little rearrangements
which permits the molecule to be used in resolving phylogenetic relationships especially at
deep levels of evolution. Selection of a gene of sufficient length and appropriate substitution
rate is a crucial step and currently used cpDNA genes include rbcL, ndhF, rpl16, matK, atpB
and many more.
In Garcinia, preliminary molecular phylogenetic work has been started by Rismita-
Sari (2000) to test Jones (1980) classifications of Garcinia into 14 sections based mainly on
male flower characters. Gustafsson et al. discussed the phylogenetic status of the Clusiaceae
members in detail using chloroplast gene Rbcl and the study supported morphological based
classifications (Gustafsson et al., 2002). The phylogenetic relationship among mangosteen
and several wild relative species were analyzed by comparing sequences of the ITS region of
nuclear ribosomal DNA. Both parsimonious and NJ analysis revealed that mangosteen is
closely related to G. malaccensis (Chinawat and Subhadrabandu, 2004). Results from
phylogenetic analyses utilizing chloroplast and nuclear DNA markers agree with morphology
in support of the unification of all of Rheedia L. and part of Ochrocarpos Thouars
with Garcinia (Sweeney, 2008). Genetic diversity based on morphological and Inter Simple
Sequence Repeats (ISSR) of 19 accessions of mangosteen and their close relatives revealed
that G. malaccensis and G. celebia were the ancestors for mangosteen (Sulassih et al. 2013).
Rao (2003) studied both intra and inter species relationship among six Garcinia
species namely G. indica, G. cambogia (G. gummi-gutta), G. cowa, G. mangostana, G.
xanthochymus and G. hombroniana, using RAPD polymorphism. RAPD markers could
successfully distinguish different species of the genus Garcinia. The study indicated high
molecular diversity within G. cambogia (Rao, 2003). Parthasarathy et al. studied RAPD
polymorphism in 33 accessions of Garcinia species collected from different areas of Western
Ghats (Parthasarathy et al., 2013). The dendrogram clearly separated the collections of the 3
main species studied, G. gummi-gutta, G. indica and G. xanthochymus, and suggested high
amount of diversity within the collections of the same species. Similar study was also
conducted on Garcinia collections from North East India using RAPD. High molecular
diversity was observed with the heterogeneity index within species ranging from 0.81 to 0.82
in four species, namely G. gummi-gutta, G. indica, G. cowa and G. xanthochymus
(Parthasarathy et al., 2013).
Though Western Ghats is a centre of diversity of Garcinia species, a comprehensive
study on the molecular profiles of Garcinia species of the region including the rare and
endemic species has rarely been attempted. Present chapter discusses the molecular
characterization of Garcinia species naturally occurring in the Western Ghats region, using
chloroplast coding region matK.
197
1. Genomic DNA isolation and sequencing

Genomic DNA was isolated from young leaves using DNeasy plant DNA isolation kit
(Qiagen). PCR amplification reactions were carried out in a 20 µl reaction volume which
contained 1X PCR buffer (150mM Tris HCl, pH-8; 500mM KCl), 0.2mM each dNTPs,
2.5mM MgCl2, 20ng DNA, 1 unit of Ampli Taq Gold DNA polymerase enzyme, 0.1 mg/ml
BSA and 4% DMSO, 5pM of forward and reverse primers (Table:01). The PCR
amplification was carried out in a PCR thermal cycler (GeneAmp PCR System 9700, Applied
Biosystems) with an initial denaturation of 95o C for 5.00 min. followed by 40 cycles of 48o C
for 0.40 min, 72o C for 1.00 min and 72o C for 5.00 min., followed by 4oC. PCR amplification
(Figure 1) was followed by sequencing using the BigDye Terminator v 3.1. The sequence
quality was checked using Sequence Scanner Software v1 (Applied Biosystems). Sequence
alignment and required editing of the obtained sequences were carried out using Geneious
Pro v 5.6.
Table1. Primers used for the molecular study of Garcinia species

Target Primer Direction Sequence (5’  3’) Reference
Name
matK matK- CBOL Plant Working Group
Forward CGATCTATTCATTCAATATTTC
390F (http://www.barcoding.si.edu
matK- /pdf/informationonbarcodeloci.pdf
Reverse TCTAGCACACGAAAGTCGAAGT
1326R
Figure 1. PCR products- matK region of nine Garcinia species
2. Sequence analysis
The phylogenetic analyses of 9 Garcinia species distributed naturally in the Western Ghats
were done using MatK with Clusia criuva of Clusiaceae family as the out group member
(ncbi-TNS:SK08071206). The evolutionary history was inferred using Neighbor-Joining
method as elaborated by Saitou and Nei (1987). The optimal tree with the sum of branch
length 0.093 is shown in Figure 2. The percentages of replicate trees in which the associated
taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches
(Felsenstein, 1985). The tree was drawn to scale, with branch lengths in the same units as
those of the evolutionary distances used, to infer the phylogenetic tree. The evolutionary
distances were computed using the Kimura 2-parameter method (Kimura, 1980) and are in
the units of the number of base substitutions per site. All positions containing gaps and
198
missing data were eliminated. There were a total of 802 positions in the final dataset.
Evolutionary analyses were conducted in MEGA5 (Tamura et al., 2011).
95 G.wightii
90 G.morella
G.indica
74
83 G.imberti
72 G.gummi-gutta
73 G.travancorica
G.rubero-echinata
G.talbolti
91 G.pushpangadaniana
Clusia criuva
Figure 2. NJ- Phylogram based on matK loci of 9 species of Garcinia and the out group Clusia
criuva.
All the accessions of the Garcinia species were clustered together in the NJ phylogram based
on matK loci and the phylogram distinctly delimit all the 9 species and were also clearly
differentiated from the out group Clusia criuva. In the first clad the accessions of G. morella
and G. wightii were clustered together with a bootstrap value of 95%. The second clad
includes G. indica and G. imberti and showed sister relationship with 83% bootstrap support.
The third clad includes two sub clusters with G. travancorica in one cluster and G. gummi-
gutta in the second cluster with bootstrap value of 73%. The fourth cluster is purely
monophyletic with G. rubro-echinata. The fifth cluster includes G. talbotii and a recently
published species G. pushpangadaniana with bootstrap value of 91%.
Generally, the classical morphology based classification and molecular analysis based
classification complement each other since morphology of an organism is the manifestation
of its genome, proteome and transcriptome profiles. The results of the current molecular
study are in part congruent with the classification based on morphological features (Chapter
1). The species status of G. pushpangadaniana is confirmed and also its allied nature to G.
talbotii (Sabu et al., 2013). G. pushpangadaniana and G. talbotii were morphologically
distinct from other species by the characteristic features of stamens in 5 phalanges and 5
numbered sepals and petals. G. morella and G. wightii that showed as a separate clad in
molecular phylogeny were allied and distinct from other species based on sessile fruits and 4
lobed stigma. G. rubro-echinata also stands distinct based on morphological features with
echinate fruits and supports the monophyletic nature of G. rubro-echinata in the molecular
phylogram. Combined multidisciplinary analysis of vegetative and reproductive morphology,
along with molecular taxonomy yield more robust phylogeny which could be used for studies
of phytogeography and evolutionary radiation of the Garcinia species.
Conclusions
The genus Garcinia is one of the taxa with poorly resolved phylogenetic relationships.
Although widely practised even now, traditional morphology based systems of classification
can have some limitations while systematics based on molecular markers can complement the
traditional morphology based method for phylogenetic studies. Further, the genetic profile of
199
the Garcinia species of the Western Ghats can be used to solve the taxonomic enigmas and
for analyzing the phylogeny of the group. The present work shows that the Garcinia species
can be distinctly identified by the phylogram based on matK loci of the Garcinia species and
molecular profiling has been successfully used to resolve species circumscriptions and
identification of Garcinia species in the Western Ghats.
References
1. CBOL Plant Working Group (http://www.barcoding.si.edu/plant_working_group.html).
BigDye Terminator v3.1 Cycle sequencing Kit- User Manual, Applied Biosystems.
2. Chinawat Y and Subhadrabhanu S. 2004. Phylogenetic relationship of Mangosteen and
several wild relatives revealed by ITS Sequence data. J. Amer. Soc. Hort. Soc., 129 (3),
368-373.
3. Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap.
Evolution, 39, 783-791.
4. Gustafsson MH, Bittrich V and Stevens PF. 2002. Phylogeny of Clusiaceae based on rbcL
sequences. Int. J. Plant Sc., 163(6), 1045-1054.
5. Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions
through comparative studies of nucleotide sequences. J. Mol. Evol., 16,111-120.
7. Mba C and Tohme J. 2005. Use of AFLP markers in surveys of plant diversity. Meth.
Enzymol., 395, 177-201.
8. Nimanthika WJ, Kaththriarachchi HS. 2010. Systematics of genus Garcinia L.
(Clusiaceae) in Sri Lanka. New insights from vegetative morphology. Journal of National
Science Foundation, 38, 29-44.
9. Parthasarathy U, Nandakishore OP, Kumar S and Parthasarathy VA. 2013. Comparative
effectiveness of inter-simple sequence repeat and randomly amplified polymorphic DNA
markers to study genetic diversity of Indian Garcinia. Afr. J. Biotech., 12(46), 6443.
10. Patwardhan A, Ray S and Roy A. 2014. Molecular markers in phylogenetic studies- A
Review. J. Phylogen. Evolution. Biol. 2, 131.
11. Rao PVV. 2003. Molecular characterization of Garcinia using RAPD polymorphism.
M.Sc. Dissertation. Nagarjuna University, Andhra Pradesh, India.
12. Rismita-Sari. 2000. Review of Garcinia (Clusiaceae) Based on Molecular Systematics.
In: A Phylogenetic study of molecular data of Garcinia spp. M. Sc. Thesis, Department of
Tropical Plant Science, School of Tropical Biology, James Cook University.
13. Sabu T, Mohanan N, Krishnaraj MV, Shareef SM, Shameer PS and Roy PE 2013.
Garcinia pushpangadaniana, (Clusiaceae) a new species from southern Western Ghats,
India. Phytotaxa, 116 (2), 51-56.
14. Saitou N. and Nei M. 1987. The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Mol. Biol. Evol., 4, 06-25.
15. Sulassih, Sohr and Santosa E. 2013. Phylogenetic analysis of mangosteen and its relatives
based on Morphological and ISSR markers. SABRAO J. Breeding Gen., 45 (30), 478-490.
and relatives. Int. J. Plant Sc., 169(9), 1288-1303.
200
17. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. 2011. MEGA5:
Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary
Distance, and Maximum Parsimony Methods. Mol. Biol. Evol., 28(10), 2731-2739.
201
List of Authors
1. Ananthakrishanan R.
Palode, Thiruvananthapuram 695562, Kerala, India
E mail: ananthanr3@gmail.com
Mobile No.: 9495340654
2. Anju V.
E mail: av.anjuv@gmail.com
Mobile No.: 9526568757
3. Anu Aravind A. P.
E mail: anumbc@gmail.com
Mobile No.: 9496324376
4. Brijesh Kumar
Sophisticated Analytical Instrument Facility
CSIR-Central Drug Research Institute, Lucknow-226031, Uttar Pradesh, India
E mail: gbrikum@yahoo.com
Mobile No.: 7800188889
5. George V.
Amity Institute of Phytochemistry and Phytomedicine
Peroorkada, Thiruvananthapuram 695 005, Kerala, India
E mail: georgedrv@yahoo.co.in
Mobile No.: 9447041156
6. Lekshmi N. Menon
E mail: lekshminmenon@gmail.com
Mobile No.: 8590235085
7. Mohanan N.
E mail: nmohanan59@gmail.com
Mobile No.: 9496103427
202
8. Nandakishore O. P.
E mail: opnandan@gmail.com
Mobile No.: 9446906839
9. Nandu T. G.
E mail: tg.nandu@gmail.com
Mobile No.: 9496354892
10. Pradeep N. S.
E mail: drnspradeep@gmail.com
Mobile No.: 9446093865
11. Rameshkumar K. B.
E mail:kbrtbgri@gmail.com
Mobile No.: 9446376431
12. RenuPandey
Sophisticated Analytical Instrument Facility
CSIR-Central Drug Research Institute, Lucknow-226031, Uttar Pradesh, India
E mail: renupandeyji@gmail.com
Mobile No.: 09411516510
13. Sabu T.
E mail: sabutbgri71@gmail.com
Mobile No.: 9447054118
14. Shameer P. S.
E mail: shameershameerps@gmail.com
Mobile No.: 9400796358
15. Shiburaj S.
E mail: drshiburaj@gmail.com
Mobile No.: 9495826669
203
16. Siji Aral

E mail: sijiaraal@gmail.com
Mobile No.: 8547511746
17. Sivu A. R.
Department of Botany
NSS College Nilamel, Kollam- 691535, Kerala, India
E mail: sivuar@gmail.com
Mobile No.: 9495592939
18. UtpalaParthasarathy
E mail: utpala@spices.res.in; utpalap@gmail.com
Mobile No.: 9446073162
204

Diversity Garcinia Species in The Western Ghats. Phytochemical Perspective

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Diversity Garcinia Species in The Western Ghats. Phytochemical Perspective

Uploaded by

Copyright:

Available Formats

Diversity of Garcinia species in the Western Ghats:

Jawaharlal Nehru Tropical Botanic Garden and Research Institute

ISBN No.: 978-81-924674-5-0

Printed at: Akshara Offset, Thiruvananthapuram- 695 035

Copyright © 2016: Editor and Publisher

Prof. Dr. V. George Ph.D., FRSC

1 Diversity of Garcinia species in the Western Ghats 1

Diversity of Garcinia species in the Western Ghats

P. S. Shameer1, K. B. Rameshkumar2 and N. Mohanan1,*

Key words: Garcinia, Clusiaceae, Western Ghats, Diversity, Conservation

Maheshwari in 1964, describes 31 species as naturally distributed in India (Maheshwari,

1. Distribution of Garcinia species in the Western Ghats

According to Anderson (1874), Maheshwari (1964) and Singh (1993) Garcinia

3.1. Diversity in floral morphology

3.2. Diversity in branching and bark exudates

3.3. Diversity in leaf morphology

3.4. Diversity in fruit morphology

4. Key to the Garcinia species of the Western Ghats

5. Western Ghats Garcinia species

Garcinia gummi-gutta var. papilla (Wight) N. P. Singh

Garcinia gummi-gutta var. conicarpa (Wight) N. P. Singh

5.2. Garcinia imberti Bourd.

5.3. Garcinia indica (Thouars) Choisy

5.4. Garcinia morella (Gaertn.) Desr.

5.5. Garcinia pushpangadaniana T. Sabu, N. Mohanan, Krishnaraj and Shareef

5.6. Garcinia rubro-echinata Kosterm.

5.7. Garcinia talbotii Raizada ex Santapau

ii. Leaves usually ovate.

5.9. Garcinia wightii T. Anderson

Structural diversity of secondary metabolites in Garcinia species

A. P. Anu Aravind, Lekshmi N. Menon and K. B. Rameshkumar*

Phytochemistry and Phytopharmacology Division

Keywords: Garcinia, Secondary metabolites, Xanthones, Biflavonoids, Benzophenones

Figure 1. Numbering in typical xanthone structure

Xanthones are limited in distribution to a few plant families such as Clusiaceae,

Table 1. Xanthones reported from Garcinia species

Stem bark 1,4,5,6-Tetrahydroxy xanthone, bracteaxanthones Niu et al, 2012

7-O-Methyl garcinone E Likhitwitayawu

1,3.6-Trihydroxy-7-methoxy-8-(3,7-dimethyl)-2,6- Lee et al.,1977

(3-methyl-2-butenyl)xanthone, cowaxanthone, al., 2005

Fruit Oxy-guttiferone K , oxy-guttiferone K2 Masullo et al,

isomangostin, R-mangostin, γ-mangostin,

Aril and 1,7-Dihydroxy-3-methoxy- 2-(3-methylbut-2- Wittenauer et

41 G. nigrolineata Leaf Nigrolineaxanthones J-S Rukachaisirikul

Root bark Garciniaxanthone I, smeathxanthone Lannang et al.,

52 G. propinqua Twig Doitunggarcinone C, dulxanthone B, 5-O- Tantapakul et

53 G. Leaf Cambogic acid and mangostin Pandey et al.,

72 G. wightii Leaf Cambogic acid and mangostin Pandey et al.,

Figure 3. Typical benzophenone (maclurin) and bicyclo-[3.3.1]-nonane 2,4,9-trione structure

Recent developments in phytochemical analytical methods, especially the hyphenated LC-

Semsinone B Garcinol Guttiferone A

Figure 4. The simple benzophenone (semsinone B) and the bicyclo-[3.3.1]-nonane

Table 2. Benzophenones reported from Garcinia species

Fruit Guttiferone A, xanthochymol, and Acuna et al.,

3,4,5,3’,5’-pentahydroxybenzophenone, and 2012

Fruit 13,14-Didehydoxyisogarcinol, garcimultiflorone Chen et al.,

38 G. schomburgkiana Fruit Schomburgkianones A-H Le et al., 2016

Guttiferone A, xanthochymol, and Acuna et al.,

Figure 5. Numbering in typical biflavonoid structure

Figure 6. Structures of I(3)-II(8) linked biflavonones (GB1), flavanone-flavone (morelloflavone),

Table 3. Biflavonoids reported from Garcinia species

Dulcisbiflavonoid A Saelee et al.,

GB-1, GB-2, and manniflavanone Crichton et al.,